Search Results

Search found 6798 results on 272 pages for 'continuous backup'.

Page 130/272 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • Professional Scrum Developer (.NET) Training in London

    - by Martin Hinshelwood
    On the 26th - 30th July in Microsoft’s offices in London Adam Cogan from SSW will be presenting the first Professional Scrum Developer course in the UK. I will be teaching this course along side Adam and it is a fantastic experience. You are split into teams and go head-to-head to deliver units of potentially shippable work in four two hour sprints. The Professional Scrum Developer course is the only course endorsed by both Microsoft and Ken Schwaber and they have worked together very effectively in brining this course to fruition. This course is the brain child of Richard Hundhausen, a Microsoft Regional Director, and both Adam and I attending the Trainer Prep in Sydney when he was there earlier this year. He is a fantastic trainer and no matter where you do this course you can be safe in the knowledge that he has trained and vetted all of the teachers. A tools version of Ken if you will Find a course and register Download this syllabus Download the Scrum Guide What is the Professional Scrum Developer course all about? Professional Scrum Developer course is a unique and intensive five-day experience for software developers. The course guides teams on how to turn product requirements into potentially shippable increments of software using the Scrum framework, Visual Studio 2010, and modern software engineering practices. Attendees will work in self-organizing, self-managing teams using a common instance of Team Foundation Server 2010. Who should attend this course? This course is suitable for any member of a software development team – architect, programmer, database developer, tester, etc. Entire teams are encouraged to attend and experience the course together, but individuals are welcome too. Attendees will self-organize to form cross-functional Scrum teams. These teams require an aggregate of skills specific to the selected case study. Please see the last page of this document for specific details. Product Owners, ScrumMasters, and other stakeholders are welcome too, but keep in mind that everyone who attends will be expected to commit to work and pull their weight on a Scrum team. What should you know by the end of the course? Scrum will be experienced through a combination of lecture, demonstration, discussion, and hands-on exercises. Attendees will learn how to do Scrum correctly while being coached and critiqued by the instructor, in the following topic areas: Form effective teams Explore and understand legacy “Brownfield” architecture Define quality attributes, acceptance criteria, and “done” Create automated builds How to handle software hotfixes Verify that bugs are identified and eliminated Plan releases and sprints Estimate product backlog items Create and manage a sprint backlog Hold an effective sprint review Improve your process by using retrospectives Use emergent architecture to avoid technical debt Use Test Driven Development as a design tool Setup and leverage continuous integration Use Test Impact Analysis to decrease testing times Manage SQL Server development in an Agile way Use .NET and T-SQL refactoring effectively Build, deploy, and test SQL Server databases Create and manage test plans and cases Create, run, record, and play back manual tests Setup a branching strategy and branch code Write more maintainable code Identify and eliminate people and process dysfunctions Inspect and improve your team’s software development process What does the week look like? This course is a mix of lecture, demonstration, group discussion, simulation, and hands-on software development. The bulk of the course will be spent working as a team on a case study application delivering increments of new functionality in mini-sprints. Here is the week at a glance: Monday morning and most of the day Friday will be spent with the computers powered off, so you can focus on sharpening your game of Scrum and avoiding the common pitfalls when implementing it. The Sprints Timeboxing is a critical concept in Scrum as well as in this course. We expect each team and student to understand and obey all of the timeboxes. The timebox duration will always be clearly displayed during each activity. Expect the instructor to enforce it. Each of the ½ day sprints will roughly follow this schedule: Component Description Minutes Instruction Presentation and demonstration of new and relevant tools & practices 60 Sprint planning meeting Product owner presents backlog; each team commits to delivering functionality 10 Sprint planning meeting Each team determines how to build the functionality 10 The Sprint The team self-organizes and self-manages to complete their tasks 120 Sprint Review meeting Each team will present their increment of functionality to the other teams = 30 Sprint Retrospective A group retrospective meeting will be held to inspect and adapt 10 Each team is expected to self-organize and manage their own work during the sprint. Pairing is highly encouraged. The instructor/product owner will be available if there are questions or impediments, but will be hands-off by default. You should be prepared to communicate and work with your team members in order to achieve your sprint goal. If you have development-related questions or get stuck, your partner or team should be your first level of support. Module 1: INTRODUCTION This module provides a chance for the attendees to get to know the instructors as well as each other. The Professional Scrum Developer program, as well as the day by day agenda, will be explained. Finally, the Scrum team will be selected and assembled so that the forming, storming, norming, and performing can begin. Trainer and student introductions Professional Scrum Developer program Agenda Logistics Team formation Retrospective Module 2: SCRUMDAMENTALS This module provides a level-setting understanding of the Scrum framework including the roles, timeboxes, and artifacts. The team will then experience Scrum firsthand by simulating a multi-day sprint of product development, including planning, review, and retrospective meetings. Scrum overview Scrum roles Scrum timeboxes (ceremonies) Scrum artifacts Simulation Retrospective It’s required that you read Ken Schwaber’s Scrum Guide in preparation for this module and course. MODULE 3: IMPLEMENTING SCRUM IN VISUAL STUDIO 2010 This module demonstrates how to implement Scrum in Visual Studio 2010 using a Scrum process template*. The team will learn the mapping between the Scrum concepts and how they are implemented in the tool. After connecting to the shared Team Foundation Server, the team members will then return to the simulation – this time using Visual Studio to manage their product development. Mapping Scrum to Visual Studio 2010 User Story work items Task work items Bug work items Demonstration Simulation Retrospective Module 4: THE CASE STUDY In this module the team is introduced to their problem domain for the week. A kickoff meeting by the Product Owner (the instructor) will set the stage for the why and what that will take during the upcoming sprints. The team will then define the quality attributes of the project and their definition of “done.” The legacy application code will be downloaded, built, and explored, so that any bugs can be discovered and reported. Introduction to the case study Download the source code, build, and explore the application Define the quality attributes for the project Define “done” How to file effective bugs in Visual Studio 2010 Retrospective Module 5: HOTFIX This module drops the team directly into a Brownfield (legacy) experience by forcing them to analyze the existing application’s architecture and code in order to locate and fix the Product Owner’s high-priority bug(s). The team will learn best practices around finding, testing, fixing, validating, and closing a bug. How to use Architecture Explorer to visualize and explore Create a unit test to validate the existence of a bug Find and fix the bug Validate and close the bug Retrospective Module 6: PLANNING This short module introduces the team to release and sprint planning within Visual Studio 2010. The team will define and capture their goals as well as other important planning information. Release vs. Sprint planning Release planning and the Product Backlog Product Backlog prioritization Acceptance criteria and tests Sprint planning and the Sprint Backlog Creating and linking Sprint tasks Retrospective At this point the team will have the knowledge of Scrum, Visual Studio 2010, and the case study application to begin developing increments of potentially shippable functionality that meet their definition of done. Module 7: EMERGENT ARCHITECTURE This module introduces the architectural practices and tools a team can use to develop a valid design on which to develop new functionality. The teams will learn how Scrum supports good architecture and design practices. After the discussion, the teams will be presented with the product owner’s prioritized backlog so that they may select and commit to the functionality they can deliver in this sprint. Architecture and Scrum Emergent architecture Principles, patterns, and practices Visual Studio 2010 modeling tools UML and layer diagrams SPRINT 1 Retrospective Module 8: TEST DRIVEN DEVELOPMENT This module introduces Test Driven Development as a design tool and how to implement it using Visual Studio 2010. To maximize productivity and quality, a Scrum team should setup Continuous Integration to regularly build every team member’s code changes and run regression tests. Refactoring will also be defined and demonstrated in combination with Visual Studio’s Test Impact Analysis to efficiently re-run just those tests which were impacted by refactoring. Continuous integration Team Foundation Build Test Driven Development (TDD) Refactoring Test Impact Analysis SPRINT 2 Retrospective Module 9: AGILE DATABASE DEVELOPMENT This module lets the SQL Server database developers in on a little secret – they can be agile too. By using the database projects in Visual Studio 2010, the database developers can join the rest of the team. The students will see how to apply Agile database techniques within Visual Studio to support the SQL Server 2005/2008/2008R2 development lifecycle. Agile database development Visual Studio database projects Importing schema and scripts Building and deploying Generating data Unit testing SPRINT 3 Retrospective Module 10: SHIP IT Teams need to know that just because they like the functionality doesn’t mean the Product Owner will. This module revisits acceptance criteria as it pertains to acceptance testing. By refining acceptance criteria into manual test steps, team members can execute the tests, recording the results and reporting bugs in a number of ways. Manual tests will be defined and executed using the Microsoft Test Manager tool. As the Sprint completes and an increment of functionality is delivered, the team will also learn why and when they should create a branch of the codeline. Acceptance criteria Testing in Visual Studio 2010 Microsoft Test Manager Writing and running manual tests Branching SPRINT 4 Retrospective Module 11: OVERCOMING DYSFUNCTION This module introduces the many types of people, process, and tool dysfunctions that teams face in the real world. Many dysfunctions and scenarios will be identified, along with ideas and discussion for how a team might mitigate them. This module will enable you and your team to move toward independence and improve your game of Scrum when you depart class. Scrum-butts and flaccid Scrum Best practices working as a team Team challenges ScrumMaster challenges Product Owner challenges Stakeholder challenges Course Retrospective What will be expected of you and you team? This is a unique course in that it’s technically-focused, team-based, and employs timeboxes. It demands that the members of the teams self-organize and self-manage their own work to collaboratively develop increments of software. All attendees must commit to: Pay attention to all lectures and demonstrations Participate in team and group discussions Work collaboratively with other team members Obey the timebox for each activity Commit to work and do your best to deliver All teams should have these skills: Understanding of Scrum Familiarity with Visual Studio 201 C#, .NET 4.0 & ASP.NET 4.0 experience*  SQL Server 2008 development experience Software testing experience * Check with the instructor ahead of time for the exact technologies Self-organising teams Another unique attribute of this course is that it’s a technical training class being delivered to teams of developers, not pairs, and not individuals. Ideally, your actual software development team will attend the training to ensure that all necessary skills are covered. However, if you wish to attend an open enrolment course alone or with just a couple of colleagues, realize that you may be placed on a team with other attendees. The instructor will do his or her best to ensure that each team is cross-functional to tackle the case study, but there are no guarantees. You may be required to try a new role, learn a new skill, or pair with somebody unfamiliar to you. This is just good Scrum! Who should NOT take this course? Because of the nature of this course, as explained above, certain types of people should probably not attend this course: Students requiring command and control style instruction – there are no prescriptive/step-by-step (think traditional Microsoft Learning) labs in this course Students who are unwilling to work within a timebox Students who are unwilling to work collaboratively on a team Students who don’t have any skill in any of the software development disciplines Students who are unable to commit fully to their team – not only will this diminish the student’s learning experience, but it will also impact their team’s learning experience Find a course and register Download this syllabus Download the Scrum Guide Technorati Tags: Scrum,SSW,Pro Scrum Dev

    Read the article

  • Add Your Own Domain to Your WordPress.com Blog

    - by Matthew Guay
    Now that you’ve got a nice blog on WordPress.com, why not get your own domain to brand your site?  Here’s how you can easily register a new domain or move your existing domain to your WordPress site. By default, your free WordPress address is yourblog’sname.wordpress.com.  But whether this is a personal or a company blog, it can be nice to have your own domain to really brand your site and make it your own.  Or, if you already have another website and want to use WordPress as a blog for it, you could even add blog.yoursite.com or any other subdomain. Adding a domain to your WordPress.com is a paid upgrade; registering and mapping a new domain to your account costs $14.97 a year, while mapping a domain you already own to your WordPress blog costs $9.97 a year. Getting Started Login to your blog’s dashboard, click the arrow beside Upgrades in the sidebar, and select Domains. Enter the domain or subdomain you want to add to your site in the text box, and click Add domain to blog.   If you entered a new domain you want to register, WordPress will make sure the domain is available and then present you a registration form to register the domain.  Enter your information, and then click Register Domain.   Or, if you enter a domain that’s already registered, you will see the following prompt. If this domain is a domain you own, you can map it to WordPress.com.  Login to your domain registrar account and switch your nameserver to: NS1.WORDPRESS.COM NS2.WORDPRESS.COM NS3.WORDPRESS.COM Your DNS settings page for your domain may be different, depending on your registrar.  Here’s how our domain settings looked. Alternately, if you’re wanting to map a subdomain, such as blog.yoursite.com to your WordPress blog, create the following CNAME record on your domain register.  You may have to contact your domain registrar’s support to do this.  Substitute your subdomain, domain, and blog name when creating the record. subdomain.yourdomain.com. IN CNAME yourblog.wordpress.com. Once your settings are correct, click Try Again in your WordPress dashboard.  The DNS settings may take a while to update, but once WordPress can tell your DNS settings point to it, you will see the following confirmation screen.  Click Map Domain to add this domain to your WordPress blog. Now you’re ready to pay for your domain mapping or registration.  Depending on your purchase, the information and price shown may be different.  Here we’re mapping a domain we already have registered, so it costs $9.97.  Select your method of payment, enter your payment information or signin with your Paypal account, and continue as usual. Once your purchase is finished, you’ll be returned to the Domains page on WordPress.  Try going to your new domain, and make sure it opens your blog.  If it works, then click the bullet beside the new domain, and click Update Primary Domain.  Now, when people visit your WordPress site, they’ll see your new domain in the address bar.  You can still access your blog from your old yourname.wordpress.com address, but it will redirect to you new domain. Conclusion Having a personalized domain is a great way to make your blog more professional, while still taking advantage of the ease of use that WordPress.com offers.  And, if you have your own domain, you can easily move to your site traffic to a different hosting provider in the future if you need to.  The process is slightly complicated, but for $15/year we found this one of the best upgrades you could do to your WordPress.com blog. If you want to see an example of a site created with Wordpress, check out Matthew’s tech site techinch.com. And, if you’re just getting started with WordPress, check out our series on how to Start your WordPress.com blog, Personalize it, and Easily Post Content to it from anywhere. Similar Articles Productive Geek Tips Add Social Bookmarking (Digg This!) Links to your Wordpress BlogHow-To Geek SoftwareHow To Start Your Own Professional Blog with WordPressDisable Logon to Windows Computers When Not Connected to a DomainMake a Backup Copy of your Production Wordpress Blog on Ubuntu TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Snagit 10 Use ILovePDF To Split and Merge PDF Files TimeToMeet is a Simple Online Meeting Planning Tool Easily Create More Bookmark Toolbars in Firefox Filevo is a Cool File Hosting & Sharing Site Get a free copy of WinUtilities Pro 2010 World Cup Schedule

    Read the article

  • 8 Mac System Features You Can Access in Recovery Mode

    - by Chris Hoffman
    A Mac’s Recovery Mode is for more than just reinstalling Mac OS X. You’ll find many other useful troubleshooting utilities here — you can use these even if your Mac can’t boot normally. To access Recovery Mode, restart your Mac and press and hold the Command + R keys during the boot-up process. This is one of several hidden startup options on a Mac. Reinstall Mac OS X Most people know Recovery Mode as the place you go to reinstall OS X on your Mac. Recovery Mode will download the OS X installer files from teh Intenret if you don’t have them locally, so they don’t take up space on your disk and you’ll never have to hunt for an opearign system disc. Better yet, it will download up-to-date installation files so you don’t have to spend hours installing operating system updates later. Microsoft could learn a lot from Apple here. Restore From a Time Machine Backup Instead of reinstalling OS X, you can choose to restore your Mac from a time machine backup. This is like restoring a system image on another operating system. You’ll need an external disk containing a backup image created on the current computer to do this. Browse the Web The Get Help Online link opens the Safari web browser to Apple’s documentation site. It’s not limited to Apple’s website, though — you can navigate to any website you like. This feature allows you to access and use a browser on your Mac even if it isn’t booting properly. It’s ideal for looking up troubleshooting information. Manage Your Disks The Disk Utility option opens the same Disk Utility you can access from within Mac OS X. It allows you to partition disks, format them, scan disks for problems, wipe drives, and set up drives in a RAID configuration. If you need to edit partitions from outside your operating system, you can just boot into the recovery environment — you don’t have to download a special partitioning tool and boot into it. Choose the Default Startup Disk Click the Apple menu on the bar at the top of your screen and select Startup Disk to access the Choose Startup Disk tool. Use this tool to choose your computer’s default startup disk and reboot into another operating system. For example, it’s useful if you have Windows installed alongside Mac OS X with Boot Camp. Add or Remove an EFI Firmware Password You can also add a firmware password to your Mac. This works like a BIOS password or UEFI password on a Windows or Linux PC. Click the Utilities menu on the bar at the top of your screen and select Firmware Password Utility to open this tool. Use the tool to turn on a firmware password, which will prevent your computer from starting up from a different hard disk, CD, DVD, or USB drive without the password you provide. This prevents people form booting up your Mac with an unauthorized operating system. If you’ve already enabled a firmware password, you can remove it from here. Use Network Tools to Troubleshoot Your Connection Select Utilities > Network Utility to open a network diagnostic tool. This utility provides a graphical way to view your network connection information. You can also use the netstat, ping, lookup, traceroute, whois, finger, and port scan utilities from here. These can be helpful to troubleshoot Internet connection problems. For example, the ping command can demonstrate whether you can communicate with a remote host and show you if you’re experiencing packet loss, while the traceroute command can show you where a connection is failing if you can’t connect to a remote server. Open a Terminal If you’d like to get your hands dirty, you can select Utilities > Terminal to open a terminal from here. This terminal allows you to do more advanced troubleshooting. Mac OS X uses the bash shell, just as typical Linux distributions do. Most people will just need to use the Reinstall Mac OS X option here, but there are many other tools you can benefit from. If the Recovery Mode files on your Mac are damaged or unavailable, your Mac will automatically download them from Apple so you can use the full recovery environment.

    Read the article

  • How To Replace Notepad in Windows 7

    - by Trevor Bekolay
    It used to be that Notepad was a necessary evil because it started up quickly and let us catch a quick glimpse of plain text files. Now, there are a bevy of capable Notepad replacements that are just as fast, but also have great feature sets. Before following the rest of this how-to, ensure that you’re logged into an account with Administrator access. Note: The following instructions involve modifying some Windows system folders. Don’t mess anything up while you’re in there! If you follow our instructions closely, you’ll be fine. Choose your replacement There are a ton of great Notepad replacements, including Notepad2, Metapad, and Notepad++. The best one for you will depend on what types of text files you open and what you do with them. We’re going to use Notepad++ in this how-to. The first step is to find the executable file that you’ll replace Notepad with. Usually this will be the only file with the .exe file extension in the folder where you installed your text editor. Copy the executable file to your desktop and try to open it, to make sure that it works when opened from a different folder. In the Notepad++ case, a special little .exe file is available for the explicit purpose of replacing Notepad.If we run it from the desktop, it opens up Notepad++ in all its glory. Back up Notepad You will probably never go back once you switch, but you never know. You can backup Notepad to a special location if you’d like, but we find it’s easiest to just keep a backed up copy of Notepad in the folders it was originally located. In Windows 7, Notepad resides in: C:\Windows C:\Windows\System32 C:\Windows\SysWOW64 in 64-bit versions only Navigate to each of those directories and copy Notepad. Paste it into the same folder. If prompted, choose to Copy, but keep both files. You can keep your backup as “notepad (2).exe”, but we prefer to rename it to “notepad.exe.bak”. Do this for all of the folders that have Notepad (2 total for 32-bit Windows 7, 3 total for 64-bit). Take control of Notepad and delete it Even if you’re on an administrator account, you can’t just delete Notepad – Microsoft has made some security gains in this respect. Fortunately for us, it’s still possible to take control of a file and delete it without resorting to nasty hacks like disabling UAC. Navigate to one of the directories that contain Notepad. Right-click on it and select Properties.   Switch to the Security tab, then click on the Advanced button. Note that the owner of the file is a user called “TrustedInstaller”. You can’t do much with files owned by TrustedInstaller, so let’s take control of it. Click the Edit… button. Select the desired owner (you could choose your own account, but we’re going to give any Administrator control) and click OK. You’ll get a message that you need to close and reopen the Properties windows to edit permissions. Before doing that, confirm that the owner has changed to what you selected. Click OK, then OK again to close the Properties window. Right-click on Notepad and click on Properties again. Switch to the Security tab. Click on Edit…. Select the appropriate group or user name in the list at the top, then add a checkmark in the checkbox beside Full control in the Allow column. Click OK, then Yes to the dialog box that pops up. Click OK again to close the Properties window. Now you can delete Notepad, by either selecting it and pressing Delete on the keyboard, or right-click on it and click Delete.   You’re now free from Notepad’s foul clutches! Repeat this procedure for the remaining folders (or folder, on 32-bit Windows 7). Drop in your replacement Copy your Notepad replacement’s executable, which should still be on your desktop. Browse to the two or three folders listed above and copy your .exe to those locations. If prompted for Administrator permission, click Continue. If your executable file was named something other than “notepad.exe”, rename it to “notepad.exe”. Don’t be alarmed if the thumbnail still shows the old Notepad icon. Double click on Notepad and your replacement should open. To make doubly sure that it works, press Win+R to bring up the Run dialog box and enter “notepad” into the text field. Press enter or click OK. Now you can allow Windows to open files with Notepad by default with little to no shame! All without restarting or having to disable UAC! Similar Articles Productive Geek Tips Search and Replace Specific Formatting (fonts, styles,etc) in Microsoft WordHow to Drag Files to the Taskbar to Open Them in Windows 7Customize the Windows 7 or Vista Send To MenuKill Processes from the Windows Command LineChange Your Windows 7 Library Icons the Easy Way TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Use My TextTools to Edit and Organize Text Discovery Channel LIFE Theme (Win7) Increase the size of Taskbar Previews (Win 7) Scan your PC for nasties with Panda ActiveScan CleanMem – Memory Cleaner AceStock – The Personal Stock Monitor

    Read the article

  • Sort Your Emails by Conversation in Outlook 2010

    - by Matthew Guay
    Do you prefer the way Gmail sorts your emails by conversation?  Here’s how you can use this handy feature in Outlook 2010 too. One exciting new feature in Outlook 2010 is the ability to sort and link your emails by conversation.  This makes it easier to know what has been discussed in emails, and helps you keep your inbox more tidy.  Some users don’t like their emails linked into conversations, and in the final release of Outlook 2010 it is turned off by default.  Since this is a new feature, new users may overlook it and never know it’s available.  Here’s how you can enable conversation view and keep your email conversations accessible and streamlined. Activate Conversation View By default, your inbox in Outlook 2010 will look much like it always has in Outlook…a list of individual emails. To view your emails by conversation, select the View tab and check the Show as Conversations box on the top left. Alternately, click on the Arrange By tab above your emails, and select Show as Conversations. Outlook will ask if you want to activate conversation view in only this folder or all folders.  Choose All folders to view all emails in Outlook in conversations. Outlook will now resort your inbox, linking emails in the same conversation together.  Individual emails that don’t belong to a conversation will look the same as before, while conversations will have a white triangle carrot on the top left of the message title.  Select the message to read the latest email in the conversation. Or, click the triangle to see all of the messages in the conversation.  Now you can select and read any one of them. Most email programs and services include the previous email in the body of an email when you reply.  Outlook 2010 can recognize these previous messages as well.  You can navigate between older and newer messages from popup Next and Previous buttons that appear when you hover over the older email’s header.  This works both in the standard Outlook preview pane and when you open an email in its own window.   Edit Conversation View Settings Back in the Outlook View tab, you can tweak your conversation view to work the way you want.  You can choose to have Outlook Always Expand Conversations, Show Senders Above the Subject, and to Use Classic Indented View.  By default, Outlook will show messages from other folders in the conversation, which is generally helpful; however, if you don’t like this, you can uncheck it here.  All of these settings will stay the same across all of your Outlook accounts. If you choose Indented View, it will show the title on the top and then an indented message entry underneath showing the name of the sender. The Show Senders Above the Subject view makes it more obvious who the email is from and who else is active in the conversation.  This is especially useful if you usually only email certain people about certain topics, making the subject lines less relevant. Or, if you decide you don’t care for conversation view, you can turn it off by unchecking the box in the View tab as above. Conclusion Although it may take new users some time to get used to, conversation view can be very helpful in keeping your inbox organized and letting important emails stay together.  If you’re a Gmail user syncing your email account with Outlook, you may find this useful as it makes Outlook 2010 work more like Gmail, even when offline. If you’d like to sync your Gmail account with Outlook 2010, check out our articles on syncing it with POP3 and IMAP. Similar Articles Productive Geek Tips Automatically Move Daily Emails to Specific Folders in OutlookQuickly Clean Your Inbox in Outlook 2003/2007Find Emails With Attachments with Outlook 2007’s Instant SearchAdd Your Gmail Account to Outlook 2010 using POPSchedule Auto Send & Receive in Microsoft Outlook TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips CloudBerry Online Backup 1.5 for Windows Home Server Snagit 10 VMware Workstation 7 Acronis Online Backup The iPod Revolution Ultimate Boot CD can help when disaster strikes Windows Firewall with Advanced Security – How To Guides Sculptris 1.0, 3D Drawing app AceStock, a Tiny Desktop Quote Monitor Gmail Button Addon (Firefox)

    Read the article

  • Improve the Quality of ePub eBooks with Sigil

    - by Matthew Guay
    Would you like to correct errors in your ePub formatted eBooks, or even split them into chapters and create a Table of Contents?  Here’s how you can with the free program Sigil. eBooks are increasingly popular with the rise of eBook readers and reading apps on mobile devices.  We recently showed you how to convert a PDF eBook to ePub format, but as you may have noticed, sometimes the converted file had some glitches or odd formatting.  Additionally, many of the many free ePub books available online from sources like the Project Guttenberg do not include a table of contents.  Sigil is a free application for Windows, OS X, and Linux that lets you edit ePub files, so let’s look at how you can use it to improve your eBooks. Note: Sigil took several moments to open files in our tests, and froze momentarily when we maximized the window.  Sigil is currently pre-release software in active development, so we would expect the bugs to be worked out in future versions.  As usual, only install if you’re comfortable testing pre-release software. Getting Started Download Sigil (link below), making sure to select the correct version for your computer.  Run the installer, and select your preferred setup language when prompted. After a moment the installer will appear; setup as normal. Launch Sigil when it’s finished installing.  It opens with a default blank ePub file, so you could actually start writing an eBook from scratch right here. Edit Your ePub eBooks Now you’re ready to edit your ePub books.  Click Open and browse to the file you want to edit. Now you can double-click any of the HTML or XHTML files on the left sidebar and edit them just like you would in Word. Or you can choose to view it in Code View and edit the actual HTML directly. The sidebar also gives you access to the other parts of the ePub file, such as Images and CSS styles. If your ePub file has a Table of Contents, you can edit it with Sigil as well.  Click Tools in the menu bar, and then select TOC Editor.  Strangely there is no way to create a new table of contents, but you can remove entries from existing one.   Convert TXT Files to ePub Many free eBooks online, especially older, out of copyright titles, are available in plain text format.  One problem with these files is that they usually use hard returns at the end of lines, so they don’t reflow to fill your screen efficiently. Sigil can easily convert these files to the more useful ePub format.  Open the text file in Sigil, and it will automatically reflow the text and convert it ePub.  As you can see in the screenshot below, the text in the eBook does not have hard line-breaks at the end of each line, and will be much more readable on mobile devices. Note that Sigil may take several moments opening the book, and may even become unresponsive while analyzing it.   Now you can edit your eBook, split it into chapters, or just save it as is.  Either way, make sure to select Save as to save your book as ePub format. Conclusion As mentioned before, Sigil seems to run slow at times, especially when editing large eBooks.  But it’s still a nice solution to edit and extend your ePub eBooks, and even convert plain text eBooks to the nicer ePub format.  Now you can make your eBooks work just like you want, and read them on your favorite device! If you feel comfortable editing HTML files, check out our article on how to edit ePub eBooks with your favorite HTML editor. Link Download Sigil from Google Code Download free ePub eBooks from Project Guttenberg Similar Articles Productive Geek Tips Edit ePub eBooks with Your Favorite HTML EditorConvert a PDF eBook to ePub Format for Your iPad, iPhone, or eReaderRead Mobi eBooks on Kindle for PCFriday Fun: Watch HD Video Content with MeevidPreview and Purchase Ebooks with Kindle for PC TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips HippoRemote Pro 2.2 Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Get Your Team’s World Cup Schedule In Google Calendar Backup Drivers With Driver Magician TubeSort: YouTube Playlist Organizer XPS file format & XPS Viewer Explained Microsoft Office Web Apps Guide Know if Someone Accessed Your Facebook Account

    Read the article

  • some files just wont install- linux-image-3.5.0-42-generic

    - by jatin
    It gives the following details of the package operation failing after using the sofware updater on 12.10: installArchives() failed: perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LANG = "en_IN.ISO8859-1" are supported and installed on your system. perl: warning: Falling back to the standard locale ("C"). locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Preconfiguring packages ... perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LANG = "en_IN.ISO8859-1" are supported and installed on your system. perl: warning: Falling back to the standard locale ("C"). locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Preconfiguring packages ... perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LANG = "en_IN.ISO8859-1" are supported and installed on your system. perl: warning: Falling back to the standard locale ("C"). locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Preconfiguring packages ... perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = (unset), LC_ALL = (unset), LANG = "en_IN.ISO8859-1" are supported and installed on your system. perl: warning: Falling back to the standard locale ("C"). locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Preconfiguring packages ... (Reading database ... (Reading database ... 217566 files and directories currently installed.) Preparing to replace linux-image-3.5.0-36-generic 3.5.0-36.57~precise1 (using .../linux-image-3.5.0-36-generic_3.5.0-36.57_amd64.deb) ... locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Done. Unpacking replacement linux-image-3.5.0-36-generic ... dpkg: error processing /var/cache/apt/archives/linux-image-3.5.0-36-generic_3.5.0-36.57_amd64.deb (--unpack): unable to make backup link of `./boot/System.map-3.5.0-36-generic' before installing new version: Operation not permitted No apport report written because MaxReports is reached already dpkg-deb: error: subprocess paste was killed by signal (Broken pipe) Examining /etc/kernel/postrm.d . run-parts: executing /etc/kernel/postrm.d/initramfs-tools 3.5.0-36-generic /boot/vmlinuz-3.5.0-36-generic run-parts: executing /etc/kernel/postrm.d/zz-update-grub 3.5.0-36-generic /boot/vmlinuz-3.5.0-36-generic Preparing to replace linux-image-3.5.0-42-generic 3.5.0-42.65~precise1 (using .../linux-image-3.5.0-42-generic_3.5.0-42.65_amd64.deb) ... locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Done. Unpacking replacement linux-image-3.5.0-42-generic ... dpkg: error processing /var/cache/apt/archives/linux-image-3.5.0-42-generic_3.5.0-42.65_amd64.deb (--unpack): unable to make backup link of `./boot/System.map-3.5.0-42-generic' before installing new version: Operation not permitted No apport report written because MaxReports is reached already Examining /etc/kernel/postrm.d . run-parts: executing /etc/kernel/postrm.d/initramfs-tools 3.5.0-42-generic /boot/vmlinuz-3.5.0-42-generic dpkg-deb: error: subprocess paste was killed by signal (Broken pipe) run-parts: executing /etc/kernel/postrm.d/zz-update-grub 3.5.0-42-generic /boot/vmlinuz-3.5.0-42-generic Preparing to replace memtest86+ 4.20-1.1ubuntu1 (using .../memtest86+_4.20-1.1ubuntu2.1_amd64.deb) ... Unpacking replacement memtest86+ ... dpkg: error processing /var/cache/apt/archives/memtest86+_4.20-1.1ubuntu2.1_amd64.deb (--unpack): unable to make backup link of `./boot/memtest86+.bin' before installing new version: Operation not permitted No apport report written because MaxReports is reached already locale: Cannot set LC_CTYPE to default locale: No such file or directory locale: Cannot set LC_MESSAGES to default locale: No such file or directory locale: Cannot set LC_ALL to default locale: No such file or directory Errors were encountered while processing: /var/cache/apt/archives/linux-image-3.5.0-36-generic_3.5.0-36.57_amd64.deb /var/cache/apt/archives/linux-image-3.5.0-42-generic_3.5.0-42.65_amd64.deb /var/cache/apt/archives/memtest86+_4.20-1.1ubuntu2.1_amd64.deb Error in function: Output of df -h: Filesystem Size Used Avail Use% Mounted on /dev/sda6 38G 6.5G 30G 19% / udev 3.5G 4.0K 3.5G 1% /dev tmpfs 1.5G 924K 1.5G 1% /run none 5.0M 4.0K 5.0M 1% /run/lock none 3.6G 296K 3.6G 1% /run/shm none 100M 64K 100M 1% /run/user /dev/sda1 197M 87M 111M 44% /boot /dev/sda5 243G 971M 230G 1% /home

    Read the article

  • Access Services in SharePoint Server 2010

    - by Wayne
    Another SharePoint Server 2010 feature which cannot go unnoticed is the Access Services. Access Services is a service in SharePoint Server 2010 that allows administrators to view, edit, and configure a Microsoft access application within a Web Browser. Access Services settings support backup and recovery, regardless of whether there is a UI setting in Central Administration. However, backup and recovery only apply to service-level and administrative-level settings; end-user content from the Access application is not backed up as part of this process. Access Services has Windows PowerShell functionality that can be used to provide the service that uses settings from a previous backup; configure and manage macro and query setting; manage and configure session management; and configure all the global settings of the service. Key Benefits of SharePoint Server Access Services Easier Access to right tools: The enhanced, customizable Ribbon in Access 2010 makes it easy to uncover more commands so you can focus on the end product. The new Microsoft Office BackstageTM view is yet another feature that can help you easily analyze and document your database, share, publish, and customize your Access 2010 experience, all from one convenient location. Helps build database effortlessly and quickly: Out-of-the box templates and reusable components make Access Services the fastest, simplest database solution available. It helps find new pre-built templates which you can start using without customization or select templates created by your peers in the Access online community and customize them to meet your needs. It builds your databases with new modular components. New Application Parts enable you to add a set of common Access components, such as a table and form for task management, to your database in a few simple clicks. Database navigation is now simplified. It creates Navigation Forms and makes your frequently used forms and reports more accessible without writing any code or logic. Create Impactful forms and reports: Whether it's an inventory of your assets or customer sales database, Access 2010 brings the innovative tools you'd expect from Microsoft Office. Access Services easily spot trends and add emphasis to your data. It quickly create coordinating database forms and reports and bring the Web into your database. Obtain a centralized landing pad for your data: Access 2010 offers easy ways to bring your data together and help increase work quality. New technologies help break down barriers so you can share and work together on your databases, making you or your team more efficient and productive. Add automation and complex expressions: If you need a more robust database design, such as preventing record deletion if a specific condition is met or if you need to create calculations to forecast your budget, Access 2010 empowers you to be your own developer. The enhanced Expression Builder greatly simplifies your expression building experience with IntelliSense®. With the revamped Macro Designer, it's now even easier for you to add basic logic to your database. New Data Macros allow you to attach logic to your data, centralizing the logic on the table, not the objects that update your data. Key features of Access Services 2010 - Access database content through a Web browser: Newly added Access Services on Microsoft SharePoint Server 2010 enables you to make your databases available on the Web with new Web databases. Users without an Access client can open Web forms and reports via a browser and changes are automatically synchronized. - Simplify how you access the features you need: The Ribbon, improved in Access 2010, helps you access commands even more quickly by enabling you to customize or create your own tabs. The new Microsoft Office Backstage view replaces the traditional File menu to provide one central, organized location for all of your document management tasks. - Codeless navigation: Use professional looking web-like navigation forms to make frequently used forms and reports more accessible without writing any code or logic. - Easily reuse Access items in other databases: Use Application Parts to add pre-built Access components for common tasks to your database in a few simple clicks. You can also package common database components, such as data entry forms and reports for task management, and reuse them across your organization or other databases. - Simplified formatting: By using Office themes you can create coordinating professional forms and reports across your database. Simply select a familiar and great looking Office theme, or design your own, and apply it to your database. Newly created Access objects will automatically match your chosen theme.

    Read the article

  • How to move MOSS 2007 to another SharePoint Farm

    - by DipeshBhanani
    It was time of my first onsite client assignment on SharePoint. Client had one server production environment. They wanted to upgrade the topology with completely new SharePoint Farm of three servers. So, the task was to move whole MOSS 2007 stuff to the new server environment without impacting data. The last three words “… without impacting data…” were actually putting pressure on my head. Moreover SSP was required to move because additional information has been added for users apart from AD import.   I thought I had to do only backup and restore. It appeared pretty easy at first thought. Just because of these three damn scary words, I thought to check out on internet for guidance related to this scenario. I couldn’t get anything except general guidance of moving server on Microsoft TechNet site. I promised myself for starting blogs with this post if I would be successful in this task. Well, I took long time to write this but finally made it. I hope it will be useful to all guys looking for SharePoint server movement.   Before beginning restoration, make sure that, there is no difference in versions of SharePoint at source and destination server. Also check whether the state of SharePoint Installation at the time of backup and restore is same or not. (E.g. SharePoint related service packs and patches if any)   The main tasks of the server movement are as follow:   1.        Backup all the databases 2.        Install and configure SharePoint on new environment 3.        Deploy all solutions (WSP Files) globally to destination server- for installing features attached to the solutions 4.        Install all the custom features 5.        Deploy/Copy custom pages/files which are added to the “12Hive” folder later 6.        Restore SSP 7.        Restore My Site 8.        Restore other web application   Tasks 3 to 5 are for making sure that we have configured the environment well enough for the web application to be restored successfully. The main and complex task was restoring SSP. I have started restoring SSP through Central Admin. After a while, the restoration status was updated to “unsuccessful”. “Damn it, what went wrong?” I thought looking at the error detail down the page. I couldn’t remember the error message but I had corrected and restored it again.   Actually once you fail restoring SSP, until and unless you don’t clean all related stuff well, your restoration will be failed again and again. I wanted to find the actual reason. So cleaned, restored, cleaned, restored… I had tried almost 5-6 times and finally, I succeeded. I had realized how pleasant it is, to see the word “Successful” on the screen. Without wasting your much time to read, let me write all the detailed steps of restoring SSP:   1.        Delete the SSP through following STSADM command. stsadm -o deletessp -title <SSP name> -deletedatabases -force e.g.: stsadm -o deletessp -title SharedServices1 -deletedatabases –force 2.        Check and delete the web application associated with SSP if it exists. 3.        Remove Link from Check and remove “Alternate Access Mapping” associated with SSP if it exists. 4.        Check and delete IIS site as well as application pool associated with SSP if it exists. 5.        Stop following services: ·         Office SharePoint Server Search ·         Windows SharePoint Services Search ·         Windows SharePoint Services Help Search   6.        Delete all the databases associated/related to SSP from SQL Server. 7.        Reset IIS. 8.        Start again following services: ·         Office SharePoint Server Search ·         Windows SharePoint Services Search ·         Windows SharePoint Services Help Search   9.        Restore the new SSP.   After the SSP restoration, all other stuffs had completed very smoothly without any more issues. I did few modifications to sites for change of server name and finally, the new environment was ready.

    Read the article

  • Ransomware: Why This New Malware is So Dangerous and How to Protect Yourself

    - by Chris Hoffman
    Ransomware is a type of malware that tries to extort money from you. One of the nastiest examples, CryptoLocker, takes your files hostage and holds them for ransom, forcing you to pay hundreds of dollars to regain access. Most malware is no longer created by bored teenagers looking to cause some chaos. Much of the current malware is now produced by organized crime for profit and is becoming increasingly sophisticated. How Ransomware Works Not all ransomware is identical. The key thing that makes a piece of malware “ransomware” is that it attempts to extort a direct payment from you. Some ransomware may be disguised. It may function as “scareware,” displaying a pop-up that says something like “Your computer is infected, purchase this product to fix the infection” or “Your computer has been used to download illegal files, pay a fine to continue using your computer.” In other situations, ransomware may be more up-front. It may hook deep into your system, displaying a message saying that it will only go away when you pay money to the ransomware’s creators. This type of malware could be bypassed via malware removal tools or just by reinstalling Windows. Unfortunately, Ransomware is becoming more and more sophisticated. One of the latest examples, CryptoLocker, starts encrypting your personal files as soon as it gains access to your system, preventing access to the files without knowing the encryption key. CryptoLocker then displays a message informing you that your files have been locked with encryption and that you have just a few days to pay up. If you pay them $300, they’ll hand you the encryption key and you can recover your files. CryptoLocker helpfully walks you through choosing a payment method and, after paying, the criminals seem to actually give you a key that you can use to restore your files. You can never be sure that the criminals will keep their end of the deal, of course. It’s not a good idea to pay up when you’re extorted by criminals. On the other hand, businesses that lose their only copy of business-critical data may be tempted to take the risk — and it’s hard to blame them. Protecting Your Files From Ransomware This type of malware is another good example of why backups are essential. You should regularly back up files to an external hard drive or a remote file storage server. If all your copies of your files are on your computer, malware that infects your computer could encrypt them all and restrict access — or even delete them entirely. When backing up files, be sure to back up your personal files to a location where they can’t be written to or erased. For example, place them on a removable hard drive or upload them to a remote backup service like CrashPlan that would allow you to revert to previous versions of files. Don’t just store your backups on an internal hard drive or network share you have write access to. The ransomware could encrypt the files on your connected backup drive or on your network share if you have full write access. Frequent backups are also important. You wouldn’t want to lose a week’s worth of work because you only back up your files every week. This is part of the reason why automated back-up solutions are so convenient. If your files do become locked by ransomware and you don’t have the appropriate backups, you can try recovering them with ShadowExplorer. This tool accesses “Shadow Copies,” which Windows uses for System Restore — they will often contain some personal files. How to Avoid Ransomware Aside from using a proper backup strategy, you can avoid ransomware in the same way you avoid other forms of malware. CryptoLocker has been verified to arrive through email attachments, via the Java plug-in, and installed on computers that are part of the Zeus botnet. Use a good antivirus product that will attempt to stop ransomware in its tracks. Antivirus programs are never perfect and you could be infected even if you run one, but it’s an important layer of defense. Avoid running suspicious files. Ransomware can arrive in .exe files attached to emails, from illicit websites containing pirated software, or anywhere else that malware comes from. Be alert and exercise caution over the files you download and run. Keep your software updated. Using an old version of your web browser, operating system, or a browser plugin can allow malware in through open security holes. If you have Java installed, you should probably uninstall it. For more tips, read our list of important security practices you should be following. Ransomware — CryptoLocker in particular — is brutally efficient and smart. It just wants to get down to business and take your money. Holding your files hostage is an effective way to prevent removal by antivirus programs after it’s taken root, but CryptoLocker is much less scary if you have good backups. This sort of malware demonstrates the importance of backups as well as proper security practices. Unfortunately, CryptoLocker is probably a sign of things to come — it’s the kind of malware we’ll likely be seeing more of in the future.     

    Read the article

  • Migrating Virtual Iron guest to Oracle VM 3.x

    - by scoter
    As stated on the official site, Oracle in 2009, acquired a provider of server virtualization management software named Virtual Iron; you can find all the acquisition details at this link. Into the FAQ on the official site you can also view that, for the future, Oracle plans to fully integrate Virtual Iron technology into Oracle VM products, and any enhancements will be delivered as a part of the combined solution; this is what is going on with Oracle VM 3.x. So, customers started asking us to migrate Virtual Iron guests to Oracle VM. IMPORTANT: This procedure needs a dedicated OVM-Server with no-guests running on top; be careful while execute this procedure on production environments. In these little steps you will find how-to migrate, as fast as possible, your guests between VI ( Virtual Iron ) and Oracle VM; keep in mind that OracleVM has a built-in P2V utility ( Official Documentation )  that you can use to migrate guests between VI and Oracle VM. Concepts: VI repositories.  On VI we have the same "repository" concept as in Oracle VM; the difference between these two products is that VI use a raw-lun as repository ( instead of using ocfs2 and its capabilities, like ref-links ). The VI "raw-lun" repository, with a pure operating-system perspective, may be presented as in this picture: Infact on this "raw-lun" VI create an LVM2 volume-group. The VI "raw-lun" repository, with an hypervisor perspective, may be presented as in this picture: So, the relationships are: LVM2-Volume-Group <-> VI Repository LVM2-Logical-Volume <-> VI guest virtual-disk The first step is to present the VI repository ( raw-lun ) to your dedicated OVM-Server. Prepare dedicated OVM-Server On the OVM-Server ( OVS ) you need to discover new lun and, after that, discover volume-group and logical-volumes containted in VI repository; due to default OVS configuration you need to edit lvm2 configuration file: /etc/lvm/lvm.conf     # By default for OVS we restrict every block device:     # filter = [ "r/.*/" ] and comment the line starting with "filter" as above. Now you have to discover the raw-lun presented and, next, activate volume-group and logical-volumes: #!/bin/bash for HOST in `ls /sys/class/scsi_host`;do echo '- - -' > /sys/class/scsi_host/$HOST/scan; done CPATH=`pwd` cd /dev for DEVICE in `ls sd[a-z] sd?[a-z]`;do echo '1' > /sys/block/$DEVICE/device/rescan; done cd $CPATH cd /dev/mapper for PARTITION in `ls *[a-z] *?[a-z]`;do partprobe /dev/mapper/$PARTITION; done cd $CPATH vgchange -a yAfter that you will see a new device:[root@ovs01 ~]# cd /dev/6000F4B00000000000210135bef64994[root@ovs01 6000F4B00000000000210135bef64994]# ls -l 6000F4B0000000000061013* lrwxrwxrwx 1 root root 77 Oct 29 10:50 6000F4B00000000000610135c3a0b8cb -> /dev/mapper/6000F4B00000000000210135bef64994-6000F4B00000000000610135c3a0b8cb By your OVM-Manager create a guest server with the same definition as on VI:same core number as VI source guestsame memory as VI source guestsame number of disks as VI source guest ( you can create OVS virtual disk with a small size of 1GB because the "clone" will, eventually, extend the size of your new virtual disks )Summarizing:source-virtual-disk path ( VI ):/dev/mapper/6000F4B00000000000210135bef64994-6000F4B00000000000610135c3a0b8cbdest-virtual-disk path ( OVS ):/OVS/Repositories/0004fb00000300006cfeb81c12f12f00/VirtualDisks/0004fb000012000055e0fc4c5c8a35ee.img ** ** = to identify your virtual disk you have verify its name under the "vm.cfg" file of your new guest.Clone VI virtual-disk to OVS virtual-diskdd if=/dev/mapper/6000F4B00000000000210135bef64994-6000F4B00000000000610135c3a0b8cb of=/OVS/Repositories/0004fb00000300006cfeb81c12f12f00/VirtualDisks/0004fb000012000055e0fc4c5c8a35ee.img Clean unsupported parameters and changes on OVS.1. Restore original /etc/lvm/lvm.conf    # By default for OVS we restrict every block device:     filter = [ "r/.*/" ]    and uncomment the line starting with "filter" as above.2. Force-stop lvm2-monitor service  # service lvm2-monitor force-stop 3. Restore original /etc/lvm directories ( archive, backup and cache )  # cd /etc/lvm  # rm -fr archive backup cache; mkdir archive backup cache4. Reboot OVSRefresh OVS repository and start your guest.By OracleVM Manager refresh your repository:By OracleVM Manager start your "migrated" guest: Comments and corrections are welcome.  Simon COTER 

    Read the article

  • Oracle Data Integration 12c: Simplified, Future-Ready, High-Performance Solutions

    - by Thanos Terentes Printzios
    In today’s data-driven business environment, organizations need to cost-effectively manage the ever-growing streams of information originating both inside and outside the firewall and address emerging deployment styles like cloud, big data analytics, and real-time replication. Oracle Data Integration delivers pervasive and continuous access to timely and trusted data across heterogeneous systems. Oracle is enhancing its data integration offering announcing the general availability of 12c release for the key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c, delivering Simplified and High-Performance Solutions for Cloud, Big Data Analytics, and Real-Time Replication. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions : Supporting Current and Emerging Initiatives Extreme Performance : Even higher performance than ever before Fast Time-to-Value : Higher IT Productivity and Simplified Solutions  With the new capabilities in Oracle Data Integrator 12c, customers can benefit from: Superior developer productivity, ease of use, and rapid time-to-market with the new flow-based mapping model, reusable mappings, and step-by-step debugger. Increased performance when executing data integration processes due to improved parallelism. Improved productivity and monitoring via tighter integration with Oracle GoldenGate 12c and Oracle Enterprise Manager 12c. Improved interoperability with Oracle Warehouse Builder which enables faster and easier migration to Oracle Data Integrator’s strategic data integration offering. Faster implementation of business analytics through Oracle Data Integrator pre-integrated with Oracle BI Applications’ latest release. Oracle Data Integrator also integrates simply and easily with Oracle Business Analytics tools, including OBI-EE and Oracle Hyperion. Support for loading and transforming big and fast data, enabled by integration with big data technologies: Hadoop, Hive, HDFS, and Oracle Big Data Appliance. Only Oracle GoldenGate provides the best-of-breed real-time replication of data in heterogeneous data environments. With the new capabilities in Oracle GoldenGate 12c, customers can benefit from: Simplified setup and management of Oracle GoldenGate 12c when using multiple database delivery processes via a new Coordinated Delivery feature for non-Oracle databases. Expanded heterogeneity through added support for the latest versions of major databases such as Sybase ASE v 15.7, MySQL NDB Clusters 7.2, and MySQL 5.6., as well as integration with Oracle Coherence. Enhanced high availability and data protection via integration with Oracle Data Guard and Fast-Start Failover integration. Enhanced security for credentials and encryption keys using Oracle Wallet. Real-time replication for databases hosted on public cloud environments supported by third-party clouds. Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c and other Oracle technologies, such as Oracle Database 12c and Oracle Applications, provides a number of benefits for organizations: Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c enables developers to leverage Oracle GoldenGate’s low overhead, real-time change data capture completely within the Oracle Data Integrator Studio without additional training. Integration with Oracle Database 12c provides a strong foundation for seamless private cloud deployments. Delivers real-time data for reporting, zero downtime migration, and improved performance and availability for Oracle Applications, such as Oracle E-Business Suite and ATG Web Commerce . Oracle’s data integration offering is optimized for Oracle Engineered Systems and is an integral part of Oracle’s fast data, real-time analytics strategy on Oracle Exadata Database Machine and Oracle Exalytics In-Memory Machine. Oracle Data Integrator 12c and Oracle GoldenGate 12c differentiate the new offering on data integration with these many new features. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. Find out much more about the new release in the video webcast "Introducing 12c for Oracle Data Integration", where customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Resource Kits Meet Oracle Data Integration 12c  Discover what's new with Oracle Goldengate 12c  Oracle EMEA DIS (Data Integration Solutions) Partner Community is available for all your questions, while additional partner focused webcasts will be made available through our blog here, so stay connected. For any questions please contact us at partner.imc-AT-beehiveonline.oracle-DOT-com Stay Connected Oracle Newsletters

    Read the article

  • Welcome Oracle Data Integration 12c: Simplified, Future-Ready Solutions with Extreme Performance

    - by Irem Radzik
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 The big day for the Oracle Data Integration team has finally arrived! It is my honor to introduce you to Oracle Data Integration 12c. Today we announced the general availability of 12c release for Oracle’s key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions Extreme Performance Fast Time-to-Value       There are many new features that support these key differentiators for Oracle Data Integrator 12c and for Oracle GoldenGate 12c. In this first 12c blog post, I will highlight only a few:·Future-Ready Solutions to Support Current and Emerging Initiatives: Oracle Data Integration offer robust and reliable solutions for key technology trends including cloud computing, big data analytics, real-time business intelligence and continuous data availability. Via the tight integration with Oracle’s database, middleware, and application offerings Oracle Data Integration will continue to support the new features and capabilities right away as these products evolve and provide advance features. E    Extreme Performance: Both GoldenGate and Data Integrator are known for their high performance. The new release widens the gap even further against competition. Oracle GoldenGate 12c’s Integrated Delivery feature enables higher throughput via a special application programming interface into Oracle Database. As mentioned in the press release, customers already report up to 5X higher performance compared to earlier versions of GoldenGate. Oracle Data Integrator 12c introduces parallelism that significantly increases its performance as well. Fast Time-to-Value via Higher IT Productivity and Simplified Solutions:  Oracle Data Integrator 12c’s new flow-based declarative UI brings superior developer productivity, ease of use, and ultimately fast time to market for end users.  It also gives the ability to seamlessly reuse mapping logic speeds development.Oracle GoldenGate 12c ‘s Integrated Delivery feature automatically optimally tunes the process, saving time while improving performance. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. On November 12th we will reveal much more about the new release in our video webcast "Introducing 12c for Oracle Data Integration". Our customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Please join us at this free event to learn more from our executives about the 12c release, hear our customers’ perspectives on the new features, and ask your questions to our experts in the live Q&A. Also, please continue to follow our blogs, tweets, and Facebook updates as we unveil more about the new features of the latest release. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • Three Key Tenets of Optimal Social Collaboration

    - by kellsey.ruppel
    Today's blog post comes to us from John Bruswick! This post is an abridged version of John’s white paper in which he discusses three principals to optimize social collaboration within an enterprise.   By [email protected], Oracle Principal Sales Consultant Effective social collaboration is actionable, deeply contextual and inherently derives its value from business entities outside of itself. How does an organization begin the journey from traditional, siloed collaboration to natural, business entity based social collaboration? Successful enablement of enterprise social collaboration requires that organizations embrace the following tenets and understand that traditional collaborative functionality has inherent limits - it is innovation and integration in accordance with the following tenets that will provide net-new efficiency benefits. Key Tenets of Optimal Social Collaboration Leverage a Ubiquitous Social Fabric - Collaborative activities should be supported through a ubiquitous social fabric, providing a personalized experience, broadcasting key business events and connecting people and business processes.  This supports education of participants working in and around a specific business entity that will benefit from an implicit capture of tacit knowledge and provide continuity between participants.  In the absence of this ubiquitous platform activities can still occur but are essentially siloed causing frequent duplication of effort across similar tasks, with critical tacit knowledge eluding capture. Supply Continuous Context to Support Decision Making and Problem Solving - People generally engage in collaborative behavior to obtain a decision or the resolution for a specific issue.  The time to achieve resolution is referred to as "Solve Time".  Users have traditionally been forced to switch or "alt-tab" between business systems and synthesize their own context across disparate systems and processes.  The constant loss of context forces end users to exert a large amount of effort that could be spent on higher value problem solving. Extend the Collaborative Lifecycle into Back Office - Beyond the solve time from decision making efforts, additional time is expended formalizing the resolution that was generated from collaboration in a system of record.  Extending collaboration to result in the capture of an explicit decision maximizes efficiencies, creating a closed circuit for a particular thread.  This type of structured action may exist today within your organization's customer support system around opening, solving and closing support issues, but generally does not extend to Sales focused collaborative activities. Excelling in the Unstructured Future We will always have to deal with unstructured collaborative processes within our organizations.  Regardless of the participants and nature of the collaborate process, two things are certain – the origination and end points are generally known and relate to a business entity, perhaps a customer, opportunity, order, shipping location, product or otherwise. Imagine the benefits if an organization's key business systems supported a social fabric, provided continuous context and extended the lifecycle around the collaborative decision making to include output into back office systems of record.   The technical hurdle to embracing optimal social collaboration would fall away, leaving the company with an opportunity to focus on and refine how processes were approached.  Time and resources previously required could then be reallocated to focusing on innovation to support competitive differentiation unique to your business. How can you achieve optimal social collaboration? Oracle Social Network enables business users to collaborate with each other using a broad range of collaboration styles and integrates data from a variety of sources and business applications -- allowing you to achieve optimal social collaboration. Looking to learn more? Read John's white paper, where he discusses in further detail the three principals to optimize social collaboration within an enterprise. 

    Read the article

  • First Day of Data Integration Track at Oracle OpenWorld 2012

    - by Irem Radzik
    OpenWorld started full speed for us today with a great set of sessions in the Data Integration track. After the exciting keynote session on Oracle Database 12c in the morning; Brad Adelberg, VP of Development for Data Integration products, presented Oracle’s data integration product strategy. His session highlighted the new requirements for data integration to achieve pervasive and continuous access to trusted data. The new requirements and product focus areas presented in this session are: Provide access to any data at any source On premise or on cloud Enable zero downtime operations and maximum performance Leverage real-time data for accurate business insights And ensure high quality data is used across the enterprise During the session Brad walked over how Oracle’s data integration products, Oracle Data Integrator, Oracle GoldenGate, Oracle Enterprise Data Quality, and Oracle Data Service Integrator, deliver on these requirements and how recent product releases build on this strategy. Soon after Brad’s session we heard from a panel of Oracle GoldenGate customers, St. Jude Medical, Equifax, and Bank of America, how they achieved zero downtime operations using Oracle GoldenGate. The panel presented different use cases of GoldenGate, from Active-Active replication to offloading reporting. Especially St. Jude Medical’s implementation, which involves the alert management system for patients that use their pacemakers, reminded me in some cases downtime of mission-critical systems can be a matter of life or death. It is very comforting to hear that GoldenGate delivers highly-reliable continuous availability for life-saving medical systems. In the afternoon, Nick Wagner from the Product Management team and I followed the customer panel with the review of Oracle GoldenGate 11gR2’s New Features.  Many questions we received from audience were about GoldenGate’s new Integrated Capture for Oracle Database and the enhanced Conflict Management features, as well as how GoldenGate compares to Oracle Streams. In addition to giving details on GoldenGate’s unique capability to capture changed data with a direct integration to the Oracle DBMS engine, we reminded the audience that enhancements to Oracle GoldenGate will continue, while Streams will be primarily maintained. Last but not least, Tim Garrod and Ryan Fonnett from Raymond James presented a unified real-time data integration solution using Oracle Data Integrator and GoldenGate for their operational data store (ODS). The ODS supports application services across the enterprise and providing timely data is a critical requirement. In this solution, Oracle GoldenGate does the log-based change data capture for Oracle Data Integrator’s near real-time data integration between heterogeneous systems. As Raymond James’ ODS supports mission-critical services for their advisors, the project team had to set up this integration environment to be highly available. During the session, Ryan and Tim explained how they use ODI to enable automated process execution and “always-on” integration processes. Their presentation included 2 demonstrations that focused on CDC patterns deployed with ODI and the automated multi-instance execution and monitoring. We are very grateful to Tim and Ryan for their very-well prepared presentation at OpenWorld this year. Day 2 (Tuesday) will be also a busy day in our track. In addition to the Fusion Middleware Innovation Awards ceremony at 11:45am at Moscone West 3001, we have the following DI sessions Real-World Operational Reporting Customer Panel 11:45am Moscone West- 3005 Oracle Data Integrator Product Update and Future Strategy 1:15pm Moscone West- 3005 High-volume OLTP with Oracle GoldenGate: Best Practices from Comcast 1:15pm Moscone West- 3005 Everything You need to Know about Monitoring Oracle GoldenGate 5pm Moscone West-3005 If you are at OpenWorld please join us in these sessions. For a full review of data integration track at OpenWorld please see our Focus-On document.

    Read the article

  • JDeveloper 11g R1 (11.1.1.4.0) - New Features on ADF Desktop Integration Explained

    - by juan.ruiz
    One of the areas that introduced many new features on the latest release (11.1.1.4.0)  of JDeveloper 11g R1 is ADF Desktop integration - in this article I’ll provide an overview of these new features. New ADF Desktop Integration Ribbon in Excel - After installing the ADF desktop integration add-in and depending on the mode in which you open the desktop integration workbook, the ADF Desktop integration ribbon for design time and runtime are displayed as a separate tab within Excel. In previous version the ADF Desktop integration environment used to be placed inside the add-ins tab. Above you can see both, design time ribbon as well as runtime ribbon. On the design time ribbon you can manage the workbook and worksheet properties, worksheet component properties, diagnostics, execution and publication of the workbook. The runtime version of the ribbon is totally customizable and represents what it used to be the runtime menu on the spreadsheet, in this ribbon you can include all the operations and actions that could be executed by the end user while working with the spreadsheet data. Diagnostics - A very important aspect for developers is how to debug or verify the interactions of the client with the server, for that ADF desktop integration has provided since day one a series of diagnostics tools. In this release the diagnostics tools are more visible and are really easy to configure. You can access the client console while testing the workbook, or you can simple dump all the messages to a log file – having the ability of setting the output level for both. Security - There are a number of enhancements on security but the one with more impact for developers is tha security now is optional when using ADF Desktop Integration. Until this version every time that you wanted to work with ADFdi it was a must that the application was previously secured. In this release security is optional which means that if you have previously defined security on your application, then you must secure the ADFdi servlet as explained in one of my previous (ADD LINK) posts. In the other hand, if but the time that you start working with ADFdi you have not defined security, you can test and publish your workbooks without adding security. Support for Continuous Integration - In this release we have added tooling for continuous integration building. in the ADF desktop integration space, the concept translates to adding functionality that developers can use to publish ADFdi workbooks as part of their entire application build. For that purpose, we have a publish tool that can be easily invoke from an ANT task such that all the design time workbooks are re-published into the latest version of the application building process. Key Column - At runtime, on any worksheet containing editable tables you will notice a new additional column called the key column. The purpose of this column is to make the end user aware that all rows on the table need to be selected at the time of sorting. The users cannot alter the value of this column. From the developers points of view there are no steps required in order to have the key column included into the worksheets. Installation and Creation of New Workbooks - Both use cases can be executed now directly from JDeveloper. As part of the Tools menu options the developer can install the ADF desktop integration designer. Also, creating new workbooks that previously was done through that convert tool shipped with JDeveloper is now automatic done from the New Gallery. Creating a new ADFdi workbook adds metadata information information to the Excel workbook so you can work in design time. Other Enhancements Support for Excel 2010 and the ADF components ready-only enabled don’t allow to change its value – the cell in Excel is automatically protected, this could cause confusion among customers of previous releases.

    Read the article

  • Visual Studio 2010 Best Practices

    - by Etienne Tremblay
    I’d like to thank Packt for providing me with a review version of Visual Studio 2010 Best Practices eBook. In fairness I also know the author Peter having seen him speak at DevTeach on many occasions.  I started by looking at the table of content to see what this book was about, knowing that “best practices” is a real misnomer I wanted to see what they were.  I really like the fact that he starts the book by really saying they are not really best practices but actually recommend practices.  As a Team Foundation Server user I found that chapter 2 was more for the open source crowd and I really skimmed it.  The portion on Branching was well documented, although I’m not a fan of the testing branch myself, but the rest was right on. The section on merge remote changes (bring the outside to you) paradigm is really important and was touched on. Chapter 3 has good solid practices on low level constructs like generics and exceptions. Chapter 4 dives into architectural practices like decoupling, distributed architecture and data based architecture.  DTOs and ORMs are touched on briefly as is NoSQL. Chapter 5 is about deployment and is really a great primer on all the “packaging” technologies like Visual Studio Setup and Deployment (depreciated in 2012), Click Once and WIX the major player outside of commercial solutions.  This is a nice section on how to move from VSSD to WIX this is going to be important in the coming years due to the fact that VS 2012 doesn’t support VSSD. In chapter 6 we dive into automated testing practices, including test coverage, mocking, TDD, SpecDD and Continuous Testing.  Peter covers all those concepts really nicely albeit succinctly. Being a book on recommended practices I find this is really good. I really enjoyed chapter 7 that gave me a lot of great tips to enhance my Visual Studio “experience”.  Tips on organizing projects where good.  Also even though I knew about configurations I like that he put that in there so you can move all your settings to another machine, a lot of people don’t know about that. Quick find and Resharper are also briefly covered.  He touches on macros (depreciated in 2012).  Finally he touches on Continuous Integration a very important concept in today’s ALM landscape. Chapter 8 is all about Parallelization, threads, Async, division of labor, reactive extensions.  All those concepts are touched on and again generalized approaches to those modern problems are giving.       Chapter 9 goes into distributed apps, the most used and accepted practice in the industry for .NET projects the chapter tackles concepts like Scalability, Messaging and Cloud (the flavor of the month of distributed apps, although I think this will stick ;-)).  He also looks a protocols TCP/UDP and how to debug distributed apps.  He touches on logging and health monitoring. Chapter 10 tackles recommended practices for web services starting with implementing WCF services, which goes into all sort of goodness like how to host in IIS or self-host.  How to manual test WCF services, also a section on authentication and authorization.  ASP.NET Web services are also touched on in that chapter All in all a good read, nice tips and accepted practices.  I like the conciseness of the subjects and Peter touches on a lot of things in this book and uses a lot of the current technologies flavors to explain the concepts.   Cheers, ET

    Read the article

  • Visual Studio 2012 and .NET 4.5 now Live!

    - by Tarun Arora
    Today was the formal launch event for Visual Studio 2012 and .NET 4.5, a state-of-the-art development solution for building modern applications that span connected devices and continuous services, from the client to the cloud. The event was streamed live from http://visualstudiolaunch.com, S.Somasegar corporate vice president of the Developer Division opened the key note, Jason Zander dived deeper into how to leverage Visual Studio 2012 and .NET 4.5 to build modern application. Brian Harry all the awesome features in Visual Studio 2012 to improve the application lifecycle management.   I. Summary of the announcements made today 1. Visual Studio Updates coming this fall –  VS Update will better support agile teams, enable continuous quality, elevate SharePoint development with application lifecycle management (ALM) tools, and expand Visual Studio 2012 Windows development capabilities. It will be available as a community technology preview (CTP) later this month and in final release later this calendar year. A comprehensive list of what will be on offer can be found here. 2. Visual Studio Express 2012 for Windows Desktop – Visual Studio Express 2012 for Windows Desktop brings the newest desktop development capabilities in Visual Studio 2012 to Express users, too. You would be excited to know that the express SKU will support Integration with TFS among some of the other cool features I would like to mention Unit Testing, Unit Testing, Code Analysis, dependency management with NuGet a full list and download links can be found here. 3. F# tools for Visual Studio Express 2012 for web –  This F# Tools release adds in F# 3.0 components, such as the F# 3.0 compiler, F# Interactive, IDE support, and new F# features such as type providers and query expressions to your Visual Studio 2012 express for web. More details and download links can be found here. 4. Visual Studio TFS 2012 Power Tools – The TFS 2012 Power tools brings the goodness of Best Practice Analyzer, Process Template Editor, Storyboard Shapes, Team Explorer enhancements, TFPT command line, TFS Server Backups, etc via to your TFS 2012 installation. It can be downloaded right away from here. II. Road shows There will be many more community road shows this month packaged with hours of demos and discussions. The Visual Studio UK Team has just announced that there will be four UK launch events, face to face session including a product group speaker and partner sessions: Edinburgh, 1st October Manchester, 3rd October London, 4th October Reading, 5th October III. Get Started Download Visual Studio 2012 and the additional supporting software's from here. The Visual Studio development team has put together over 60 videos to help you learn about the new Visual Studio 2012 capabilities in more detail, and all of these will be available for watching here. IV. What’s Next A lot more exciting stuff lined up… Windows 8 Anticipated release: Oct. 26 (UPDATED 9/12) Windows Server 2012 Released (UPDATED 9/4) System Center 2012 Released (UPDATED 9/11) SQL Server 2012 Released (UPDATED 4/2) Internet Explorer 10 Anticipated release: Between Q3 2012 and early 2013 (UPDATED 5/3   Office 2013 Anticipated release: Q4 2012 or Q1 2013(UPDATED 9/12) Exchange 2013 Anticipated release: Q4 2012 (UPDATED 7/26) Visual Studio 2012 Released (UPDATED 9/12) Kinect for Windows Released (UPDATED 9/4) Windows Phone "Tango" and 8 "Tango": Released; Anticipated "Windows Phone 8" release: Q4 2012 (UPDATED 9/5) Dynamics ERP Online Anticipated release: September or October 2012 (UPDATED 7/20) Office 365 Anticipated update schedule: "Almost weekly"(UPDATED 9/12) Windows Azure Rumored CTP release: Spring 2012 (UPDATED 9/7) SharePoint 2013 Anticipated release: Q4 2012 (UPDATED 8/21) Enjoy

    Read the article

  • Mastering snow and Java development at jDays in Gothenburg

    - by JavaCecilia
    Last weekend, I took the train from Stockholm to Gothenburg to attend and present at the new Java developer conference jDays. It was professionally arranged in the Swedish exhibition hall close to the amusement park Liseberg and we got a great deal out of the top-level presenters and hallway discussions. Understanding and Improving Your Java Process Our main purpose was to spread information on JVM and our monitoring tools for Java processes, so I held a crash course in the most important terms and concepts if you want to affect the performance of your Java process. From the beginning - the JVM specification to interpretation of heap usage graphs. For correct analysis, you also need to understand something about process memory - you need space for the Java heap (-Xms for initial size and -Xmx for max heap size), but the process memory also contain the thread stacks (to a size of -Xss), JVM internal data structures used for keeping track of Java objects on the heap, method compilation/optimization, native libraries, etc. If you get long pause times, make sure to monitor your application, see the allocation rate and frequency of pause times.My colleague Klara Ward then held a presentation on the Java Mission Control product, the profiling and diagnostics tools suite for HotSpot, coming soon. The room was packed and very appreciated, Klara demonstrated four different scenarios, e.g. how to diagnose and fix latencies due to lock contention for logging.My German colleague, OpenJDK ambassador Dalibor Topic travelled to Sweden to do the second keynote on "Make the Future Java". He let us in on the coming features and roadmaps of Java, now delivering major versions on a two-year schedule (Java 7 2011, Java 8 2013, etc). Also letting us in on where to download early versions of 8, to report problems early on. Software Development in teams Being a scout leader, I'm drilled in different team building and workshop techniques, creating strong groups - of course, I had to attend Henrik Berglund's session on building successful teams. He spoke about the importance of clear goals, autonomy and agreed processes. Thomas Sundberg ended the conference by doing live remote pair programming with Alex in Rumania and a concrete tips for people wanting to try it out (for local collaboration, remember to wash and change clothes). Memory Master Keynote The conference keynote was delivered by the Swedish memory master Mattias Ribbing, showing off by remembering the order of a deck of cards he'd seen once. He made it interactive by forcing the audience to learn a memory mastering technique of remembering ten ordered things by heart, asking us to shout out the order backwards and we made it! I desperately need this - bought the book, will get back on the subject. Continuous Delivery The most impressive presenter was Axel Fontaine on Continuous Delivery. Very well prepared slides with key images of his message and moved about the stage like a rock star. The topic is of course highly interesting, how to create an infrastructure enabling immediate feedback to developers and ability to release your product several times per day. Tomek Kaczanowski delivered a funny and useful presentation on good and bad tests, providing comic relief with poorly written tests and the useful rules of thumb how to rewrite them. To conclude, we had a great time and hope to see you at jDays next year :)

    Read the article

  • CodePlex Daily Summary for Saturday, March 13, 2010

    CodePlex Daily Summary for Saturday, March 13, 2010New Projects[Experiment] vczh DBUI: EXPERIMENT. Auto UI adaptor for a specified data base[SAMPLE PROJECT] Branch and Patch with GIT: I'll paste more here later...BlogPress: This web application provides a content management system. Coot: Facebook Photos Screensaver.DotNetNuke® JDMenu: dnnJDMenu makes it easy to use the open source JDMenu component in your DotNetNuke skin.DotNetNuke® RadRotator: dnnRadRotator makes it easy to add telerik RadRotator functionality to your site or custom module. Licensing permits anyone to use the components ...DotNetNuke® RadTabStrip: DNNRadTabStrip makes it easy to add telerik RadTabStrip functionality to your module or skin. Licensing permits anyone to use the components (incl...DotNetNuke® RadTreeView: DNNRadTreeView makes it easy to add telerik RadTreeView functionality to your module or skin. Licensing permits anyone to use the components (incl...DotNetNuke® Skin Garden: A DotNetNuke Design Challenge skin package submitted to the "Out of the box" category by Mark Allan of DnnGarden. Concise and semantic HTML 5 stru...ElmasFC: Elmas Facebook CheckerFront Callback Protocol: Front Callback Protocol make it easier for developers to create a network application in the .Net Language. It provide the flexibility of using TCP...Glass UI: A Windows Forms Control Library built specifically for Aero Glass. This will consist of existing controls, modified to render on glass, as well as ...Guitarist Tools: Some tools for guitarists.HomeUX: HomeUX is home control software featuring a Silverlight-based touch screen user interface.Homework Helper: Homework Helper help students to train simpler homework like "What's the name of the capital of France?" - Question - Answear based. It's made i...IGNOU Mini Project Allocation: A mini project allocation system.Images Compiler: Images Compiler is pretty small wpf application for users who want to resize, rename, disable colors... for too much images in very short time. It...InstitutionManagementSystem: Institution Management System prototypeManagedCv: ManagedCv is the library for C#/VB/ to use the OpenCV librarymanagement joint ownership: Application pour la gestion des actions réalisées au sein d’une copropriété. Application for management actions within a joint ownershipMapWindow6: MapWindow 6.0 is an open source geographic information system (GIS) and library of geospatial software development tools for .NET, written in C#. T...Morris Auto: Morris Auto is a social application build templateMouse control with finger detection: The aim of this project is to design an application for recognition of the movement of a finger through a webcam and then control the mouse. The pr...ORAYLIS BI.Quality: ORAYLIS BI.Quality makes it easier to develop BI Solutions in an agile environment. It adapts Unit Tests to BI Development. Propositional Framework: Different sales propositions are presented to the user using data collected from marketing intelligence, browser history or user behaviour as they ...ServStop: ServStop is a .NET application that makes it easy to stop several system services at once. Now you don't have to change startup types or stop them ...shatkotha web portal: source code of web portal shatkothaSurvey and Registration tools: Two Silverlight tools for add Survey and Registration in your websiteTable Storage Backup & Restore for Windows Azure: Allows various backup & restore options for Windows Azure Table Storage accounts: - Backup from one storage account to another - Backup a storag...Topsy Lib: This project provides wrapper methods to call Topsy's web services from C#.twNowplaying: twNowplaying is a small and handy utility that allows you to tweet your currently playing track from Spotify to Twitter. Followed by the #twNowplay...XOM: XOM: Xml Object Mapper Automatically populate your objects with data from XML via an XML map. Never do this again: if(e.GetElementsByTagName("us...YS Utils: The library contains set of useful classes which may solve common tasks for different applications.ZabViewer: CS ProjectNew ReleasesAppFabric Caching Admin Tool: AppFabric Caching Admin Tool (0.8): System Requirements:.NET 4.0 RC AppFabric Caching Beta2 Test On:Win 7 (64x)ASP.Net Routing Configuration: mal.Web.Routing v0.9.2.0: mal.Web.Routing v0.9.2.0DotNetNuke IM Module of Facebook Like Messenger: DNN IM Module of Facebook Like Messenger: Empower DNN Website with a 1-to-1 Chat Solution named Free Facebook Messenger Style Web Chat Bar of 123 Web Messenger. 1. If you need to use the c...DotNetNuke® Form and List (formerly User Defined Table): 05.01.02: Form and List 05.01.02 (Release Candidate 2)5.1.2 will be the next stabilzation release. Major Highlights fixed Cancel action in a form, it don't ...DotNetNuke® JDMenu: DNN jdMenu 1.0.0: dnnJDMenu makes it easy to use the open source JDMenu component in your DotNetNuke skin. Many thanks to Jonathan Sharp of Outwest Media for creati...DotNetNuke® RadTabStrip: DNNRadTabstrip 1.0.0: DNNRadTabStrip makes it easy to add telerik RadTabStrip functionality to your module or skin. Licensing permits anyone to use the components (inclu...DotNetNuke® RadTreeView: DNNRadTreeView 1.0.0: DNNRadTreeView makes it easy to create skins which use the Telerik RadTreeview functionality. Licensing permits anyone (including designers) to use...DotNetNuke® Skin Garden: Garden Package 1.0.0: A DotNetNuke Design Challenge skin package submitted to the "Out of the box" category by Mark Allan of DnnGarden. Concise and semantic HTML 5 struc...ElmasFC: Elmas FC: This porgram is checking your facebook account automaticly.Free DotNetNuke IM of 123 Web Messenger -- Web-based Friend List: Free Download DNN IM Module and Source Code: 123 Web Messenger offers free DotNetNuke Instant Messaging to help you embed a IM Software into DNN Website by integrating 123 Web Messenger with D...Free Silverlight & WPF Chart Control - Visifire: Visifire SL and WPF Charts 3.0.4 Released: Hi, Today we have released the final version of Visifire v3.0.4 which contains the following major features: * Zooming * Step Line chart ...Home Access Plus+: v3.1.0.0: Version 3.1.0.0 Release Problem with this release, get Version 3.1.1.1 Change Log: Fixed ampersand issue Added Unzip Features Added Help Desk ...Home Access Plus+: v3.1.1.1: Version 3.1.1.1 Release Change Log: Fixed the Help Desk File Changes: ~/App_Data/Tickets.xml ~/bin/CHS Extranet.dll ~/bin/CHS Extranet.pdbHomework Helper: Homework Helper 1.0: The first release of Homework Helper. It got basic functionality. Check the Documentation or press F1 while using the program.Homework Helper: Homework Helper v1.0: This is the latest version of Homework Helper. Just a few updates since the latest one (a couple of minutes ago). Now it saves your settings! Instr...IBCSharp: IBCSharp 1.02: What IBCSharp 1.02.zip unzips to: http://i39.tinypic.com/28hz8m1.png Note: The above solution has MSTest, Typemock Isolator, and Microsoft CHESS c...InfoService: InfoService v1.5 RC 1: InfoService Release Canidate Please note this is a RC. It should be stable, but i can't guarantee that! So use it on your own risk. Please read Pl...IntX: IntX 0.9.3.3: Fixed issue #7100IronRuby: 1.0 RC3: The IronRuby team is pleased to announce version 1.0 RC3! As IronRuby approaches the final 1.0, these RCs will contain crucial bug fixes and enhanc...MAISGestão: LayerDiagram (pdf): This is the final version of the layer diagramMapWindow6: MapWindow 6.0 msi (March 12): After some significant trouble with svn, this site represents a test of using Mercurial for our version control. Hopefully the choice of this new ...MSBuild Mercurial Tasks: 0.2.0 Beta: This release realises the Scenario 2 and provides two MSBuild tasks: HgCommit and HgPush. This task allows to create a new changeset in the current...NLog - Advanced .NET Logging: NLog 2.0 preview 1: This is very experimental first build of NLog from 2.0 branch is available for download. It’s not alpha, beta or even gamma, just a preview of upco...Open NFe: Fonte DANFE v1.9.5: Código-fonte para a versão 1.9.5 do DANFEOpiConsole (XNA): OpiConsole 0.3: OpiConsole 0.3 OpiConsole includes: * PC & Xbox support. * Default commands (cvar, quit etc.) * Ability to add custom commands. *...ORAYLIS BI.Quality: Release 1.0.0: Release 1.0.0Pcap.Net: Pcap.Net 0.5.0 (38141): Pcap.Net - March 2010 Release Pcap.Net is a .NET wrapper for WinPcap written in C++/CLI and C#. It Features almost all WinPcap features and include...PhysX.Net: PhysX.Net 0.12.0.0 Beta 1: This is beta release of 0.12.0.0 for people to test and provide feedback on. It targets 2.8.3.21 of PhysXPólya: Pólya 2010 03 13 alpha: Pólya is a collection of generic data structures; as generic as C#/.Net allows them to be. In this first release the focus has been on some fundam...Prolog.NET: Prolog.NET 1.0 Beta 1.3: Installer includes: primary Prolog.NET assembly Prolog.NET Workbench Prolog.NET Scheduler sample application PrologTest console applicatio...Propositional Framework: USP: The initial code drop was based on the Autocomplete demo and the neural network approach used by Jeff Heaton (@ http://www.heatonresearch.com/) - e...Protocol Transition with BizTalk: Source: Stable buildRoTwee: RoTwee (7.1.0.0): Now picture of your friend is shown in RoTwee. Place mouse cursor to the tweet !ServStop: 0.5.0.0: Initial Release Contents of ServStop0500.zip ServStop.exe 0.5.0.0 Initial Release. 32,768 bytes. Other files None. Source code available on "...SkeinLibManaged: Release 1.0.0.0 (Beta): This is the compiled DLL with XML documentation, so there should be plenty of context sensitive help and Intellisense. This is the Release version...sPWadmin: pwAdmin v0.9a: Added: LiveChat Plugin Shows the latest 150 chat messages from "/Your PW Server/logservice/logs/world2.chat" Refresh chat every 5 seconds Allow...sPWadmin: pwAdmin v0.9b: Some minor fixes to style, layout & different browser support Merged the forms in server configuration tab to a single form that can now save mul...Topsy Lib: Initial release: Initial Debug and Release versions.twNowplaying: twNowplaying: Press the Twitter icon to get started, don't forget to submit bugs to the issue tracker. What's new This release has some minor UI fixes.twNowplaying: twNowplaying Alpha 1.0: Press the Twitter icon to get started, don't forget to submit bugs to the issue tracker. Thank you , and enjoy! =)VCC: Latest build, v2.1.30312.0: Automatic drop of latest buildWPF Dialogs: Version 0.1.3: The FolderBrowseDialog / FolderBrowseDialog - Deutsch was improved and extended.XOM: XOM 0.1A: Just a release of the code I have so far. In order to get your objects to work, you need to create an XML file to define your objects. Here is a ...Xpress - ASP.NET MVC 个人博客程序: xpress2.1.1.0312.beta: 最新beta版,注意:此版本和2.1.0不兼容 更改内容: 将主题文件发放在 Views 文件夹下 主题文件支持强类型Model 主题资源文件放在Resouces目录下YS Utils: V 1.0.0.0: This is first release. The YSUtils library contains first set of classes. ZIP files contains documentation.Most Popular ProjectsMetaSharpWBFS ManagerRawrAJAX Control ToolkitMicrosoft SQL Server Product Samples: DatabaseSilverlight ToolkitWindows Presentation Foundation (WPF)ASP.NET Ajax LibraryASP.NETMicrosoft SQL Server Community & SamplesMost Active ProjectsRawrN2 CMSBlogEngine.NETFasterflect - A Fast and Simple Reflection APIpatterns & practices – Enterprise LibraryFarseer Physics EngineSharePoint Team-MailerCaliburn: An Application Framework for WPF and SilverlightCalcium: A modular application toolset leveraging PrismjQuery Library for SharePoint Web Services

    Read the article

  • CodePlex Daily Summary for Tuesday, November 29, 2011

    CodePlex Daily Summary for Tuesday, November 29, 2011Popular ReleasesMFCMAPI: November 2011 Release: Build: 15.0.0.1029 Full release notes at SGriffin's blog. If you just want to run the MFCMAPI or MrMAPI, get the executables. If you want to debug them, get the symbol files and the source. The 64 bit builds will only work on a machine with Outlook 2010 64 bit installed. All other machines should use the 32 bit builds, regardless of the operating system. Facebook BadgeWCF Community Site: WCF Web API Preview 6: Welcome to the sixth preview release of WCF Web API on Codeplex! Install WCF Web API Preview 6 using NuGet New Features/EnhancementsURL form encoding - Http request bodies sent as application/x-www-form-urlencoded can now deserialize into objects and participate in content negotiation. Custom OData entity keys - The ODataFormatter now supports custom conventions for determining which properties identify an entity key. [ServiceContract] is no longer required on the Web API class definiti...Devpad: 4.11: Whats new for Devpad 4.11: New Import Archive Improved Save Dialog Improved Replace Dialog Improved Go To Dialog Minor Bug Fix's, improvements and speed upsSubExtractor: Release 1021: Feature: Allow OcrMap.bin file to be placed in same directory as EXE Feature: Choose Subtitle dialog directory remembered while app is up Feature: Allow Save As when creating Subtitle files (initial directory is remembered) Feature: Allow resizing of all main window dialogs Fix: Issue Id #682 (Dynamically generating the expected baseline and top offsets for characters. This fixes the problem of manually entered characters not in character selector incorrectly being put on a different line or...Home Access Plus+: v7.7: v7.7.1128.2200Added: ShowTo Option on Resources Added: Basic Authentication Logon Method Added: Button on the Live Tracker page to clear logons in the database but not do a remote logoff Updated: jquery from v1.6.2 to v1.7.1 Fixed: Another attempt at fixing the SIMS import in the booking system Fixed: JSON Issues with the Setup Added: More DEBUG Events to the Event Log (note DEBUG not RELEASE) Added: Support for Week A Week B instead of Week 1 and Week 2 Updated: The My Files ...Diagnostics Tool for Microsoft Dynamics CRM 2011: CrmDiagTool2011 (5.1.27.82): NEW FEATURE: DevErrors flag is now accessible for remote server (need to be local admin to access web.config file through administrative share)CommonLibrary.NET: CommonLibrary.NET 0.9.8 - Alpha: A collection of very reusable code and components in C# 4.0 ranging from ActiveRecord, Csv, Command Line Parsing, Configuration, Holiday Calendars, Logging, Authentication, and much more. Samples in <root>\src\Lib\CommonLibrary.NET\Samples CommonLibrary.NET 0.9.8 AlphaNew Dynamic Scripting Language : workitem : 7493 Fixes 1622 6803Widget Suite for DotNetNuke: 01.04.00: The following features/enhancements are associated with this release: Bug: Removed the empty box/white space created by some widgets New Widget: FlexSlider New Widget: Google+ Button New Widget: Klout Badge Sample Widget Script FileFxCop Integrator for Visual Studio 2010: FxCop Integrator 2.0.0 RC: Replaced the MSBuild Tasks installer to fix the bug of the targets file. FxCop Integrator is not affected by this bug. (Nov 28 2011) New FeatureSupported calculating code metrics with Code Metrics PowerTool. (Work Item #6568: 6568). Provided MSBuild tasks. #7454: 7454 Supported to filter out auto-generated code from code analysis result. #7485: 7485 Supported exporting report of code analysis result. Supported multi-project analysis. Supported file level analysis. Added the featu...Terminals: Version 2 - Beta 4 Release: Beta 4 Refresh Build Dont forget to backup your config files BEFORE upgrading! As usual, please take time to use and abuse this release. We left logging in place, and this is a debug build so be sure to submit your logs on each bug reported, and please do report all bugs! Updated the About form to include the date and time of the build. Useful for CI builds to ensure we have the correct version "Favourites" and "History" save their expanded states after app restarts Code cleanup, secu...MiniTwitter: 1.76: MiniTwitter 1.76 ???? ?? ?????????? User Streams ???????????? User Streams ???????????、??????????????? REST ?????????? ?????????????????????????????? ??????????????????????????????Media Companion: MC 3.424b Weekly: Ensure .NET 4.0 Full Framework is installed. (Available from http://www.microsoft.com/download/en/details.aspx?id=17718) Ensure the NFO ID fix is applied when transitioning from versions prior to 3.416b. (Details here) Movie Show Resolutions... Resolved issue when reverting multiselection of movies to "-none-" Added movie rename support for subtitle files '.srt' & '.sub' Finalised code for '-1' fix - radiobutton to choose either filename or title Fixed issue with Movie Batch Wizard Fanart - ...Advanced Windows Phone Enginering Tool: WPE Downloads: This version of WPE gives you basic updating, restoring, and, erasing for your Windows Phone device.Microsoft Ajax Minifier: Microsoft Ajax Minifier 4.37: Fix for issue #16936 - CSS strings containing ASP.NET replacement blocks that contain the same delimiter character(s) as the CSS string cause the CSS parser to barf. Need to use the -aspnet:1 flag to treat the ASP.NET blocks as single entities. Added support for CSS3 @keyframes syntax. Added NuGet package support to the DLL project. Expand the -line switch to also optionally specify the multiline/single line mode, and the spaces-per-tab for multiline mode. Tweak the -pretty switch to be more ...Anno 2070 Assistant: Beta v1.0 (STABLE): Anno 2070 Assistant Beta v1.0 Released! Features Included: Complete Building Layouts for Ecos, Tycoons & Techs Complete Production Chains for Ecos, Tycoons & Techs Completed Credits Screen Known Issues: Not all production chains and building layouts may be on the lists because they have not yet been discovered. However, data is still 99.9% complete. Currently the Supply & Demand, including Calculator screen are disabled until version 1.1.Oil Prices: Oil Prices V1.1: Oil Prices V1.1 Fix Bangchak price listTAXILISM: TAXILISM V1.0: TAXILISMExamine: v1.4 - Beta: A fairly mega release which borrows some behaviors from the currently under development v2.0 version, this means there are some breaking changes which are listed below, though I don't think these breaking changes will affect many. FeaturesUpgraded DLLs to .Net 4.0 runtime Azure support No more file queue, all asynchronous operations are handled by .Net 4.0's async Task scheduling system, this not only increases performance but better handles async operations. Running in async mode will...Minemapper: Minemapper v0.1.7: Including updated Minecraft Biome Extractor and mcmap to support the new Minecraft 1.0.0 release (new block types, etc).Visual Leak Detector for Visual C++ 2008/2010: v2.2.1: Enhancements: * strdup and _wcsdup functions support added. * Preliminary support for VS 11 added. Bugs Fixed: * Low performance after upgrading from VLD v2.1. * Memory leaks with static linking fixed (disabled calloc support). * Runtime error R6002 fixed because of wrong memory dump format. * version.h fixed in installer. * Some PVS studio warning fixed.New Projects.NET WindowsCe MVP Framework: .NET WindowsCe MVP Framework for .NET Compact Framework 2 or higherAndaman Alumini: AluminiSite for andaman studentsAudio Macro Recorder Plugin for Notepad++: kkkkCassandra .Net Provider: Cassandra .Net Provider is a project created to help .Net developers to start to work with Apache Cassandra. Under Cassandra .Net Provider project developers will find a client fully configurable, working with polled connection, where CQL commands can be executed.Code samples for deepcode.co.uk: Code samples to support articles posted on www.deepcode.co.ukContador de Caracteres: Contador de caracteres para Windows Phone 7Data Ductus Utilities: Simple utilities that other may find useful like mongo DataContract mapping etc.dIRC: dIRC is a cutting-edge .Net IRC client library written in C#.Distributed Blackboard: Distributed virtual drawing canvasFileSplit: FileSplit lets you split large files into smaller files for easier sharing and backup. After splitting the files, FileSplit also creates a .bat (batch) file that when clicked, automatically joins the split files into the original file. This is especially useful for those recipients who are not computer saavy.FlagSync: FlagSync is a synchronization and backup tool, which allows you to synchronize or backup your files with local folders (or an extern harddrive or flashdrive) and FTP-Servers, as well as synchronize your non-iPod MP3-Player with iTunes.Fodda: A small utility for downloading pictures and movies from Canon cameras to your computer. The transferred pictures and movies are placed in a directory structure based on the date of creation. E.g. My Pictures\2011\11\27_11_2011. It will probably work equally well with Cameras from other manufacturers.Google Authenticator TOTP C#: An implementation of Google's Authenticator in C# and WPF. It's a Time-based One-time Password (TOTP) described in RFC 6238. You could use it to implement two-factor authentication in your own .Net application.gppfree: gpp freeiOSApps: A collection of iOS appsLineSeriesDemo: LineSeriesDemolospacos23: klk NHash: This is a simple project that integrates with Explorer and Computes MD5 and SHA1.OpenGL Engine: Projekt pisany na projekt zespolowy.PolarConverter: Adjust the measured distance of HRM files created by Polar Heart Rate monitorsRASSUS - Sustav za dijeljenje fotografija: Sustav za dijeljenje fotografija - projekt studenata na fakultetu elektrotehnike i racunarstva.Space Monopoly: Space monopoly is the freeware game of buying and selling shares.StarCraft 2 ladder tiles for Windows Phone 7: StarCraft 2 ladder tiles for Windows Phone 7Validador de CPF/CNPJ: Validador Lógico de CPF ou CNPJ para Windows Phonever2web: Ver2web is an online Club management software developed for the course Webprogramming at Technikum Wien. It is programmed in C# using ASP.net MVC 3, Entity Framework 4.x and Unity 2.2. WPF Wizard Control: WPF user control (not a custom control) for generically hosting multiple-step wizards. Uses MVVM, you create the model and view for each step and optionally configure steps that guide the wizard along a different workflow.yankee-private-project: ??????????,????!

    Read the article

  • Adjust timezone of an AVM Fritz!Box 7390

    It's been a while that I purchased an AVM Fritz!Box 7390 but since I'm using this 'PABX' here in Mauritius, I'm not really happy about the wrong time in the logs or handsets connected. Lately, I had some spare time to address this issue, and the following article describes how to adjust the timezone settings in general. The original idea came from an FAQ found in c't 21/11 (for a 7270 written in German language) but I added a couple of things based on other resources online. The following tutorial may be valid for other models, too. Use your common sense and think before you act. Brief introduction to AVM Fritz!Box devices The Fritz!Box series of AVM has been around for more than a decade and those little 'red boxes' have a high level of versatility for your small office or home. High-speed connections, secure WLAN and convenient telephony make a home network out of any network. Whether it's a computer, tablet or smartphone, any device can be connected to the FRITZ!Box. And best of all, installation is so simple that users will be online in a matter of minutes. If you want to have peace of your mind in your small network then a Fritz!Box is the easiest way to achieve that. I'm using my box primarly as WiFi access point, VoIP gateway and media server but only because it came in second after my Linux system. Limitations in the administrative Web UI Unfortunately, there are no possibilities to adjust the timezone settings in the Web UI at all - even not in Expert mode. I assume that this is part of the 'simplification' provided by AVM's design team. That's okay, as long as you reside in Central Europe, and the implicit time handling is correct for your location. Adjusting the timezone I got my device through an order at Amazon Germany already some time ago, and honestly I wasn't bothered too much about the pre-configured (fixed) timezone setting - CET or CEST depending on daylight saving. But you know, it's that kind of splinter at the back of your head that keeps nagging and bothering you indirectly. So, finally I sat down yesterday evening and did a quick research on how to change the timezone. Even though there are a number of results, I read the FAQ from the c't magazine first, as I consider this as a trusted and safe source of information. Of course, it is most important to avoid to 'brick' your device. You've been warned - No support Tinkering with the configuration of any AVM devices seems to be a violation of their official support channels. So, be warned and continue onlyin case that you're sure about what you are going to do. The following solutions are 'as-is' and they worked for my box flawlessly but may cause an issue in your case. Don't blame me... Solution 1 - Backup, modify and restore That's the way as described in the c't article and a couple of other forum postings I found online, mainly from Australia. Login the administrative Web UI and navigate to 'System => Einstellungen sichern' (System => Backup configuration) and store your current configuration to a local file on your machine. Despite some online postings it is not necessary to specify a password in order to secure or encrypt your backup. IMHO, this only adds another unnecessary layer of complexity to the process. Anyway, next you should create a another copy of your settings and keep it unmodified. That's our safety net to restore the current settings in case that we might have to issue a factory setting reset to the box. Now, open the configuration file with an advanced text editor which is capable to deal with Unix carriage returns properly - Windows Notepad doesn't do the job but Wordpad or Notepad++. Personally, I don't care and simply use geany, gedit or nano on Linux. In total there are 3 modifications that we have to apply to the configuration file - one new line and two adjustments. First, we have to add an instruction near the top of file that overrides the device internal checksum validation. Without this line, your settings won't be accepted. Caution: The drectives are case-sensitve and your outcome should read something like this: **** FRITZ!Box Fon WLAN 7390 CONFIGURATION EXPORTPassword=$$$$<ignore>FirmwareVersion=84.05.52CONFIG_INSTALL_TYPE=iks_16MB_xilinx_4eth_2ab_isdn_nt_te_pots_wlan_usb_host_dect_64415OEM=avmCountry=049Language=deNoChecks=yes**** CFGFILE:ar7.cfg/* * /var/flash/ar7.cfg * Mon Jul 29 10:49:18 2013 */ar7cfg {... Then search for the expression 'timezone' and you should find a section like this one (~ line 1113): timezone_manual {        enabled = no;        offset = 0;        dst_enabled = no;        TZ_string = "";        name = "";} We would like to manually handle the timezone setting in our device and therefore we have to enable it and set the proper value for Mauritius. The configuration block should like so afterwards: timezone_manual {        enabled = yes;        offset = 0;        dst_enabled = no;        TZ_string = "MUT-4";        name = "";} We specify the designation and the offset in hours of the timezone we would like to have. Caution: The offset indicates the value one has to add to the local time to arrive at UTC. More details are described in the Explanation of TZ strings. Mauritius has GMT+4 which means that we have to substract 4 hours from the local time to have UTC. Finally, we restore the modified configuration file via the administrative Web UI under 'System => Einstellungen sichern => Wiederherstellen' (System => Backup configuration => Restore). This triggers a reboot of the device, so please be patient and wait until the Web UI displays the login dialog again. Good luck! Solution 2 - Telnet A more elegant, read: technically interesting, way to adjust configuration settings in your Fritz!Box is to access it directly through Telnet. By default AVM disables that protocol channel and you have to enable it with a connected telephone. In order to activate the telnet service dial the following combination: #96*7* #96*8* (to disable telnet again after work has been completed) If you're using an AVM handset like the Fritz!Fon then you will receive a confirmation message on the display like so: telnetd ein Next, depending on your favourite operating system, you either launch a Command prompt in Windows or a terminal in Linux, get your Admin password ready, and you connect to your box like so: $ telnet fritz.box Trying 192.168.1.1...Connected to fritz.box.Escape character is '^]'.password: BusyBox v1.19.3 (2012-10-12 14:52:09 CEST) built-in shell (ash)Enter 'help' for a list of built-in commands.ermittle die aktuelle TTYtty is "/dev/pts/0"Console Ausgaben auf dieses Terminal umgelenkt# That's it, you are connected and we can continue to change the configuration manually. In order to adjust the timezone setting we have to open the ar7.cfg file. As we are now operating in a specialised environment, we only have limited capabilities at hand. One of those is a reduced version of vi - nvi. Let's open a second browser window with the fine manual page of nvi and start to edit our configuration file: # nvi /var/flash/ar7.cfg In our configuration file, we have to navigate to the timezone directives. The easiest way is to search for the expression 'timezone' by typing in the following: /timezone    (press Enter/Return) Now, we should see the exact lines of code like in the backed up version: timezone_manual {                                                                            enabled = no;                                                          offset = 0;                                                         dst_enabled = no;                                                   TZ_string = "";                                                     name = "";                                                        } And of course, we apply the same changes as described in the previous section: timezone_manual {                                                                            enabled = yes;                                                          offset = 0;                                                         dst_enabled = no;                                                   TZ_string = "MUT-4";                                                     name = "";                                                        } Finally, we have to write our changes back to the file and apply the new settings. :wq    (press Enter/Return) # ar7cfgchanged That's it! Finally, close the telnet session by pressing Ctrl+] and enter 'quit'. Additional ideas... There are a couple of more possibilities to enhance and to extend the usability of a Fritz!Box. There are lots of resources available on the net, but I'd like to name a few here. Especially for Linux users it is essential to be able to connect to any device remotely in a  safe and secure way. And the installation of a SSH server on the box would be a first step to improve this situation, also to avoid to run telnet after all. Sometimes, there might be problems in your VoIP connections, feel free to adjust the settings of codecs and connection handling, too. I guess, you'll get the idea... The only frontiers are in your mind.

    Read the article

  • Find the "largest" dense sub matrix in a large sparse matrix

    - by BCS
    Given a large sparse matrix (say 10k+ by 1M+) I need to find a subset, not necessarily continuous, of the rows and columns that form a dense matrix (all non-zero elements). I want this sub matrix to be as large as possible (not the largest sum, but the largest number of elements) within some aspect ratio constraints. Are there any known exact or aproxamate solutions to this problem? A quick scan on Google seems to give a lot of close-but-not-exactly results. What terms should I be looking for? edit: Just to clarify; the sub matrix need not be continuous. In fact the row and column order is completely arbitrary so adjacency is completely irrelevant. A thought based on Chad Okere's idea Order the rows from largest count to smallest count (not necessary but might help perf) Select two rows that have a "large" overlap Add all other rows that won't reduce the overlap Record that set Add whatever row reduces the overlap by the least Repeat at #3 until the result gets to small Start over at #2 with a different starting pair Continue until you decide the result is good enough

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Timer a usage in msp430 in high compiler optimization mode

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code, //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >