Search Results

Search found 3758 results on 151 pages for 'efficient'.

Page 13/151 | < Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >

  • Ruby efficient way of building an array from an array of arrays

    - by randombits
    I have an array of ActiveRecord objects, each one which has its own respective errors array. I want to flatten it all out and get only the unique values into one array. So the top level array might look like: foo0 = Foo.new foo1 = Foo.new foo2 = Foo.new foo3 = Foo.new arr = [foo0, foo1, foo2, foo3] Each one of those objects could potentially have an array of errors, and I'd like to get just the unique message out of them and put them in another array, say called error_arr. How would you do it the "Ruby" way?

    Read the article

  • How to shift pixels of a pixmap efficient in Qt4

    - by stanleyxu2005
    Hello, I have implemented a marquee text widget using Qt4. I painted the text content onto a pixmap first. And then paint a portion of this pixmap onto a paint device by calling painter.drawTiledPixmap(offsetX, offsetY, myPixmap) My Imagination is that, Qt will fill the whole marquee text rectangle with the content from myPixmap. Is there a ever faster way, to shift all existing content to left by 1px and than fill the newly exposed 1px wide and N-px high area with the content from myPixmap?

    Read the article

  • More efficient method for grabbing all child units

    - by Hazior
    I have a table in SQL that links to itself through parentID. I want to find the children and their children and so forth until I find all the child objects. I have a recursive function that does this but it seems very ineffective. Is there a way to get sql to find all child objects? If so how?

    Read the article

  • What's the most efficient query?

    - by Aaron Carlino
    I have a table named Projects that has the following relationships: has many Contributions has many Payments In my result set, I need the following aggregate values: Number of unique contributors (DonorID on the Contribution table) Total contributed (SUM of Amount on Contribution table) Total paid (SUM of PaymentAmount on Payment table) Because there are so many aggregate functions and multiple joins, it gets messy do use standard aggregate functions the the GROUP BY clause. I also need the ability to sort and filter these fields. So I've come up with two options: Using subqueries: SELECT Project.ID AS PROJECT_ID, (SELECT SUM(PaymentAmount) FROM Payment WHERE ProjectID = PROJECT_ID) AS TotalPaidBack, (SELECT COUNT(DISTINCT DonorID) FROM Contribution WHERE RecipientID = PROJECT_ID) AS ContributorCount, (SELECT SUM(Amount) FROM Contribution WHERE RecipientID = PROJECT_ID) AS TotalReceived FROM Project; Using a temporary table: DROP TABLE IF EXISTS Project_Temp; CREATE TEMPORARY TABLE Project_Temp (project_id INT NOT NULL, total_payments INT, total_donors INT, total_received INT, PRIMARY KEY(project_id)) ENGINE=MEMORY; INSERT INTO Project_Temp (project_id,total_payments) SELECT `Project`.ID, IFNULL(SUM(PaymentAmount),0) FROM `Project` LEFT JOIN `Payment` ON ProjectID = `Project`.ID GROUP BY 1; INSERT INTO Project_Temp (project_id,total_donors,total_received) SELECT `Project`.ID, IFNULL(COUNT(DISTINCT DonorID),0), IFNULL(SUM(Amount),0) FROM `Project` LEFT JOIN `Contribution` ON RecipientID = `Project`.ID GROUP BY 1 ON DUPLICATE KEY UPDATE total_donors = VALUES(total_donors), total_received = VALUES(total_received); SELECT * FROM Project_Temp; Tests for both are pretty comparable, in the 0.7 - 0.8 seconds range with 1,000 rows. But I'm really concerned about scalability, and I don't want to have to re-engineer everything as my tables grow. What's the best approach?

    Read the article

  • Good data structure for efficient insert/querying on arbitrary properties

    - by Juliet
    I'm working on a project where Arrays are the default data structure for everything, and every query is a linear search in the form of: Need a customer with a particular name? customer.Find(x => x.Name == name) Need a customer with a particular unique id? customer.Find(x => x.Id == id) Need a customer of a particular type and age? customer.Find(x => x is PreferredCustomer && x.Age >= age) Need a customer of a particular name and age? customer.Find(x => x.Name == name && x.Age == age) In almost all instances, the criteria for lookups is well-defined. For example, we only search for customers by one or more of the properties Id, Type, Name, or Age. We rarely search by anything else. Is a good data structure to support arbitrary queries of these types with lookup better than O(n)? Any out-of-the-box implementations for .NET?

    Read the article

  • Is there a more efficient way to retrieve tables from websites using wpf + webclient

    - by Jordan Brooker
    new to the community, but here is my first question that I am stuck on. I am new to WPF and WebClient using c# and I am attempting to make a program that access www.nba.com to populate a combobox I have with team names, and then when a user selects a team from the combobox, I wanted to populate a portion of the main window with the roster from the teams home site, same style and eveything. I was able to populate the combobox using the WebClient.OpenRead and reading in the markup to extract the team names. Now I am on the more difficult part. I was planning on using the same method to grab all the markup and then somehow display the table in a content panel, but I feel that this is a very tedious thing to do. Can anyone give me any tips for completing this action or is there a method in the webclient class that allows me to search a webpage for a table or object other than text? Thanks.

    Read the article

  • Efficient Clojure workflow?

    - by Alex B
    I am developing a pet project with Clojure, but wonder if I can speed up my workflow a bit. My current workflow (with Compojure) is: Start Swank with lein swank. Go to Emacs, connect with M-x slime-connect. Load all existing source files one by one. This also starts a Jetty server and an application. Write some code in REPL. When satisfied with experiments, write a full version of a construct I had in mind. Eval (C-c C-c) it. Switch REPL to namespace where this construct resides and test it. Switch to browser and reload browser tab with the affected page. Tweak the code, eval it, check in the browser. Repeat any of the above. There are a number of annoyances with it: I have to switch between Emacs and the browser (or browsers if I am testing things like templating with multiple browsers) all the time. Is there a common idiom to automate this? I used to have a JavaScript bit that reloads the page continuously, but it's of limited utility, obviously, when I have to interact with the page for more than a few seconds. My JVM instance becomes "dirty" when I experiment and write test functions. Basically namespaces become polluted, especially if I'm refactoring and moving the functions between namespaces. This can lead to symbol collisions and I need to restart Swank. Can I undef a symbol? I load all source files one by one (C-c C-k) upon restarting Swank. I suspect I'm doing it all wrong. Switching between the REPL and the file editor can be a bit irritating, especially when I have a lot of Emacs tabs open, alongside the browser(s). I'm looking for ways to improve the above points and the entire workflow in general, so I'd appreciate if you'd share yours. P. S. I have also used Vimclojure before, so Vimclojure-based workflows are welcome too.

    Read the article

  • Python: Most efficient way to concatenate and rearrange files

    - by user300890
    Hi, I am reading from several files, each file is divided into 2 pieces, first a header section of a few thousand lines followed by a body of a few thousand. My problem is I need to concatenate these files into one file where all the headers are on the top followed by the body. Currently I am using two loops; one to pull out all the headers and write them, and the second to write the body of each file (I also include a tmp_count variable to limit the number of lines to be loading into memory before dumping to file). This is pretty slow - about 6min for 13gb file. Can anyone tell me how to optimize this or if there is a faster way to do this in python ? Thanks! Here is my code: def cat_files_sam(final_file_name,work_directory_master,file_count): final_file = open(final_file_name,"w") if len(file_count) > 1: file_count=sort_output_files(file_count) # only for @ headers for bowtie_file in file_count: #print bowtie_file tmp_list = [] tmp_count = 0 for line in open(os.path.join(work_directory_master,bowtie_file)): if line.startswith("@"): if tmp_count == 1000000: final_file.writelines(tmp_list) tmp_list = [] tmp_count = 0 tmp_list.append(line) tmp_count += 1 else: final_file.writelines(tmp_list) break for bowtie_file in file_count: #print bowtie_file tmp_list = [] tmp_count = 0 for line in open(os.path.join(work_directory_master,bowtie_file)): if line.startswith("@"): continue if tmp_count == 1000000: final_file.writelines(tmp_list) tmp_list = [] tmp_count = 0 tmp_list.append(line) tmp_count += 1 final_file.writelines(tmp_list) final_file.close()

    Read the article

  • most efficient method of turning multiple 1D arrays into columns of a 2D array

    - by Ty W
    As I was writing a for loop earlier today, I thought that there must be a neater way of doing this... so I figured I'd ask. I looked briefly for a duplicate question but didn't see anything obvious. The Problem: Given N arrays of length M, turn them into a M-row by N-column 2D array Example: $id = [1,5,2,8,6] $name = [a,b,c,d,e] $result = [[1,a], [5,b], [2,c], [8,d], [6,e]] My Solution: Pretty straight forward and probably not optimal, but it does work: <?php // $row is returned from a DB query // $row['<var>'] is a comma separated string of values $categories = array(); $ids = explode(",", $row['ids']); $names = explode(",", $row['names']); $titles = explode(",", $row['titles']); for($i = 0; $i < count($ids); $i++) { $categories[] = array("id" => $ids[$i], "name" => $names[$i], "title" => $titles[$i]); } ?> note: I didn't put the name = value bit in the spec, but it'd be awesome if there was some way to keep that as well.

    Read the article

  • Efficient storage/retrieval method for replayable comet style applications (Google Wave, Etherpad)

    - by Gareth Simpson
    I am considering a web application that would have the same kind of multi user, automatic saving, infinite undo / replay capabilities that you see in Google Wave and Etherpad (albeit on a drastically smaller scale and userbase). Before I go away and reinvent the wheel, is this something that has already been addressed as either a piece of technology or library, or even just a design pattern. I know this isn't necessarily the best Stack Overflow question as there is probably not a "right" answer, but my Google-fu has failed me and I'd just like a reading list! Ordinarily I would be developing under python/django but this is not a firm requirement just a preference :)

    Read the article

  • Efficient algorithm for Next button on a MySQL result set

    - by David Grayson
    I have a website that lets people view rows in a table (each row is a picture). There are more than 100,000 rows. You can view different subsets of the rows, and you can view them with different sort orders. While you are viewing one of the rows, you can click the "Next" or "Previous" buttons to go the next/previous row in the list. How would you implement the "Next" and "Previous" features of the website? More specifically, if you have an arbitrary query that returns a list of up to 100,000+ rows, and you know some information about the current row someone is viewing, how do you determine the NEXT row efficiently? Here is the pseudo-code of the solution I came up with when the website was young, and it worked well when there were only 1000 rows, but now that there are 100,000 rows I think it is eating up too much memory. int nextRowId(string query, int currentRowId) { array allRowIds = mysql_query(query); // Takes up a lot of memory! int currentIndex = (index of currentRowId in allRowIds); // Takes time! return allRowIds[currentIndex+1]; } While you are thinking about this problem, remember that the website can store more information about the current row than just its ID (for example, the position of the current row in the result set), and this information can be used as a hint to help determine the ID of the next row. Edit: Sorry for not mentioning this earlier, but this isn't just a static website: rows can often be added to the list, and rows can be re-ordered in the list. (Much rarer, rows can be removed from the list.) I think that I should worry about that kind of thing, but maybe you can convince me otherwise.

    Read the article

  • Memory efficient collection class

    - by Joe
    I'm building an array of dictionaries (called keys) in my iphone application to hold the section names and row counts for a tableview. the code looks like this: [self.results removeAllObjects]; [self.keys removeAllObjects]; NSUInteger i,j = 0; NSString *key = [NSString string]; NSString *prevKey = [NSString string]; if ([self.allResults count] > 0) { prevKey = [NSString stringWithString:[[[self.allResults objectAtIndex:0] valueForKey:@"name"] substringToIndex:1]]; for (NSDictionary *theDict in self.allResults) { key = [NSString stringWithString:[[theDict valueForKey:@"name"] substringToIndex:1]]; if (![key isEqualToString:prevKey]) { NSDictionary *newDictionary = [NSDictionary dictionaryWithObjectsAndKeys: [NSNumber numberWithInt:i],@"count", prevKey,@"section", [NSNumber numberWithInt:j], @"total",nil]; [self.keys addObject:newDictionary]; prevKey = [NSString stringWithString:key]; i = 1; } else { i++; } j++; } NSDictionary *newDictionary = [NSDictionary dictionaryWithObjectsAndKeys: [NSNumber numberWithInt:i],@"count", prevKey,@"section", [NSNumber numberWithInt:j], @"total",nil]; [self.keys addObject:newDictionary]; } [self.tableview reloadData]; The code works fine first time through but I sometimes have to rebuild the entire table so I redo this code which orks fine on the simulator, but on my device the program bombs when I execute the reloadData line : malloc: *** mmap(size=3772944384) failed (error code=12) *** error: can't allocate region *** set a breakpoint in malloc_error_break to debug malloc: *** mmap(size=3772944384) failed (error code=12) *** error: can't allocate region *** set a breakpoint in malloc_error_break to debug Program received signal: “EXC_BAD_ACCESS”. If I remove the reloadData line the code works on the device. I'm wondering if this is something to do with the way I've built the keys array (ie using autoreleased strings and dictionaries).

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Efficient implementation of natural logarithm (ln) and exponentiation

    - by Donotalo
    Basically, I'm looking for implementation of log() and exp() functions provided in C library <math.h>. I'm working with 8 bit microcontrollers (OKI 411 and 431). I need to calculate Mean Kinetic Temperature. The requirement is that we should be able to calculate MKT as fast as possible and with as little code memory as possible. The compiler comes with log() and exp() functions in <math.h>. But calling either function and linking with the library causes the code size to increase by 5 Kilobytes, which will not fit in one of the micro we work with (OKI 411), because our code already consumed ~12K of available ~15K code memory. The implementation I'm looking for should not use any other C library functions (like pow(), sqrt() etc). This is because all library functions are packed in one library and even if one function is called, the linker will bring whole 5K library to code memory.

    Read the article

  • Efficient persistent storage for simple id to table of values map for java

    - by wds
    I need to store some data that follows the simple pattern of mapping an "id" to a full table (with multiple rows) of several columns (i.e. some integer values [u, v, w]). The size of one of these tables would be a couple of KB. Basically what I need is to store a persistent cache of some intermediary results. This could quite easily be implemented as simple sql, but there's a couple of problems, namely I need to compress the size of this structure on disk as much as possible. (because of amount of values I'm storing) Also, it's not transactional, I just need to write once and simply read the contents of the entire table, so a relational DB isn't actually a very good fit. I was wondering if anyone had any good suggestions? For some reason I can't seem to come up with something decent atm. Especially something with an API in java would be nice.

    Read the article

  • Writing shorter code/algorithms, is more efficient (performance)?

    - by Carlos
    After coming across the code golf trivia around the site it is obvious people try to find ways to write code and algorithms as short as the possibly can in terms of characters, lines and total size, even if that means writing something like: n=input() while n>1:n=(n/2,n*3+1)[n%2];print n So as a beginner I start to wonder whether size actually matters :D. It is obviously a very subjective question highly dependent on the actual code being used, but what is the rule of thumb in the real world. In the case that size wont matter, how come then we don't focus more on performance rather than size?

    Read the article

  • efficient android rendering

    - by llll
    I've read quite a few tutorials on game programming on android, and all of them provide basically the same solution as to drawing the game, that is having a dedicated thread spinning like this: public void run() { while(true) { if(!surfaceHolder.getSurface().isValid()) continue; Canvas canvas = surfaceHolder.lockCanvas(); drawGame(canvas); /* do actual drawing here */ surfaceHolder.unlockCanvasAndPost(canvas); } } now I'm wondering, isn't this wasteful? Suppose I've a game with very simple graphics, so that the actual time in drawGame is little; then I'm going to draw the same things on and on, stealing cpu from the other threads; a possibility could be skipping the drawing and sleeping a bit if the game state hasn't changed, which I could check by having the state update thread mantaining a suitable status flag. But maybe there are other options. For example, couldn'it be possible to synchronize with rendering, so that I don't post updates too often? Or am I missing something and that is precisely what lockCanvas does, that is it blocks and burns no cpu until proper time? Thanks in advance L.

    Read the article

  • More efficient R / Sweave / TeXShop work-flow?

    - by user594795
    I've now got everything to work properly on my Mac OS X 10.6 machine so that I can create decent looking LaTeX documents with Sweave that include snippets of R code, output, and LaTeX formatting together. Unfortunately, I feel like my work-flow is a bit clunky and inefficient: Using TextWrangler, I write LaTeX code and R code (surrounded by <<= above and @ below R code chunk) together in one .Rnw file. After saving changes, I call the .Rnw file from R using the Sweave command Sweave(file="/Users/mymachine/Documents/Assign4.Rnw", syntax="SweaveSyntaxNoweb") In response, R outputs the following message: You can now run LaTeX on 'Assign4.tex' So then I find the .tex file (Assign4.tex) in the R directory and copy it over to the folder in my documents ~/Documents/ where the .Rnw file is sitting (to keep everything in one place). Then I open the .tex file (e.g. Assign4.tex) in TeXShop and compile it there into pdf format. It is only at this point that I get to see any changes I have made to the document and see if it 'looks nice'. Is there a way that I can compile everything with one button click? Specifically it would be nice to either call Sweave / R directly from TextWrangler or TeXShop. I suspect it might be possible to code a script in Terminal to do it, but I have no experience with Terminal. Please let me know if there's any other things I can do to streamline or improve my work flow.

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >