Search Results

Search found 362 results on 15 pages for 'lookups'.

Page 13/15 | < Previous Page | 9 10 11 12 13 14 15  | Next Page >

  • Seven Worlds will collide…. High Availability BI is not such a Distant Sun.

    - by Testas
    Over the last 5 years I have observed Microsoft persevere with the notion of Self Service BI over a series of conferences as far back as SQLBits V in Newport. The release of SQL Server 2012, improvements in Excel and the integration with SharePoint 2010 is making this a reality. Business users are now empowered to create their own BI reports through a number of different technologies such as PowerPivot, PowerView and Report Builder. This opens up a whole new way of working; improving staff productivity, promoting efficient decision making and delivering timely business reports. There is, however; a serious question to answer. What happens should any of these applications become unavailable? More to the point, how would the business react should key business users be unable to fulfil reporting requests for key management meetings when they require it?  While the introduction of self-service BI will provide instant access to the creation of management information reports, it will also cause instant support calls should the access to the data become unavailable. These are questions that are often overlooked when a business evaluates the need for self-service BI. But as I have written in other blog posts, the thirst for information is unquenchable once the business users have access to the data. When they are unable to access the information, you will be the first to know about it and will be expected to have a resolution to the downtime as soon as possible. The world of self-service BI is pushing reporting and analytical databases to the tier 1 application level for some of Coeo’s customers. A level that is traditionally associated with mission critical OLTP environments. There is recognition that by making BI readily available to the business user, provisions also need to be made to ensure that the solution is highly available so that there is minimal disruption to the business. This is where High Availability BI infrastructures provide a solution. As there is a convergence of technologies to support a self-service BI culture, there is also a convergence of technologies that need to be understood in order to provide the high availability architecture required to support the self-service BI infrastructure. While you may not be the individual that implements these components, understanding the concepts behind these components will empower you to have meaningful discussions with the right people should you put this infrastructure in place. There are 7 worlds that you will have to understand to successfully implement a highly available BI infrastructure   1.       Server/Virtualised server hardware/software 2.       DNS 3.       Network Load Balancing 4.       Active Directory 5.       Kerberos 6.       SharePoint 7.       SQL Server I have found myself over the last 6 months reaching out to knowledge that I learnt years ago when I studied for the Windows 2000 and 2003 (MCSE) Microsoft Certified System Engineer. (To the point that I am resuming my studies for the Windows Server 2008 equivalent to be up to date with newer technologies) This knowledge has proved very useful in the numerous engagements I have undertaken since being at Coeo, particularly when dealing with High Availability Infrastructures. As a result of running my session at SQLBits X and SQL Saturday in Dublin, the feedback I have received has been that many individuals desire to understand more of the concepts behind the first 6 “worlds” in the list above. Over the coming weeks, a series of blog posts will be put on this site to help understand the key concepts of each area as it pertains to a High Availability BI Infrastructure. Each post will not provide exhaustive coverage of the topic. For example DNS can be a book in its own right when you consider that there are so many different configuration options with Forward Lookup, Reverse Lookups, AD Integrated Zones and DNA forwarders to name some examples. What I want to do is share the pertinent points as it pertains to the BI infrastructure that you build so that you are equipped with the knowledge to have the right discussion when planning this infrastructure. Next, we will focus on the server infrastructure that will be required to support the High Availability BI Infrastructure, from both a physical box and virtualised perspective. Thanks   Chris

    Read the article

  • SPARC M7 Chip - 32 cores - Mind Blowing performance

    - by Angelo-Oracle
    The M7 Chip Oracle just announced its Next Generation Processor at the HotChips HC26 conference. As the Tech Lead in our Systems Division's Partner group, I had a front row seat to the extraordinary price performance advantage of Oracle current T5 and M6 based systems. Partner after partner tested  these systems and were impressed with it performance. Just read some of the quotes to see what our partner has been saying about our hardware. We just announced our next generation processor, the M7. This has 32 cores (up from 16-cores in T5 and 12-cores in M6). With 20 nm technology  this is our most advanced processor. The processor has more cores than anything else in the industry today. After the Sun acquisition Oracle has released 5 processors in 4 years and this is the 6th.  The S4 core  The M7 is built using the foundation of the S4 core. This is the next generation core technology. Like its predecessor, the S4 has 8 dynamic threads. It increases the frequency while maintaining the Pipeline depth. Each core has its own fine grain power estimator that keeps the core within its power envelop in 250 nano-sec granularity. Each core also includes Software in Silicon features for Application Acceleration Support. Each core includes features to improve Application Data Integrity, with almost no performance loss. The core also allows using part of the Virtual Address to store meta-data.  User-Level Synchronization Instructions are also part of the S4 core. Each core has 16 KB Instruction and 16 KB Data L1 cache. The Core Clusters  The cores on the M7 chip are organized in sets of 4-core clusters. The core clusters share  L2 cache.  All four cores in the complex share 256 KB of 4 way set associative L2 Instruction Cache, with over 1/2 TB/s of throughput. Two cores share 256 KB of 8 way set associative L2 Data Cache, with over 1/2 TB/s of throughput. With this innovative Core Cluster architecture, the M7 doubles core execution bandwidth. to maximize per-thread performance.  The Chip  Each  M7 chip has 8 sets of these core-clusters. The chip has 64 MB on-chip L3 cache. This L3 caches is shared among all the cores and is partitioned into 8 x 8 MB chunks. Each chunk is  8-way set associative cache. The aggregate bandwidth for the L3 cache on the chip is over 1.6TB/s. Each chip has 4 DDR4 memory controllers and can support upto 16 DDR4 DIMMs, allowing for 2 TB of RAM/chip. The chip also includes 4 internal links of PCIe Gen3 I/O controllers.  Each chip has 7 coherence links, allowing for 8 of these chips to be connected together gluelessly. Also 32 of these chips can be connected in an SMP configuration. A potential system with 32 chips will have 1024 cores and 8192 threads and 64 TB of RAM.  Software in Silicon The M7 chip has many built in Application Accelerators in Silicon. These features will be exposed to our Software partners using the SPARC Accelerator Program.  The M7  has built-in logic to decompress data at the speed of memory access. This means that applications can directly work on compressed data in memory increasing the data access rates. The VA Masking feature allows the use of part of the virtual address to store meta-data.  Realtime Application Data Integrity The Realtime Application Data Integrity feature helps applications safeguard against invalid, stale memory reference and buffer overflows. The first 4-bits if the Pointer can be used to store a version number and this version number is also maintained in the memory & cache lines. When a pointer accesses memory the hardware checks to make sure the two versions match. A SEGV signal is raised when there is a mismatch. This feature can be used by the Database, applications and the OS.  M7 Database In-Memory Query Accelerator The M7 chip also includes a In-Silicon Query Engines.  These accelerate tasks that work on In-Memory Columnar Vectors. Oracle In-Memory options stores data in Column Format. The M7 Query Engine can speed up In-Memory Format Conversion, Value and Range Comparisons and Set Membership lookups. This engine can work on Compressed data - this means not only are we accelerating the query performance but also increasing the memory bandwidth for queries.  SPARC Accelerated Program  At the Hotchips conference we also introduced the SPARC Accelerated Program to provide our partners and third part developers access to all the goodness of the M7's SPARC Application Acceleration features. Please get in touch with us if you are interested in knowing more about this program. 

    Read the article

  • Training a 'replacement', how to enforce standards?

    - by Mohgeroth
    Not sure that this is the right stack exchange site to ask this of, but here goes... Scope I work for a small company that employs a few hundred people. The development team for the company is small and works out of visual foxpro. A specific department in the company hired me in as a 'lone gunman' to fix and enhance a pre-existing invoicing system. I've successfully taken an Access application that suffered from a lot of risks and limitations and converted it into a C# application driven off of a SQL server backend. I have recently obtained my undergraduate and am no expert by any means. To help make up for that I've felt that earning microsoft certifications will force me to understand more about .net and how it functions. So, after giving my notice with 9 months in advance, 3 months ago a replacement finally showed up. Their role is to learn what I have been designing to an attempt to support the applications designed in C#. The Replacement Fresh out of college with no real-world work experience, the first instinct for anything involving data was and still is listboxes... any time data is mentioned the list box is the control of choice for the replacement. This has gotten to the point, no matter how many times I discuss other controls, where I've seen 5 listboxes on a single form. Classroom experience was almost all C++ console development. So, an example of where I have concern is in a winforms application: Users need to key Reasons into a table to select from later. Given that I know that a strongly typed data set exists, I can just drag the data source from the toolbox and it would create all of this for me. I realize this is a simple example but using databinding is the key. For the past few months now we have been talking about the strongly typed dataset, how to use it and where it interacts with other controls. Data sets, how they work in relation to binding sources, adapters and data grid views. After handing this project off I expected questions about how to implement these since for me this is the way to do it. What happened next simply floors me: An instance of an adapter from the strongly typed dataset was created in the activate event of the form, a table was created and filled with data. Then, a loop was made to manually add rows to a listbox from this table. Finally, a variable was kept to do lookups to figure out what ID the record was for updates if required. How do they modify records you ask? That was my first question too. You won't believe how simple it is, all you do it double click and they type into a pop-up prompt the new value to change it to. As a data entry operator, all the modal popups would drive me absolutely insane. The final solution exceeds 100 lines of code that must be maintained. So my concern is that none of this is sinking in... the department is only allowed 20 hours a week of their time. Up until last week, we've only been given 4-5 hours a week if I'm lucky. The past week or so, I've been lucky to get 10. Question WHAT DO I DO?! I have 4 weeks left until I leave and they fully 'support' this application. I love this job and the opportunity it has given me but it's time for me to spread my wings and find something new. I am in no way, shape or form convinced that they are ready to take over. I do feel that the replacement has the technical ability to 'figure it out' but instead of learning they just write code to do all of this stuff manually. If the replacement wants to code differently in the end, as long as it works I'm fine with that as horrifiying at it looks. However to support what I have designed they MUST to understand how it works and how I have used controls and the framework to make 'magic' happen. This project has about 40 forms, a database with over 30 some odd tables, triggers and stored procedures. It relates labor to invoices to contracts to projections... it's not as simple as it was three years ago when I began this project and the department is now in a position where they cannot survive without it. How in the world can I accomplish any of the following?: Enforce standards or understanding in constent design when the department manager keeps telling them they can do it however they want to Find a way to engage the replacement in active learning of the framework and system design that support must be given for Gracefully inform sr. management that 5-9 hours a week is simply not enough time to learn about the department, pre-existing processes, applications that need to be supported AND determine where potential enhancements to the system go... Yes I know this is a wall of text, thanks for reading through me but I simply don't know what I should be doing. For me, this job is a monster of a reference and things would look extremely bad if I left and things fell apart. How do I handle this?

    Read the article

  • Add Widget via Action in Toolbar

    - by Geertjan
    The question of the day comes from Vadim, who asks on the NetBeans Platform mailing list: "Looking for example showing how to add Widget to Scene, e.g. by toolbar button click." Well, the solution is very similar to this blog entry, where you see a solution provided by Jesse Glick for VisiTrend in Boston: https://blogs.oracle.com/geertjan/entry/zoom_capability Other relevant articles to read are as follows: http://netbeans.dzone.com/news/which-netbeans-platform-action http://netbeans.dzone.com/how-to-make-context-sensitive-actions Let's go through it step by step, with this result in the end, a solution involving 4 classes split (optionally, since a central feature of the NetBeans Platform is modularity) across multiple modules: The Customer object has a "name" String and the Droppable capability has a method "doDrop" which takes a Customer object: public interface Droppable {    void doDrop(Customer c);} In the TopComponent, we use "TopComponent.associateLookup" to publish an instance of "Droppable", which creates a new LabelWidget and adds it to the Scene in the TopComponent. Here's the TopComponent constructor: public CustomerCanvasTopComponent() {    initComponents();    setName(Bundle.CTL_CustomerCanvasTopComponent());    setToolTipText(Bundle.HINT_CustomerCanvasTopComponent());    final Scene scene = new Scene();    final LayerWidget layerWidget = new LayerWidget(scene);    Droppable d = new Droppable(){        @Override        public void doDrop(Customer c) {            LabelWidget customerWidget = new LabelWidget(scene, c.getTitle());            customerWidget.getActions().addAction(ActionFactory.createMoveAction());            layerWidget.addChild(customerWidget);            scene.validate();        }    };    scene.addChild(layerWidget);    jScrollPane1.setViewportView(scene.createView());    associateLookup(Lookups.singleton(d));} The Action is displayed in the toolbar and is enabled only if a Droppable is currently in the Lookup: @ActionID(        category = "Tools",        id = "org.customer.controler.AddCustomerAction")@ActionRegistration(        iconBase = "org/customer/controler/icon.png",        displayName = "#AddCustomerAction")@ActionReferences({    @ActionReference(path = "Toolbars/File", position = 300)})@NbBundle.Messages("AddCustomerAction=Add Customer")public final class AddCustomerAction implements ActionListener {    private final Droppable context;    public AddCustomerAction(Droppable droppable) {        this.context = droppable;    }    @Override    public void actionPerformed(ActionEvent ev) {        NotifyDescriptor.InputLine inputLine = new NotifyDescriptor.InputLine("Name:", "Data Entry");        Object result = DialogDisplayer.getDefault().notify(inputLine);        if (result == NotifyDescriptor.OK_OPTION) {            Customer customer = new Customer(inputLine.getInputText());            context.doDrop(customer);        }    }} Therefore, when the Properties window, for example, is selected, the Action will be disabled. (See the Zoomable example referred to in the link above for another example of this.) As you can see above, when the Action is invoked, a Droppable must be available (otherwise the Action would not have been enabled). The Droppable is obtained in the Action and a new Customer object is passed to its "doDrop" method. The above in pictures, take note of the enablement of the toolbar button with the red dot, on the extreme left of the toolbar in the screenshots below: The above shows the JButton is only enabled if the relevant TopComponent is active and, when the Action is invoked, the user can enter a name, after which a new LabelWidget is created in the Scene. The source code of the above is here: http://java.net/projects/nb-api-samples/sources/api-samples/show/versions/7.3/misc/WidgetCreationFromAction Note: Showing this as an MVC example is slightly misleading because, depending on which model object ("Customer" and "Droppable") you're looking at, the V and the C are different. From the point of view of "Customer", the TopComponent is the View, while the Action is the Controler, since it determines when the M is displayed. However, from the point of view of "Droppable", the TopComponent is the Controler, since it determines when the Action, i.e., which is in this case the View, displays the presence of the M.

    Read the article

  • Rebuilding CoasterBuzz, Part IV: Dependency injection, it's what's for breakfast

    - by Jeff
    (Repost from my personal blog.) This is another post in a series about rebuilding one of my Web sites, which has been around for 12 years. I hope to relaunch soon. More: Part I: Evolution, and death to WCF Part II: Hot data objects Part III: The architecture using the "Web stack of love" If anything generally good for the craft has come out of the rise of ASP.NET MVC, it's that people are more likely to use dependency injection, and loosely couple the pieces parts of their applications. A lot of the emphasis on coding this way has been to facilitate unit testing, and that's awesome. Unit testing makes me feel a lot less like a hack, and a lot more confident in what I'm doing. Dependency injection is pretty straight forward. It says, "Given an instance of this class, I need instances of other classes, defined not by their concrete implementations, but their interfaces." Probably the first place a developer exercises this in when having a class talk to some kind of data repository. For a very simple example, pretend the FooService has to get some Foo. It looks like this: public class FooService {    public FooService(IFooRepository fooRepo)    {       _fooRepo = fooRepo;    }    private readonly IFooRepository _fooRepo;    public Foo GetMeFoo()    {       return _fooRepo.FooFromDatabase();    } } When we need the FooService, we ask the dependency container to get it for us. It says, "You'll need an IFooRepository in that, so let me see what that's mapped to, and put it in there for you." Why is this good for you? It's good because your FooService doesn't know or care about how you get some foo. You can stub out what the methods and properties on a fake IFooRepository might return, and test just the FooService. I don't want to get too far into unit testing, but it's the most commonly cited reason to use DI containers in MVC. What I wanted to mention is how there's another benefit in a project like mine, where I have to glue together a bunch of stuff. For example, when I have someone sign up for a new account on CoasterBuzz, I'm actually using POP Forums' new account mailer, which composes a bunch of text that includes a link to verify your account. The thing is, I want to use custom text and some other logic that's specific to CoasterBuzz. To accomplish this, I make a new class that inherits from the forum's NewAccountMailer, and override some stuff. Easy enough. Then I use Ninject, the DI container I'm using, to unbind the forum's implementation, and substitute my own. Ninject uses something called a NinjectModule to bind interfaces to concrete implementations. The forum has its own module, and then the CoasterBuzz module is loaded second. The CB module has two lines of code to swap out the mailer implementation: Unbind<PopForums.Email.INewAccountMailer>(); Bind<PopForums.Email.INewAccountMailer>().To<CbNewAccountMailer>(); Piece of cake! Now, when code asks the DI container for an INewAccountMailer, it gets my custom implementation instead. This is a lot easier to deal with than some of the alternatives. I could do some copy-paste, but then I'm not using well-tested code from the forum. I could write stuff from scratch, but then I'm throwing away a bunch of logic I've already written (in this case, stuff around e-mail, e-mail settings, mail delivery failures). There are other places where the DI container comes in handy. For example, CoasterBuzz does a number of custom things with user profiles, and special content for paid members. It uses the forum as the core piece to managing users, so I can ask the container to get me instances of classes that do user lookups, for example, and have zero care about how the forum handles database calls, configuration, etc. What a great world to live in, compared to ten years ago. Sure, the primary interest in DI is around the "separation of concerns" and facilitating unit testing, but as your library grows and you use more open source, it starts to be the glue that pulls everything together.

    Read the article

  • Joining on NULLs

    - by Dave Ballantyne
    A problem I see on a fairly regular basis is that of dealing with NULL values.  Specifically here, where we are joining two tables on two columns, one of which is ‘optional’ ie is nullable.  So something like this: i.e. Lookup where all the columns are equal, even when NULL.   NULL’s are a tricky thing to initially wrap your mind around.  Statements like “NULL is not equal to NULL and neither is it not not equal to NULL, it’s NULL” can cause a serious brain freeze and leave you a gibbering wreck and needing your mummy. Before we plod on, time to setup some data to demo against. Create table #SourceTable ( Id integer not null, SubId integer null, AnotherCol char(255) not null ) go create unique clustered index idxSourceTable on #SourceTable(id,subID) go with cteNums as ( select top(1000) number from master..spt_values where type ='P' ) insert into #SourceTable select Num1.number,nullif(Num2.number,0),'SomeJunk' from cteNums num1 cross join cteNums num2 go Create table #LookupTable ( Id integer not null, SubID integer null ) go insert into #LookupTable Select top(100) id,subid from #SourceTable where subid is not null order by newid() go insert into #LookupTable Select top(3) id,subid from #SourceTable where subid is null order by newid() If that has run correctly, you will have 1 million rows in #SourceTable and 103 rows in #LookupTable.  We now want to join one to the other. First attempt – Lets just join select * from #SourceTable join #LookupTable on #LookupTable.id = #SourceTable.id and #LookupTable.SubID = #SourceTable.SubID OK, that’s a fail.  We had 100 rows back,  we didn’t correctly account for the 3 rows that have null values.  Remember NULL <> NULL and the join clause specifies SUBID=SUBID, which for those rows is not true. Second attempt – Lets deal with those pesky NULLS select * from #SourceTable join #LookupTable on #LookupTable.id = #SourceTable.id and isnull(#LookupTable.SubID,0) = isnull(#SourceTable.SubID,0) OK, that’s the right result, well done and 99.9% of the time that is where its left. It is a relatively trivial CPU overhead to wrap ISNULL around both columns and compare that result, so no problems.  But, although that’s true, this a relational database we are using here, not a procedural language.  SQL is a declarative language, we are making a request to the engine to get the results we want.  How we ask for them can make a ton of difference. Lets look at the plan for our second attempt, specifically the clustered index seek on the #SourceTable   There are 2 predicates. The ‘seek predicate’ and ‘predicate’.  The ‘seek predicate’ describes how SQLServer has been able to use an Index.  Here, it has been able to navigate the index to resolve where ID=ID.  So far so good, but what about the ‘predicate’ (aka residual probe) ? This is a row-by-row operation.  For each row found in the index matching the Seek Predicate, the leaf level nodes have been scanned and tested using this logical condition.  In this example [Expr1007] is the result of the IsNull operation on #LookupTable and that is tested for equality with the IsNull operation on #SourceTable.  This residual probe is quite a high overhead, if we can express our statement slightly differently to take full advantage of the index and make the test part of the ‘Seek Predicate’. Third attempt – X is null and Y is null So, lets state the query in a slightly manner: select * from #SourceTable join #LookupTable on #LookupTable.id = #SourceTable.id and ( #LookupTable.SubID = #SourceTable.SubID or (#LookupTable.SubID is null and #SourceTable.SubId is null) ) So its slightly wordier and may not be as clear in its intent to the human reader, that is what comments are for, but the key point is that it is now clearer to the query optimizer what our intention is. Let look at the plan for that query, again specifically the index seek operation on #SourceTable No ‘predicate’, just a ‘Seek Predicate’ against the index to resolve both ID and SubID.  A subtle difference that can be easily overlooked.  But has it made a difference to the performance ? Well, yes , a perhaps surprisingly high one. Clever query optimizer well done. If you are using a scalar function on a column, you a pretty much guaranteeing that a residual probe will be used.  By re-wording the query you may well be able to avoid this and use the index completely to resolve lookups. In-terms of performance and scalability your system will be in a much better position if you can.

    Read the article

  • ComboBox Data Binding

    - by Geertjan
    Let's create a databound combobox, levering MVC in a desktop application. The result will be a combobox, provided by the NetBeans ChoiceView, that displays data retrieved from a database: What follows is not much different from the NetBeans Platform CRUD Application Tutorial and you're advised to consult that document if anything that follows isn't clear enough. One kind of interesting thing about the instructions that follow is that it shows that you're able to create an application where each element of the MVC architecture can be located within a separate module: Start by creating a new NetBeans Platform application named "MyApplication". Model We're going to start by generating JPA entity classes from a database connection. In the New Project wizard, choose "Java Class Library". Click Next. Name the Java Class Library "MyEntities". Click Finish. Right-click the MyEntities project, choose New, and then select "Entity Classes from Database". Work through the wizard, selecting the tables of interest from your database, and naming the package "entities". Click Finish. Now a JPA entity is created for each of the selected tables. In the Project Properties dialog of the project, choose "Copy Dependent Libraries" in the Packaging panel. Build the project. In your project's "dist" folder (visible in the Files window), you'll now see a JAR, together with a "lib" folder that contains the JARs you'll need. In your NetBeans Platform application, create a module named "MyModel", with code name base "org.my.model". Right-click the project, choose Properties, and in the "Libraries" panel, click Add Dependency button in the Wrapped JARs subtab to add all the JARs from the previous step to the module. Also include "derby-client.jar" or the equivalent driver for your database connection to the module. Controler In your NetBeans Platform application, create a module named "MyControler", with code name base "org.my.controler". Right-click the module's Libraries node, in the Projects window, and add a dependency on "Explorer & Property Sheet API". In the MyControler module, create a class with this content: package org.my.controler; import org.openide.explorer.ExplorerManager; public class MyUtils { static ExplorerManager controler; public static ExplorerManager getControler() { if (controler == null) { controler = new ExplorerManager(); } return controler; } } View In your NetBeans Platform application, create a module named "MyView", with code name base "org.my.view".  Create a new Window Component, in "explorer" view, for example, let it open on startup, with class name prefix "MyView". Add dependencies on the Nodes API and on the Explorer & Property Sheet API. Also add dependencies on the "MyModel" module and the "MyControler" module. Before doing so, in the "MyModel" module, make the "entities" package and the "javax.persistence" packages public (in the Libraries panel of the Project Properties dialog) and make the one package that you have in the "MyControler" package public too. Define the top part of the MyViewTopComponent as follows: public final class MyViewTopComponent extends TopComponent implements ExplorerManager.Provider { ExplorerManager controler = MyUtils.getControler(); public MyViewTopComponent() { initComponents(); setName(Bundle.CTL_MyViewTopComponent()); setToolTipText(Bundle.HINT_MyViewTopComponent()); setLayout(new BoxLayout(this, BoxLayout.PAGE_AXIS)); controler.setRootContext(new AbstractNode(Children.create(new ChildFactory<Customer>() { @Override protected boolean createKeys(List list) { EntityManager entityManager = Persistence. createEntityManagerFactory("MyEntitiesPU").createEntityManager(); Query query = entityManager.createNamedQuery("Customer.findAll"); list.addAll(query.getResultList()); return true; } @Override protected Node createNodeForKey(Customer key) { Node customerNode = new AbstractNode(Children.LEAF, Lookups.singleton(key)); customerNode.setDisplayName(key.getName()); return customerNode; } }, true))); controler.addPropertyChangeListener(new PropertyChangeListener() { @Override public void propertyChange(PropertyChangeEvent evt) { Customer selectedCustomer = controler.getSelectedNodes()[0].getLookup().lookup(Customer.class); StatusDisplayer.getDefault().setStatusText(selectedCustomer.getName()); } }); JPanel row1 = new JPanel(new FlowLayout(FlowLayout.LEADING)); row1.add(new JLabel("Customers: ")); row1.add(new ChoiceView()); add(row1); } @Override public ExplorerManager getExplorerManager() { return controler; } ... ... ... Now run the application and you'll see the same as the image with which this blog entry started.

    Read the article

  • Synchronized Property Changes (Part 4)

    - by Geertjan
    The next step is to activate the undo/redo functionality... for a Node. Something I've not seen done before. I.e., when the Node is renamed via F2 on the Node, the "Undo/Redo" buttons should start working. Here is the start of the solution, via this item in the mailing list and Timon Veenstra's BeanNode class, note especially the items in bold: public class ShipNode extends BeanNode implements PropertyChangeListener, UndoRedo.Provider { private final InstanceContent ic; private final ShipSaveCapability saveCookie; private UndoRedo.Manager manager; private String oldDisplayName; private String newDisplayName; private Ship ship; public ShipNode(Ship bean) throws IntrospectionException { this(bean, new InstanceContent()); } private ShipNode(Ship bean, InstanceContent ic) throws IntrospectionException { super(bean, Children.LEAF, new ProxyLookup(new AbstractLookup(ic), Lookups.singleton(bean))); this.ic = ic; setDisplayName(bean.getType()); setShortDescription(String.valueOf(bean.getYear())); saveCookie = new ShipSaveCapability(bean); bean.addPropertyChangeListener(WeakListeners.propertyChange(this, bean)); } @Override public Action[] getActions(boolean context) { List<? extends Action> shipActions = Utilities.actionsForPath("Actions/Ship"); return shipActions.toArray(new Action[shipActions.size()]); } protected void fire(boolean modified) { if (modified) { ic.add(saveCookie); } else { ic.remove(saveCookie); } } @Override public UndoRedo getUndoRedo() { manager = Lookup.getDefault().lookup( UndoRedo.Manager.class); return manager; } private class ShipSaveCapability implements SaveCookie { private final Ship bean; public ShipSaveCapability(Ship bean) { this.bean = bean; } @Override public void save() throws IOException { StatusDisplayer.getDefault().setStatusText("Saving..."); fire(false); } } @Override public boolean canRename() { return true; } @Override public void setName(String newDisplayName) { Ship c = getLookup().lookup(Ship.class); oldDisplayName = c.getType(); c.setType(newDisplayName); fireNameChange(oldDisplayName, newDisplayName); fire(true); fireUndoableEvent("type", ship, oldDisplayName, newDisplayName); } public void fireUndoableEvent(String property, Ship source, Object oldValue, Object newValue) { ReUndoableEdit reUndoableEdit = new ReUndoableEdit( property, source, oldValue, newValue); UndoableEditEvent undoableEditEvent = new UndoableEditEvent( this, reUndoableEdit); manager.undoableEditHappened(undoableEditEvent); } private class ReUndoableEdit extends AbstractUndoableEdit { private Object oldValue; private Object newValue; private Ship source; private String property; public ReUndoableEdit(String property, Ship source, Object oldValue, Object newValue) { super(); this.oldValue = oldValue; this.newValue = newValue; this.source = source; this.property = property; } @Override public void undo() throws CannotUndoException { setName(oldValue.toString()); } @Override public void redo() throws CannotRedoException { setName(newValue.toString()); } } @Override public String getDisplayName() { Ship c = getLookup().lookup(Ship.class); if (null != c.getType()) { return c.getType(); } return super.getDisplayName(); } @Override public String getShortDescription() { Ship c = getLookup().lookup(Ship.class); if (null != String.valueOf(c.getYear())) { return String.valueOf(c.getYear()); } return super.getShortDescription(); } @Override public void propertyChange(PropertyChangeEvent evt) { if (evt.getPropertyName().equals("type")) { String oldDisplayName = evt.getOldValue().toString(); String newDisplayName = evt.getNewValue().toString(); fireDisplayNameChange(oldDisplayName, newDisplayName); } else if (evt.getPropertyName().equals("year")) { String oldToolTip = evt.getOldValue().toString(); String newToolTip = evt.getNewValue().toString(); fireShortDescriptionChange(oldToolTip, newToolTip); } fire(true); } } Undo works when rename is done, but Redo never does, because Undo is constantly activated, since it is reactivated whenever there is a name change. And why must the UndoRedoManager be retrieved from the Lookup (it doesn't work otherwise)? Don't get that part of the code either. Help welcome!

    Read the article

  • F#: Advantages of converting top-level functions to member methods?

    - by J Cooper
    Earlier I requested some feedback on my first F# project. Before closing the question because the scope was too large, someone was kind enough to look it over and leave some feedback. One of the things they mentioned was pointing out that I had a number of regular functions that could be converted to be methods on my datatypes. Dutifully I went through changing things like let getDecisions hand = let (/=/) card1 card2 = matchValue card1 = matchValue card2 let canSplit() = let isPair() = match hand.Cards with | card1 :: card2 :: [] when card1 /=/ card2 -> true | _ -> false not (hasState Splitting hand) && isPair() let decisions = [Hit; Stand] let split = if canSplit() then [Split] else [] let doubleDown = if hasState Initial hand then [DoubleDown] else [] decisions @ split @ doubleDown to this: type Hand // ...stuff... member hand.GetDecisions = let (/=/) (c1 : Card) (c2 : Card) = c1.MatchValue = c2.MatchValue let canSplit() = let isPair() = match hand.Cards with | card1 :: card2 :: [] when card1 /=/ card2 -> true | _ -> false not (hand.HasState Splitting) && isPair() let decisions = [Hit; Stand] let split = if canSplit() then [Split] else [] let doubleDown = if hand.HasState Initial then [DoubleDown] else [] decisions @ split @ doubleDown Now, I don't doubt I'm an idiot, but other than (I'm guessing) making C# interop easier, what did that gain me? Specifically, I found a couple *dis*advantages, not counting the extra work of conversion (which I won't count, since I could have done it this way in the first place, I suppose, although that would have made using F# Interactive more of a pain). For one thing, I'm now no longer able to work with function "pipelining" easily. I had to go and change some |> chained |> calls to (some |> chained).Calls etc. Also, it seemed to make my type system dumber--whereas with my original version, my program needed no type annotations, after converting largely to member methods, I got a bunch of errors about lookups being indeterminate at that point, and I had to go and add type annotations (an example of this is in the (/=/) above). I hope I haven't come off too dubious, as I appreciate the advice I received, and writing idiomatic code is important to me. I'm just curious why the idiom is the way it is :) Thanks!

    Read the article

  • Passing a ManagedObjectContext to a second view

    - by amo
    I'm writing my first iPhone/Cocoa app. It has two table views inside a navigation view. When you touch a row in the first table view, you are taken to the second table view. I would like the second view to display records from the CoreData entities related to the row you touched in the first view. I have the CoreData data showing up fine in the first table view. You can touch a row and go to the second table view. I'm able to pass info from the selected object from the first to the second view. But I cannot get the second view to do its own CoreData fetching. For the life of me I cannot get the managedObjectContext object to pass to the second view controller. I don't want to do the lookups in the first view and pass a dictionary because I want to be able to use a search field to refine results in the second view, as well as insert new entries to the CoreData data from there. Here's the function that transitions from the first to the second view. - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here -- for example, create and push another view controller. NSManagedObject *selectedObject = [[self fetchedResultsController] objectAtIndexPath:indexPath]; SecondViewController *secondViewController = [[SecondViewController alloc] initWithNibName:@"SecondView" bundle:nil]; secondViewController.tName = [[selectedObject valueForKey:@"name"] description]; secondViewController.managedObjectContext = [self managedObjectContext]; [self.navigationController pushViewController:secondViewController animated:YES]; [secondViewController release]; } And this is the function inside SecondViewController that crashes: - (void)viewDidLoad { [super viewDidLoad]; self.title = tName; NSError *error; if (![[self fetchedResultsController] performFetch:&error]) { // <-- crashes here // Handle the error... } } - (NSFetchedResultsController *)fetchedResultsController { if (fetchedResultsController != nil) { return fetchedResultsController; } /* Set up the fetched results controller. */ // Create the fetch request for the entity. NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; // Edit the entity name as appropriate. // **** crashes on the next line because managedObjectContext == 0x0 NSEntityDescription *entity = [NSEntityDescription entityForName:@"SecondEntity" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // <snip> ... more code here from Apple template, never gets executed because of the crashing return fetchedResultsController; } Any ideas on what I am doing wrong here? managedObjectContext is a retained property. UPDATE: I inserted a NSLog([[managedObjectContext registeredObjects] description]); in viewDidLoad and it appears managedObjectContext is being passed just fine. Still crashing, though. Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: '+entityForName: could not locate an NSManagedObjectModel for entity name 'SecondEntity''

    Read the article

  • Best Practices / Patterns for Enterprise Protection/Remediation of SSNs (Social Security Numbers)

    - by Erik Neu
    I am interested in hearing about enterprise solutions for SSN handling. (I looked pretty hard for any pre-existing post on SO, including reviewing the terriffic SO automated "Related Questions" list, and did not find anything, so hopefully this is not a repeat.) First, I think it is important to enumerate the reasons systems/databases use SSNs: (note—these are reasons for de facto current state—I understand that many of them are not good reasons) Required for Interaction with External Entities. This is the most valid case—where external entities your system interfaces with require an SSN. This would typically be government, tax and financial. SSN is used to ensure system-wide uniqueness. SSN has become the default foreign key used internally within the enterprise, to perform cross-system joins. SSN is used for user authentication (e.g., log-on) The enterprise solution that seems optimum to me is to create a single SSN repository that is accessed by all applications needing to look up SSN info. This repository substitutes a globally unique, random 9-digit number (ASN) for the true SSN. I see many benefits to this approach. First of all, it is obviously highly backwards-compatible—all your systems "just" have to go through a major, synchronized, one-time data-cleansing exercise, where they replace the real SSN with the alternate ASN. Also, it is centralized, so it minimizes the scope for inspection and compliance. (Obviously, as a negative, it also creates a single point of failure.) This approach would solve issues 2 and 3, without ever requiring lookups to get the real SSN. For issue #1, authorized systems could provide an ASN, and be returned the real SSN. This would of course be done over secure connections, and the requesting systems would never persist the full SSN. Also, if the requesting system only needs the last 4 digits of the SSN, then that is all that would ever be passed. Issue #4 could be handled the same way as issue #1, though obviously the best thing would be to move away from having users supply an SSN for log-on. There are a couple of papers on this: UC Berkely: http://bit.ly/bdZPjQ Oracle Vault: bit.ly/cikbi1

    Read the article

  • EF4 Import/Lookup thousands of records - my performance stinks!

    - by Dennis Ward
    I'm trying to setup something for a movie store website (using ASP.NET, EF4, SQL Server 2008), and in my scenario, I want to allow a "Member" store to import their catalog of movies stored in a text file containing ActorName, MovieTitle, and CatalogNumber as follows: Actor, Movie, CatalogNumber John Wayne, True Grit, 4577-12 (repeated for each record) This data will be used to lookup an actor and movie, and create a "MemberMovie" record, and my import speed is terrible if I import more than 100 or so records using these tables: Actor Table: Fields = {ID, Name, etc.} Movie Table: Fields = {ID, Title, ActorID, etc.} MemberMovie Table: Fields = {ID, CatalogNumber, MovieID, etc.} My methodology to import data into the MemberMovie table from a text file is as follows (after the file has been uploaded successfully): Create a context. For each line in the file, lookup the artist in the Actor table. For each Movie in the Artist table, lookup the matching title. If a matching Movie is found, add a new MemberMovie record to the context and call ctx.SaveChanges(). The performance of my implementation is terrible. My expectation is that this can be done with thousands of records in a few seconds (after the file has been uploaded), and I've got something that times out the browser. My question is this: What is the best approach for performing bulk lookups/inserts like this? Should I call SaveChanges only once rather than for each newly created MemberMovie? Would it be better to implement this using something like a stored procedure? A snippet of my loop is roughly this (edited for brevity): while ((fline = file.ReadLine()) != null) { string [] token = fline.Split(separator); string Actor = token[0]; string Movie = token[1]; string CatNumber = token[2]; Actor found_actor = ctx.Actors.Where(a => a.Name.Equals(actor)).FirstOrDefault(); if (found_actor == null) continue; Movie found_movie = found_actor.Movies.Where( s => s.Title.Equals(title, StringComparison.CurrentCultureIgnoreCase)).FirstOrDefault(); if (found_movie == null) continue; ctx.MemberMovies.AddObject(new MemberMovie() { MemberProfileID = profile_id, CatalogNumber = CatNumber, Movie = found_movie }); try { ctx.SaveChanges(); } catch { } } Any help is appreciated! Thanks, Dennis

    Read the article

  • IP address numbers in MySQL subquery

    - by Iain Collins
    I have a problem with a subquery involving IPV4 addresses stored in MySQL (MySQL 5.0). The IP addresses are stored in two tables, both in network number format - e.g. the format output by MySQL's INET_ATON(). The first table ('events') contains lots of rows with IP addresses associated with them, the second table ('network_providers') contains a list of provider information for given netblocks. events table (~4,000,000 rows): event_id (int) event_name (varchar) ip_address (unsigned 4 byte int) network_providers table (~60,000 rows): ip_start (unsigned 4 byte int) ip_end (unsigned 4 byte int) provider_name (varchar) Simplified for the purposes of the problem I'm having, the goal is to create an export along the lines of: event_id,event_name,ip_address,provider_name If do a query along the lines of either of the following, I get the result I expect: SELECT provider_name FROM network_providers WHERE INET_ATON('192.168.0.1') >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1 SELECT provider_name FROM network_providers WHERE 3232235521 >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1 That is to say, it returns the correct provider_name for whatever IP I look up (of course I'm not really using 192.168.0.1 in my queries). However, when performing this same query as a subquery, in the following manner, it doesn't yield the result I would expect: SELECT event.id, event.event_name, (SELECT provider_name FROM network_providers WHERE event.ip_address >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1) as provider FROM events Instead the a different (incorrect) value for network_provider is returned - over 90% (but curiously not all) values returned in the provider column contain the wrong provider information for that IP. Using event.ip_address in a subquery just to echo out the value confirms it contains the value I'd expect and that the subquery can parse it. Replacing event.ip_address with an actual network number also works, just using it dynamically in the subquery in this manner that doesn't work for me. I suspect the problem is there is something fundamental and important about subqueries in MySQL that I don't get. I've worked with IP addresses like this in MySQL quite a bit before, but haven't previously done lookups for them using a subquery. The question: I'd really appreciate an example of how I could get the output I want, and if someone here knows, some enlightenment as to why what I'm doing doesn't work so I can avoid making this mistake again. Notes: The actual real-world usage I'm trying to do is considerably more complicated (involving joining two or three tables). This is a simplified version, to avoid overly complicating the question. Additionally, I know I'm not using a between on ip_start & ip_end - that's intentional (the DB's can be out of date, and such cases the owner in the DB is almost always in the next specified range and 'best guess' is fine in this context) however I'm grateful for any suggestions for improvement that relate to the question. Efficiency is always nice, but in this case absolutely not essential - any help appreciated.

    Read the article

  • What to name column in database table that holds versioning number

    - by rwmnau
    I'm trying to figure out what to call the column in my database table that holds an INT to specific "record version". I'm currently using "RecordOrder", but I don't like that, because people think higher=newer, but the way I'm using it, lower=newer (with "1" being the current record, "2" being the second most current, "3" older still, and so on). I've considered "RecordVersion", but I'm afraid that would have the same problem. Any other suggestions? "RecordAge"? I'm doing this because when I insert into the table, instead of having to find out what version is next, then run the risk of having that number stolen from me before I write, I just insert insert with a "RecordOrder" of 0. There's a trigger on the table AFTER INSERT that increments all the "RecordOrder" numbers for that key by 1, so the record I just inserted becomes "1", and all others are increased by 1. That way, you can get a person's current record by selection RecordOrder=1, instead of getting the MAX(RecordOrder) and then selecting that. PS - I'm also open to criticism about why this is a terrible idea and I should be incrementing this index instead. This just seemed to make lookups much easier, but if it's a bad idea, please enlighten me! Some details about the data, as an example: I have the following database table: CREATE TABLE AmountDue ( CustomerNumber INT, AmountDue DECIMAL(14,2), RecordOrder SMALLINT, RecordCreated DATETIME ) A subset of my data looks like this: CustomerNumber Amountdue RecordOrder RecordCreated 100 0 1 2009-12-19 05:10:10.123 100 10.05 2 2009-12-15 06:12:10.123 100 100.00 3 2009-12-14 14:19:10.123 101 5.00 1 2009-11-14 05:16:10.123 In this example, there are three rows for customer 100 - they owed $100, then $10.05, and now they owe nothing. Let me know if I need to clarify it some more. UPDATE: The "RecordOrder" and "RecordCreated" columns are not available to the user - they're only there for internal use, and to help figure out which is the current customer record. Also, I could use it to return an appropriately-ordered customer history, though I could just as easily do that with the date. I can accomplish the same thing as an incrementing "Record Version" with just the RecordCreated date, I suppose, but that removes the convenience of knowing that RecordOrder=1 is the current record, and I'm back to doing a sub-query with MAX or MIN on the DateTime to determine the most recent record.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • CultureManager issue

    - by Serge
    I have a bug I don't understand. While the following works fine: Resources.Classes.AFieldFormula.DirectFieldFormula this one throws an exception: new ResourceManager(typeof(Resources.Classes.AFieldFormula)).GetString("DirectFieldFormula"); Could not find any resources appropriate for the specified culture or the neutral culture. Make sure \"Resources.Classes.AFieldFormula.resources\" was correctly embedded or linked into assembly \"MygLogWeb\" at compile time, or that all the satellite assemblies required are loadable and fully signed. How comes? Resource designer.cs file: //------------------------------------------------------------------------------ // <auto-generated> // This code was generated by a tool. // Runtime Version:4.0.30319.18408 // // Changes to this file may cause incorrect behavior and will be lost if // the code is regenerated. // </auto-generated> //------------------------------------------------------------------------------ namespace Resources.Classes { using System; /// <summary> /// A strongly-typed resource class, for looking up localized strings, etc. /// </summary> // This class was auto-generated by the StronglyTypedResourceBuilder // class via a tool like ResGen or Visual Studio. // To add or remove a member, edit your .ResX file then rerun ResGen // with the /str option, or rebuild your VS project. [global::System.CodeDom.Compiler.GeneratedCodeAttribute("System.Resources.Tools.StronglyTypedResourceBuilder", "4.0.0.0")] [global::System.Diagnostics.DebuggerNonUserCodeAttribute()] [global::System.Runtime.CompilerServices.CompilerGeneratedAttribute()] public class AFieldFormula { private static global::System.Resources.ResourceManager resourceMan; private static global::System.Globalization.CultureInfo resourceCulture; [global::System.Diagnostics.CodeAnalysis.SuppressMessageAttribute("Microsoft.Performance", "CA1811:AvoidUncalledPrivateCode")] internal AFieldFormula() { } /// <summary> /// Returns the cached ResourceManager instance used by this class. /// </summary> [global::System.ComponentModel.EditorBrowsableAttribute(global::System.ComponentModel.EditorBrowsableState.Advanced)] public static global::System.Resources.ResourceManager ResourceManager { get { if (object.ReferenceEquals(resourceMan, null)) { global::System.Resources.ResourceManager temp = new global::System.Resources.ResourceManager("MygLogWeb.Classes.AFieldFormula", typeof(AFieldFormula).Assembly); resourceMan = temp; } return resourceMan; } } /// <summary> /// Overrides the current thread's CurrentUICulture property for all /// resource lookups using this strongly typed resource class. /// </summary> [global::System.ComponentModel.EditorBrowsableAttribute(global::System.ComponentModel.EditorBrowsableState.Advanced)] public static global::System.Globalization.CultureInfo Culture { get { return resourceCulture; } set { resourceCulture = value; } } /// <summary> /// Looks up a localized string similar to Direct field. /// </summary> public static string DirectFieldFormula { get { return ResourceManager.GetString("DirectFieldFormula", resourceCulture); } } } }

    Read the article

  • Weird networking problem ( Linksys, Windows 7 )

    - by Rohit Nair
    Okay it's a bit tough to figure out where to start from, but here is the basic summary of the issue: During general internet usage, there are times when any attempt to visit a website stalls at "Waiting for somedomain.com". This problem occurs in Firefox, IE and Chrome. No website will load, INCLUDING the router configuration page at 192.168.1.1. Curiously, ping works fine, and other network apps such as MSN Messenger continue to work and I can send and receive messages. Disconnecting and reconnecting to the wireless network seems to fix the problem for a bit, but there are times when it relapses into not loading after every 2-3 http requests. Restarting the router seems to fix the issue, but it can crop up hours or days later. I have a CCNA cert and I know my way around the Windows family of operating systems, so I'm going to list all the things I've tried here. Other computers on the network seem to suffer the same problem, which makes me think it might be a specific problem with something in Win7. The random nature of this issue makes it a bit difficult to confirm, but I can definitely say that I have experienced this on the following systems: Windows 7 64-bit on my desktop Windows Vista 32-bit on my desktop ( the desktop has 2 wireless NICs and the problem existed on both ) Windows Vista 32-bit on my laptop ( both with wireless and wired ) Windows XP SP3 on another laptop ( both wireless and wired ) Using Wireshark to sniff packets seemed to indicate that although HTTP requests were being SENT out, no packets were coming in to respond to the HTTP request. However, other network apps continued to work i.e I would still receive IMs on Windows Live Messenger. Disabling IPV6 had no effect. Updating router firmware to the latest stock firmware by Linksys had no effect. Switching to dd-wrt firmware had no effect. By "no effect" I mean that although the restart required by firmware updates fixed the problem at the time, it still came back. A couple of weeks back, after a LOT of googling and flipping of various options, I figured it might be a case of router slowdown ( http://www.dd-wrt.com/wiki/index.php/Router%5FSlowdown ) caused by the fact that I occasionally run a torrent client. I tried changing the configuration as suggested in that router slowdown link, and restarted the router. However I have not run the torrent client for 12 days now, and yet I still randomly experience this problem. Currently the computer I am using is running Windows 7 64-bit. I would just like to reiterate some of the reasons that I was confused by the issue. Even the router config page at 192.168.1.1 would not load, indicating that it's not a problem with the WAN link, but probably a router issue or a local computer issue. For some reason, disconnecting and reconnecting to the wireless network immediately seems to fix the problem. Updating the router firmware, even switching to open source firmware did nothing. So it seemed to be a computer issue. On the other hand, I have not seen any mass outrage of people having networking problems with Windows 7 and Linksys routers, especially a problem of this sort, and I have tweaked every network setting I could think of. Although HTTP seems to have trouble, ping works fine, DNS lookups work fine, other networking apps work fine. However if I disconnect from Windows Live Messenger and try to reconnect, it fails to reconnect. So although it could receive data over the existing TCP/IP connection, trying to start a new one failed? Does anyone have any further ideas on debugging or fixing this issue? I am reasonably certain there are no viruses or other malicious apps on my network, and I am also reasonably certain that nobody is accessing my router without my consent. Router: Linksys WRT54G2 1.0 running dd-wrt firmware Wireless Card: Alfa AWUS036H OS: Windows 7 64-bit EDIT: I tried switching to a clean wireless channel free from interference, but the problem still persisted. I tried connecting directly with a cable, but the problem still persisted. Signed A very confused and bewildered geek whose knowledge seems to be useless in the face of this frustrating network issue.

    Read the article

  • Having problems with high CPU usage and apparent memory leak of Exim

    - by Dancrumb
    I'm having problems with my server and am hoping you can help. The culprit appears to be exim. The CPU usage is consistently high and the memory usage trends up and up and up for no apparent reason (this is not a heavily used server). To demonstrate the issue, I ran the following: root@server [/var/log]# service exim restart; for iter in `seq 0 9`; do date; top -n1 | grep exim; sleep 10; done Shutting down exim: [ OK ] Shutting down spamd: [ OK ] Starting exim: [ OK ] Sun Jun 6 18:12:07 CDT 2010 62592 root 25 0 11400 6572 2356 R 51.5 1.3 0:00.92 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim Sun Jun 6 18:12:18 CDT 2010 62592 root 25 0 28768 23m 2356 R 57.4 4.6 0:06.75 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:12:28 CDT 2010 62592 root 25 0 36408 30m 2356 R 55.5 6.0 0:12.59 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:12:39 CDT 2010 62592 root 25 0 41396 35m 2356 R 53.5 7.0 0:18.35 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:12:49 CDT 2010 62592 root 25 0 45868 40m 2356 R 47.5 7.8 0:24.06 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:13:00 CDT 2010 62592 root 25 0 50056 44m 2356 R 55.3 8.6 0:29.84 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:13:10 CDT 2010 62592 root 25 0 53888 47m 2356 R 55.2 9.4 0:35.63 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:13:21 CDT 2010 62592 root 20 0 56920 50m 2356 R 55.3 9.9 0:41.15 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:13:31 CDT 2010 62592 root 25 0 60380 54m 2356 R 53.4 10.6 0:46.98 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim Sun Jun 6 18:13:42 CDT 2010 62592 root 22 0 63400 57m 2356 R 49.5 11.2 0:52.74 exim 62587 mailnull 18 0 7548 1212 792 S 0.0 0.2 0:00.00 exim 62588 root 18 0 7536 2052 1648 S 0.0 0.4 0:00.00 exim After some time, it gets to a rate of picking up an extra MB every 10s. I've checked the exim logs and there are no messages coming in there. exim -bV shows: Exim version 4.69 #1 built 16-Mar-2009 14:44:43 Copyright (c) University of Cambridge 2006 Berkeley DB: Sleepycat Software: Berkeley DB 4.2.52: (February 22, 2005) Support for: crypteq iconv() IPv6 PAM Perl OpenSSL Content_Scanning Old_Demime Experimental_SPF Experimental_SRS Experimental_DomainKeys Lookups: lsearch wildlsearch nwildlsearch iplsearch dbm dbmnz passwd Authenticators: cram_md5 dovecot plaintext spa Routers: accept dnslookup ipliteral manualroute queryprogram redirect Transports: appendfile/maildir autoreply pipe smtp Size of off_t: 8 Configuration file is /etc/exim.conf I'm at something of a loss as to how to proceed. Any recommendations would be well received!

    Read the article

  • Troubleshooting unwanted NTP Traffic

    - by Jaxaeon
    A domain controller running Windows Server 2012 is sending NTP and NETBIOS traffic to an address that has never been configured as a time provider. The server logs give no indication that any NTP traffic is failing. The only place I see any evidence of this traffic is in pfSense system logs: (Blocked) Jun 9 08:48:50 DOMAIN 10.0.1.100:123 192.128.127.254:123 UDP (Blocked) Jun 9 08:48:53 DOMAIN 10.0.1.100:137 192.128.127.254:137 UDP As far as I can tell the NTP service is working normally otherwise: DC2.domain.com[10.0.1.101:123]: ICMP: 0ms delay NTP: -0.0131705s offset from DC1.domain.com RefID: DC1.domain.com [10.0.1.100] Stratum: 3 DC1.domain.com *** PDC ***[10.0.1.100:123]: ICMP: 0ms delay NTP: +0.0000000s offset from DC1.domain.com RefID: clock1.albyny.inoc.net [64.246.132.14] Stratum: 2 The time provider NtpClient is currently receiving valid time data from 1.pool.ntp.org,0×1 (ntp.m|0x0|0.0.0.0:123->204.2.134.163:123). The time provider NtpClient is currently receiving valid time data from 0.pool.ntp.org,0×1 (ntp.m|0x0|0.0.0.0:123->64.246.132.14:123). The time service is now synchronizing the system time with the time source 0.pool.ntp.org,0×1 (ntp.m|0x0|0.0.0.0:123->64.246.132.14:123). I've been inside and out of the NTP configuration and cannot find any reason for this traffic. Reverse DNS points the destination address to nothing.attdns.com. pinging nothing.attdns.com from the domain controller in question leads to a response from loopback (127.0.0.2) which makes my head hurt. Any ideas? EDIT1: It should probably be noted that after a dns flush, nslookup 192.128.127.254 returns nothing.attdns.com. 192.128.127.254 is not present in domain.com DNS records. The attdns.com domain is not present in cached lookups. 127.in-addr.arpa is clean of any funkyness. EDIT2: The loopback ping response from nothing.attdns.com is possibly unrelated. Machines on other networks are also displaying this behavior. EDIT3: As mentioned in the comments, I tracked the problem network adapter back to my pfSense VM hosted in esxi 5.5 (I know shame on me for virtualizing a firewall). pfSense was configured to use DC1.domain.com as its primary time provider, but upon changing it back to pool.ntp.org the problem persists. pfSense logs give no indication of NTP misconfiguration. Everywhere I can think to look this VM is identified as 10.0.1.253, so I still have no idea why it’s sending NTP requests as 192.128… Since this firewall was a temporary solution to a problem that no longer exists so I am going to decommission it. EDIT4: The queries were coming from another machine sharing the same virtual adapter as the firewall. The machine has two local adapters: one for LAN, and the other for attached hardware that uses an Ethernet connection. That hardware sits in the the mystery subnet, and the machine is broadcasting NTP requests over both adapters.

    Read the article

  • Postfix sasl login failing no mechanism found

    - by Nat45928
    following the link here: http://flurdy.com/docs/postfix/ with posfix, courier, MySql, and sasl gave me a web server that has imap functionality working fine but when i go to log into the server to send a message using the same user id and password for connecting the the imap server it rejects my login to the smtp server. If i do not specify a login for the outgoing mail server then it will send the message just fine. the error in postfix's log is: Jul 6 17:26:10 Sj-Linux postfix/smtpd[19139]: connect from unknown[10.0.0.50] Jul 6 17:26:10 Sj-Linux postfix/smtpd[19139]: warning: SASL authentication failure: unable to canonify user and get auxprops Jul 6 17:26:10 Sj-Linux postfix/smtpd[19139]: warning: unknown[10.0.0.50]: SASL DIGEST-MD5 authentication failed: no mechanism available Jul 6 17:26:10 Sj-Linux postfix/smtpd[19139]: warning: unknown[10.0.0.50]: SASL LOGIN authentication failed: no mechanism available Ive checked all usernames and passwords for mysql. what could be going wrong? edit: here is some other information: installed libraires for postfix, courier and sasl: aptitude install postfix postfix-mysql aptitude install libsasl2-modules libsasl2-modules-sql libgsasl7 libauthen-sasl-cyrus-perl sasl2-bin libpam-mysql aptitude install courier-base courier-authdaemon courier-authlib-mysql courier-imap courier-imap-ssl courier-ssl and here is my /etc/postfix/main.cf myorigin = domain.com smtpd_banner = $myhostname ESMTP $mail_name biff = no # appending .domain is the MUA's job. append_dot_mydomain = no # Uncomment the next line to generate "delayed mail" warnings #delay_warning_time = 4h readme_directory = no # TLS parameters smtpd_tls_cert_file=/etc/ssl/certs/ssl-cert-snakeoil.pem smtpd_tls_key_file=/etc/ssl/private/ssl-cert-snakeoil.key smtpd_use_tls=yes smtpd_tls_session_cache_database = btree:${data_directory}/smtpd_scache smtp_tls_session_cache_database = btree:${data_directory}/smtp_scache # See /usr/share/doc/postfix/TLS_README.gz in the postfix-doc package for # information on enabling SSL in the smtp client. #myhostname = my hostname alias_maps = hash:/etc/aliases alias_database = hash:/etc/aliases myorigin = /etc/mailname local_recipient_maps = mydestination = relayhost = mynetworks = 127.0.0.0/8 [::ffff:127.0.0.0]/104 [::1]/128 mailbox_size_limit = 0 recipient_delimiter = + inet_interfaces = all mynetworks_style = host # how long if undelivered before sending warning update to sender delay_warning_time = 4h # will it be a permanent error or temporary unknown_local_recipient_reject_code = 450 # how long to keep message on queue before return as failed. # some have 3 days, I have 16 days as I am backup server for some people # whom go on holiday with their server switched off. maximal_queue_lifetime = 7d # max and min time in seconds between retries if connection failed minimal_backoff_time = 1000s maximal_backoff_time = 8000s # how long to wait when servers connect before receiving rest of data smtp_helo_timeout = 60s # how many address can be used in one message. # effective stopper to mass spammers, accidental copy in whole address list # but may restrict intentional mail shots. # but may restrict intentional mail shots. smtpd_recipient_limit = 16 # how many error before back off. smtpd_soft_error_limit = 3 # how many max errors before blocking it. smtpd_hard_error_limit = 12 # Requirements for the HELO statement smtpd_helo_restrictions = permit_mynetworks, permit # Requirements for the sender details smtpd_sender_restrictions = permit_sasl_authenticated, permit_mynetworks, warn_if_reject reject_non_fqdn_sender, reject_unknown_sender_domain, reject_unauth_pipelining, permit # Requirements for the connecting server smtpd_client_restrictions = reject_rbl_client sbl.spamhaus.org, reject_rbl_client blackholes.easynet.nl, reject_rbl_client dnsbl.njabl.org # Requirement for the recipient address smtpd_recipient_restrictions = reject_unauth_pipelining, permit_mynetworks, permit_sasl_authenticated, reject_non_fqdn_recipient, reject_unknown_recipient_domain, reject_unauth_destination, permit smtpd_data_restrictions = reject_unauth_pipelining # require proper helo at connections smtpd_helo_required = yes # waste spammers time before rejecting them smtpd_delay_reject = yes disable_vrfy_command = yes # not sure of the difference of the next two # but they are needed for local aliasing alias_maps = hash:/etc/postfix/aliases alias_database = hash:/etc/postfix/aliases # this specifies where the virtual mailbox folders will be located virtual_mailbox_base = /var/spool/mail/virtual # this is for the mailbox location for each user virtual_mailbox_maps = mysql:/etc/postfix/mysql_mailbox.cf # and this is for aliases virtual_alias_maps = mysql:/etc/postfix/mysql_alias.cf # and this is for domain lookups virtual_mailbox_domains = mysql:/etc/postfix/mysql_domains.cf # this is how to connect to the domains (all virtual, but the option is there) # not used yet # transport_maps = mysql:/etc/postfix/mysql_transport.cf virtual_uid_maps = static:5000 virtual_gid_maps = static:5000 # SASL smtpd_sasl_auth_enable = yes # If your potential clients use Outlook Express or other older clients # this needs to be set to yes broken_sasl_auth_clients = yes smtpd_sasl_security_options = noanonymous smtpd_sasl_local_domain =

    Read the article

  • Forwarding rsyslog to syslog-ng, with FQDN and facility separation

    - by Joshua Miller
    I'm attempting to configure my rsyslog clients to forward messages to my syslog-ng log repository systems. Forwarding messages works "out of the box", but my clients are logging short names, not FQDNs. As a result the messages on the syslog repo use short names as well, which is a problem because one can't determine which system the message originated from easily. My clients get their names through DHCP / DNS. I've tried a number of solutions trying to get this working, but without success. I'm using rsyslog 4.6.2 and syslog-ng 3.2.5. I've tried setting $PreserveFQDN on as the first directive in /etc/rsyslog.conf (and restarting rsyslog of course). It seems to have no effect. hostname --fqdn on the client returns the proper FQDN, so the problem isn't whether the system can actually figure out its own FQDN. $LocalHostName <fqdn> looked promising, but this directive isn't available in my version of rsyslog (Available since 4.7.4+, 5.7.3+, 6.1.3+). Upgrading isn't an option at the moment. Configuring the syslog-ng server to populate names based on reverse lookups via DNS isn't an option. There are complexities with reverse DNS and the public cloud. Specifying for the forwarder to use a custom template seems like a viable option at first glance. I can specify the following, which causes local logging to begin using the FQDN on the syslog-ng repo. $template MyTemplate, "%timestamp% <FQDN> %syslogtag%%msg%" $ActionForwardDefaultTemplate MyTemplate However, when I put this in place syslog-ng seems to be unable to categorize messages by facility or priority. Messages come in as FQDN, but everything is put in to user.log. When I don't use the custom template, messages are properly categorized under facility and priority, but with the short name. So, in summary, if I manually trick rsyslog into including the FQDN, priority and facility becomes lost details to syslog-ng. How can I get rsyslog to do FQDN logging which works properly going to a syslog-ng repository? rsyslog client config: $ModLoad imuxsock.so # provides support for local system logging (e.g. via logger command) $ModLoad imklog.so # provides kernel logging support (previously done by rklogd) $ActionFileDefaultTemplate RSYSLOG_TraditionalFileFormat *.info;mail.none;authpriv.none;cron.none /var/log/messages authpriv.* /var/log/secure mail.* -/var/log/maillog cron.* /var/log/cron *.emerg * uucp,news.crit /var/log/spooler local7.* /var/log/boot.log $WorkDirectory /var/spool/rsyslog # where to place spool files $ActionQueueFileName fwdRule1 # unique name prefix for spool files $ActionQueueMaxDiskSpace 1g # 1gb space limit (use as much as possible) $ActionQueueSaveOnShutdown on # save messages to disk on shutdown $ActionQueueType LinkedList # run asynchronously $ActionResumeRetryCount -1 # infinite retries if host is down *.* @syslog-ng1.example.com *.* @syslog-ng2.example.com syslog-ng configuration (abridged for brevity): options { flush_lines (0); time_reopen (10); log_fifo_size (1000); long_hostnames (off); use_dns (no); use_fqdn (yes); create_dirs (no); keep_hostname (yes); }; source src { unix-stream("/dev/log"); internal(); udp(ip(0.0.0.0) port(514)); }; destination per_host_destination { file( "/var/log/syslog-ng/devices/$HOST/$FACILITY.log" owner("root") group("root") perm(0644) dir_owner(root) dir_group(root) dir_perm(0775) create_dirs(yes)); }; log { source(src); destination(per_facility_destination); };

    Read the article

  • How do bots access directories on a server that are not DocumentRoot of public IP address? How do I stop them?

    - by tmsimont
    I have a local network set up with apache2 and "named" running on OpenSuse 13.1 Linux. I used the "named" service to use my computer as a domain server. I set up my router to point to ask my computer for domain lookups, so I have a chance to have it rewrite a bunch of domains on my network to its own local IP, 192.168.0.111 This works great. I use virtual host configuration to allow various domains and subdomains (re-routed to the same IP via named) to pull up different directories in my computer. For example: <VirtualHost *:80> ServerName 192.168.0.111 ServerAlias fmb.wa.net DocumentRoot /home/work/wa.net/fmb </VirtualHost> <VirtualHost *:80> ServerName 192.168.0.111 ServerAlias postrecord.wa.net DocumentRoot /home/work/wa.net/postrecord </VirtualHost> <VirtualHost *:80> ServerName 192.168.0.111 ServerAlias cvalley.wa.net DocumentRoot /home/work/wa.net/cvalley_local </VirtualHost> This makes it possible for me to hit cvalley.wa.net from any device in my network and get the site that lives in /home/work/wa.net/cvalley_local I decided to forward port 80 to this computer, so I could share a few development sites with coworkers. I can't control which site they see with the same named service, because they'd have to use my computer as their domain name server... So I added a line like this: <VirtualHost *:80> ServerName 192.168.0.111 ServerAlias MY.IP.XXX.XX DocumentRoot /home/work/wa.net/cvalley </VirtualHost> Where "MY.IP.XXX.XX" is my public IP address. This works as expected, when you hit my IP address from a public network you see the site that lives in /home/work/wa.net/cvalley. The point of confusion that I have is that there are public IP addresses in my logs in other sites. I would have expected it to be impossible to access other sites in my network, unless the public user somehow figured out what I'm calling my ServerAliases, and is mimicing my domain set up... How can public traffic be hitting my other local sites? How can I recreate this kind of access? Here are some examples of public IP's hitting my VirtualHost sites: 162.253.66.76 - - [15/Aug/2014:19:20:47 -0600] "GET /xmlrpc.php HTTP/1.0" 404 1004 "-" "-" 162.253.66.74 - - [16/Aug/2014:10:50:28 -0600] "GET / HTTP/1.0" 200 262 "-" "masscan/1.0 (https://github.com/robertdavidgraham/masscan)" 185.4.227.194 - - [16/Aug/2014:11:16:45 -0600] "GET http://24x7-allrequestsallowed.com/?PHPSESSID=1rysxtj500143WQMVT%5E_NAZ%5BQ HTTP/1.1" 200 262 "-" "-" 101.226.254.138 - - [16/Aug/2014:13:32:14 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" 162.253.66.74 - - [16/Aug/2014:14:26:19 -0600] "GET / HTTP/1.0" 200 262 "-" "masscan/1.0 (https://github.com/robertdavidgraham/masscan)" 212.129.2.119 - - [16/Aug/2014:16:00:51 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" 91.240.163.111 - - [16/Aug/2014:18:34:32 -0600] "GET / HTTP/1.0" 200 262 "-" "masscan/1.0 (https://github.com/robertdavidgraham/masscan)" 162.253.66.74 - - [16/Aug/2014:19:02:53 -0600] "GET / HTTP/1.0" 200 262 "-" "masscan/1.0 (https://github.com/robertdavidgraham/masscan)" 122.226.223.69 - - [17/Aug/2014:05:53:09 -0600] "GET http://www.k2proxy.com//hello.html HTTP/1.1" 404 1006 "-" "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.1; WOW64; Trident/6.0; SLCC2; .NET CLR 2.0.50727; .NET CLR 3.5.30729; .NET CLR 3.0.30729; Media Center PC 6.0; .NET4.0C; .NET4.0E)" ::1 - - [17/Aug/2014:10:19:26 -0600] "OPTIONS * HTTP/1.0" 200 - "-" "Apache/2.4.6 (Linux/SUSE) OpenSSL/1.0.1e PHP/5.4.20 (internal dummy connection)" 162.209.65.196 - - [17/Aug/2014:15:31:53 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" 111.206.199.163 - - [18/Aug/2014:11:12:56 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" 37.187.180.168 - - [18/Aug/2014:15:40:00 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" 62.210.38.226 - - [18/Aug/2014:18:35:16 -0600] "HEAD / HTTP/1.0" 200 - "-" "-" Is there anything that I can do to reliably deny public access by default, but allow it only in one VirtualHost?

    Read the article

  • The dynamic Type in C# Simplifies COM Member Access from Visual FoxPro

    - by Rick Strahl
    I’ve written quite a bit about Visual FoxPro interoperating with .NET in the past both for ASP.NET interacting with Visual FoxPro COM objects as well as Visual FoxPro calling into .NET code via COM Interop. COM Interop with Visual FoxPro has a number of problems but one of them at least got a lot easier with the introduction of dynamic type support in .NET. One of the biggest problems with COM interop has been that it’s been really difficult to pass dynamic objects from FoxPro to .NET and get them properly typed. The only way that any strong typing can occur in .NET for FoxPro components is via COM type library exports of Visual FoxPro components. Due to limitations in Visual FoxPro’s type library support as well as the dynamic nature of the Visual FoxPro language where few things are or can be described in the form of a COM type library, a lot of useful interaction between FoxPro and .NET required the use of messy Reflection code in .NET. Reflection is .NET’s base interface to runtime type discovery and dynamic execution of code without requiring strong typing. In FoxPro terms it’s similar to EVALUATE() functionality albeit with a much more complex API and corresponiding syntax. The Reflection APIs are fairly powerful, but they are rather awkward to use and require a lot of code. Even with the creation of wrapper utility classes for common EVAL() style Reflection functionality dynamically access COM objects passed to .NET often is pretty tedious and ugly. Let’s look at a simple example. In the following code I use some FoxPro code to dynamically create an object in code and then pass this object to .NET. An alternative to this might also be to create a new object on the fly by using SCATTER NAME on a database record. How the object is created is inconsequential, other than the fact that it’s not defined as a COM object – it’s a pure FoxPro object that is passed to .NET. Here’s the code: *** Create .NET COM InstanceloNet = CREATEOBJECT('DotNetCom.DotNetComPublisher') *** Create a Customer Object Instance (factory method) loCustomer = GetCustomer() loCustomer.Name = "Rick Strahl" loCustomer.Company = "West Wind Technologies" loCustomer.creditLimit = 9999999999.99 loCustomer.Address.StreetAddress = "32 Kaiea Place" loCustomer.Address.Phone = "808 579-8342" loCustomer.Address.Email = "[email protected]" *** Pass Fox Object and echo back values ? loNet.PassRecordObject(loObject) RETURN FUNCTION GetCustomer LOCAL loCustomer, loAddress loCustomer = CREATEOBJECT("EMPTY") ADDPROPERTY(loCustomer,"Name","") ADDPROPERTY(loCustomer,"Company","") ADDPROPERTY(loCUstomer,"CreditLimit",0.00) ADDPROPERTY(loCustomer,"Entered",DATETIME()) loAddress = CREATEOBJECT("Empty") ADDPROPERTY(loAddress,"StreetAddress","") ADDPROPERTY(loAddress,"Phone","") ADDPROPERTY(loAddress,"Email","") ADDPROPERTY(loCustomer,"Address",loAddress) RETURN loCustomer ENDFUNC Now prior to .NET 4.0 you’d have to access this object passed to .NET via Reflection and the method code to do this would looks something like this in the .NET component: public string PassRecordObject(object FoxObject) { // *** using raw Reflection string Company = (string) FoxObject.GetType().InvokeMember( "Company", BindingFlags.GetProperty,null, FoxObject,null); // using the easier ComUtils wrappers string Name = (string) ComUtils.GetProperty(FoxObject,"Name"); // Getting Address object – then getting child properties object Address = ComUtils.GetProperty(FoxObject,"Address");    string Street = (string) ComUtils.GetProperty(FoxObject,"StreetAddress"); // using ComUtils 'Ex' functions you can use . Syntax     string StreetAddress = (string) ComUtils.GetPropertyEx(FoxObject,"AddressStreetAddress"); return Name + Environment.NewLine + Company + Environment.NewLine + StreetAddress + Environment.NewLine + " FOX"; } Note that the FoxObject is passed in as type object which has no specific type. Since the object doesn’t exist in .NET as a type signature the object is passed without any specific type information as plain non-descript object. To retrieve a property the Reflection APIs like Type.InvokeMember or Type.GetProperty().GetValue() etc. need to be used. I made this code a little simpler by using the Reflection Wrappers I mentioned earlier but even with those ComUtils calls the code is pretty ugly requiring passing the objects for each call and casting each element. Using .NET 4.0 Dynamic Typing makes this Code a lot cleaner Enter .NET 4.0 and the dynamic type. Replacing the input parameter to the .NET method from type object to dynamic makes the code to access the FoxPro component inside of .NET much more natural: public string PassRecordObjectDynamic(dynamic FoxObject) { // *** using raw Reflection string Company = FoxObject.Company; // *** using the easier ComUtils class string Name = FoxObject.Name; // *** using ComUtils 'ex' functions to use . Syntax string Address = FoxObject.Address.StreetAddress; return Name + Environment.NewLine + Company + Environment.NewLine + Address + Environment.NewLine + " FOX"; } As you can see the parameter is of type dynamic which as the name implies performs Reflection lookups and evaluation on the fly so all the Reflection code in the last example goes away. The code can use regular object ‘.’ syntax to reference each of the members of the object. You can access properties and call methods this way using natural object language. Also note that all the type casts that were required in the Reflection code go away – dynamic types like var can infer the type to cast to based on the target assignment. As long as the type can be inferred by the compiler at compile time (ie. the left side of the expression is strongly typed) no explicit casts are required. Note that although you get to use plain object syntax in the code above you don’t get Intellisense in Visual Studio because the type is dynamic and thus has no hard type definition in .NET . The above example calls a .NET Component from VFP, but it also works the other way around. Another frequent scenario is an .NET code calling into a FoxPro COM object that returns a dynamic result. Assume you have a FoxPro COM object returns a FoxPro Cursor Record as an object: DEFINE CLASS FoxData AS SESSION OlePublic cAppStartPath = "" FUNCTION INIT THIS.cAppStartPath = ADDBS( JustPath(Application.ServerName) ) SET PATH TO ( THIS.cAppStartpath ) ENDFUNC FUNCTION GetRecord(lnPk) LOCAL loCustomer SELECT * FROM tt_Cust WHERE pk = lnPk ; INTO CURSOR TCustomer IF _TALLY < 1 RETURN NULL ENDIF SCATTER NAME loCustomer MEMO RETURN loCustomer ENDFUNC ENDDEFINE If you call this from a .NET application you can now retrieve this data via COM Interop and cast the result as dynamic to simplify the data access of the dynamic FoxPro type that was created on the fly: int pk = 0; int.TryParse(Request.QueryString["id"],out pk); // Create Fox COM Object with Com Callable Wrapper FoxData foxData = new FoxData(); dynamic foxRecord = foxData.GetRecord(pk); string company = foxRecord.Company; DateTime entered = foxRecord.Entered; This code looks simple and natural as it should be – heck you could write code like this in days long gone by in scripting languages like ASP classic for example. Compared to the Reflection code that previously was necessary to run similar code this is much easier to write, understand and maintain. For COM interop and Visual FoxPro operation dynamic type support in .NET 4.0 is a huge improvement and certainly makes it much easier to deal with FoxPro code that calls into .NET. Regardless of whether you’re using COM for calling Visual FoxPro objects from .NET (ASP.NET calling a COM component and getting a dynamic result returned) or whether FoxPro code is calling into a .NET COM component from a FoxPro desktop application. At one point or another FoxPro likely ends up passing complex dynamic data to .NET and for this the dynamic typing makes coding much cleaner and more readable without having to create custom Reflection wrappers. As a bonus the dynamic runtime that underlies the dynamic type is fairly efficient in terms of making Reflection calls especially if members are repeatedly accessed. © Rick Strahl, West Wind Technologies, 2005-2010Posted in COM  FoxPro  .NET  CSharp  

    Read the article

< Previous Page | 9 10 11 12 13 14 15  | Next Page >