Search Results

Search found 3489 results on 140 pages for 'all numeric no hash'.

Page 132/140 | < Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >

• Decode the string encoded through php in javascript

  - by Pankaj Khurana

  Hi, I am working on a facebook page in which i have used ajax & response is returned in json format. I have encoded the string in php. Now i want to decode that string in javascript. foreach($feedbackdetails as $feedbackdetail) { $str.= '<div class="tweet"> <img style="cursor:pointer;" id="imgVoteUp" src="http://myserver/facebook/vote_up.gif" alt="Vote Up" title="Vote Up" onclick="saveVote('.$feedbackdetail[pk_feedbackid].',1)" /> : '.$feedbackdetail[upvotecount].' <img style="cursor:pointer;" id="imgVoteDown" src="http://myserver/facebook/vote_down.gif" alt="Vote Down" title="Vote Down" onclick="saveVote('.$feedbackdetail[pk_feedbackid].',0)" /> : '.$feedbackdetail[downvotecount].' <p class="'.$pclass.'">'.$feedbackdetail[title].' by '.$feedbackdetail[name].'<br>'.$feedbackdetail[description].'</p></div>'; } $str=urlencode($str); echo '{"fbml_test":"'.$str.'"}'; Javascript Function: function saveVote(id,type,class) { contentdiv='div_'+id; processdiv='processdiv_'+id; document.getElementById(processdiv).setInnerXHTML('<span id="caric"><center><img src="http://static.ak.fbcdn.net/rsrc.php/z5R48/hash/ejut8v2y.gif" /></center></span>'); posturl='http://myserver/facebook/vote.php'; if(class==0) { class='firstmessage'; } else { class='message'; } var queryString = "?id="+id+"&type="+type+"&pclass="+class; posturl = posturl +queryString; ajax = new Ajax(); ajax.responseType = Ajax.JSON; ajax.requireLogin = true; ajax.ondone = function(data) { document.getElementById('caric').setStyle('display','none'); //new Dialog().showMessage('Dialog',data); if(data.error) { new Dialog().showMessage('Dialog',data.error); } if(data.fbml_test) { document.getElementById(contentdiv).setInnerFBML(data)); } //div_id.setInnerFBML(data); } ajax.post(posturl); } Right now i am getting encoded string how can i change it? Please help me on this Thanks Pankaj

  Read the article

• Segmenting a double array of labels

  - by Ami

  The Problem: I have a large double array populated with various labels. Each element (cell) in the double array contains a set of labels and some elements in the double array may be empty. I need an algorithm to cluster elements in the double array into discrete segments. A segment is defined as a set of pixels that are adjacent within the double array and one label that all those pixels in the segment have in common. (Diagonal adjacency doesn't count and I'm not clustering empty cells). |-------|-------|------| | Jane | Joe | | | Jack | Jane | | |-------|-------|------| | Jane | Jane | | | | Joe | | |-------|-------|------| | | Jack | Jane | | | Joe | | |-------|-------|------| In the above arrangement of labels distributed over nine elements, the largest cluster is the “Jane” cluster occupying the four upper left cells. What I've Considered: I've considered iterating through every label of every cell in the double array and testing to see if the cell-label combination under inspection can be associated with a preexisting segment. If the element under inspection cannot be associated with a preexisting segment it becomes the first member of a new segment. If the label/cell combination can be associated with a preexisting segment it associates. Of course, to make this method reasonable I'd have to implement an elaborate hashing system. I'd have to keep track of all the cell-label combinations that stand adjacent to preexisting segments and are in the path of the incrementing indices that are iterating through the double array. This hash method would avoid having to iterate through every pixel in every preexisting segment to find an adjacency. Why I Don't Like it: As is, the above algorithm doesn't take into consideration the case where an element in the double array can be associated with two unique segments, one in the horizontal direction and one in the vertical direction. To handle these cases properly, I would need to implement a test for this specific case and then implement a method that will both associate the element under inspection with a segment and then concatenate the two adjacent identical segments. On the whole, this method and the intricate hashing system that it would require feels very inelegant. Additionally, I really only care about finding the large segments in the double array and I'm much more concerned with the speed of this algorithm than with the accuracy of the segmentation, so I'm looking for a better way. I assume there is some stochastic method for doing this that I haven't thought of. Any suggestions?

  Read the article

• Accidental Complexity in OpenSSL HMAC functions

  - by Hassan Syed

  SSL Documentation Analaysis This question is pertaining the usage of the HMAC routines in OpenSSL. Since Openssl documentation is a tad on the weak side in certain areas, profiling has revealed that using the: unsigned char *HMAC(const EVP_MD *evp_md, const void *key, int key_len, const unsigned char *d, int n, unsigned char *md, unsigned int *md_len); From here, shows 40% of my library runtime is devoted to creating and taking down **HMAC_CTX's behind the scenes. There are also two additional function to create and destroy a HMAC_CTX explicetly: HMAC_CTX_init() initialises a HMAC_CTX before first use. It must be called. HMAC_CTX_cleanup() erases the key and other data from the HMAC_CTX and releases any associated resources. It must be called when an HMAC_CTX is no longer required. These two function calls are prefixed with: The following functions may be used if the message is not completely stored in memory My data fits entirely in memory, so I choose the HMAC function -- the one whose signature is shown above. The context, as described by the man page, is made use of by using the following two functions: HMAC_Update() can be called repeatedly with chunks of the message to be authenticated (len bytes at data). HMAC_Final() places the message authentication code in md, which must have space for the hash function output. The Scope of the Application My application generates a authentic (HMAC, which is also used a nonce), CBC-BF encrypted protocol buffer string. The code will be interfaced with various web-servers and frameworks Windows / Linux as OS, nginx, Apache and IIS as webservers and Python / .NET and C++ web-server filters. The description above should clarify that the library needs to be thread safe, and potentially have resumeable processing state -- i.e., lightweight threads sharing a OS thread (which might leave thread local memory out of the picture). The Question How do I get rid of the 40% overhead on each invocation in a (1) thread-safe / (2) resume-able state way ? (2) is optional since I have all of the source-data present in one go, and can make sure a digest is created in place without relinquishing control of the thread mid-digest-creation. So, (1) can probably be done using thread local memory -- but how do I resuse the CTX's ? does the HMAC_final() call make the CTX reusable ?. (2) optional: in this case I would have to create a pool of CTX's. (3) how does the HMAC function do this ? does it create a CTX in the scope of the function call and destroy it ? Psuedocode and commentary will be useful.

  Read the article

• Rails: How do I unserialize from database?

  - by Macint

  Hello, I am currently trying to save information for an invoice/bill. On the invoice I want to show what the total price is made up of. The procedures & items, their price and the qty. So in the end I hope to get it to look like this: Consult [date] [total_price] Procedure_name [price] [qty] Procedure_name [price] [qty] Consult [date] [total_price] Procedure_name [price] [qty] etc... All this information is available through the database but i want to save the information as a separate copy. That way if the user changes the price of some procedures the invoice information is still correct. I thought i'd do this by serializing and save the data to a column (consult_data) in the Invoice table. My Model: class Invoice < ActiveRecord::Base ...stuff... serialize :consult_data ... end This is what I get from the form (1 consult and 3 procedures): {"commit"=>"Save draft", "authenticity_token"=>"MZ1OiOCtj/BOu73eVVkolZBWoN8Fy1skHqKgih7Sbzw=", "id"=>"113", "consults"=>[{"consult_date"=>"2010-02-20", "consult_problem"=>"ABC", "procedures"=>[{"name"=>"asdasdasd", "price"=>"2.0", "qty"=>"1"}, {"name"=>"AAAnd another one", "price"=>"45.0", "qty"=>"4"}, {"name"=>"asdasdasd", "price"=>"2.0", "qty"=>"1"}], "consult_id"=>"1"}]} My save action: def add_to_invoice @invoice = @current_practice.invoices.find_by_id(params[:id]) @invoice.consult_data=params[:consults] if @invoice.save render :text => "I think it worked" else render :text => "I don't think it worked'" end end It does save to the database and if I look at the entry in the console I can see that it is all there: consult_data: "--- \n- !map:HashWithIndifferentAccess \n consult_da..." (---The question---) But I can't seam to get back my data. I tried defining a variable to the consult_data attribute and then doing "variable.consult_problem" or "variable[:consult_problem]" (also tried looping) but it only throws no-method-errors back at me. How do I unserialize the data from the database and turn it back into hash that i can use? Thank you very much for any help!

  Read the article

• What is the best way to read and write cXML documents in C# ?

  - by tetranz

  I know this is a vague open ended question. I'm hoping to get some general direction. I need to add cXML punchout to an ASP.NET C# site / application. This is replacing something that I wrote years ago in ColdFusion. I'm a reasonably experienced C# developer but I haven't done much with XML. There seems to be lots of different options for processing XML in .NET. Here's the open ended question: Assuming that I have an XML document in some form, eg a file or a string, what is the best way to read it into my code? I want to get the data and then query databases etc. The cXML document size and our traffic volumes are easily small enough so that loading the a cXML document into memory is not a problem. Should I: 1) Manually build classes based on the dtd and use the XML Serializer? 2) Use a tool to generate classes. There are sample cXML files downloadable from Ariba.com. I tried xsd.exe to generate an xsd and then xsd.exe /c to generate classes. When I try to deserialize I get errors because there seems to be "confusion" around whether some elements should be single values or arrays. I tried the CodeXS online tool but that gives errors in it's log and errors if I try to deserialize a sample document. 2) Create a dataset and ReadXml()? 3) Create a typed dataset and ReadXml()? 4) Use Linq to XML. I often use Linq to Objects so I'm familiar with Linq in general but I'm struggling to see what it gives me in this situation. 5) Some other means. I guess I need to improve my understanding of XML in general but even so ... am I missing some obvious way of doing this? In the old ColdFusion site I found a free component ("tag") which basically ignored any schema and read the XML into a "structure" which is essentially a series of nested hash tables which was then easy to read in code. That was probably quite sloppy but it worked. I also need to generate XML files from my C# objects. Maybe Linq to XML will be good for that. I could start with a default "template" document and manipulate it before saving. Thanks for any pointers ...

  Read the article

• question about book example - Java Concurrency in Practice, Listing 4.12

  - by mike

  Hi, I am working through an example in Java Concurrency in Practice and am not understanding why a concurrent-safe container is necessary in the following code. I'm not seeing how the container "locations" 's state could be modified after construction; so since it is published through an 'unmodifiableMap' wrapper, it appears to me that an ordinary HashMap would suffice. EG, it is accessed concurrently, but the state of the map is only accessed by readers, no writers. The value fields in the map are syncronized via delegation to the 'SafePoint' class, so while the points are mutable, the keys for the hash, and their associated values (references to SafePoint instances) in the map never change. I think my confusion is based on what precisely the state of the collection is in the problem. Thanks!! -Mike Listing 4.12, Java Concurrency in Practice, (this listing available as .java here, and also in chapter form via google) /////////////begin code @ThreadSafe public class PublishingVehicleTracker { private final Map<String, SafePoint> locations; private final Map<String, SafePoint> unmodifiableMap; public PublishingVehicleTracker( Map<String, SafePoint> locations) { this.locations = new ConcurrentHashMap<String, SafePoint>(locations); this.unmodifiableMap = Collections.unmodifiableMap(this.locations); } public Map<String, SafePoint> getLocations() { return unmodifiableMap; } public SafePoint getLocation(String id) { return locations.get(id); } public void setLocation(String id, int x, int y) { if (!locations.containsKey(id)) throw new IllegalArgumentException( "invalid vehicle name: " + id); locations.get(id).set(x, y); } } // monitor protected helper-class @ThreadSafe public class SafePoint { @GuardedBy("this") private int x, y; private SafePoint(int[] a) { this(a[0], a[1]); } public SafePoint(SafePoint p) { this(p.get()); } public SafePoint(int x, int y) { this.x = x; this.y = y; } public synchronized int[] get() { return new int[] { x, y }; } public synchronized void set(int x, int y) { this.x = x; this.y = y; } } ///////////end code

  Read the article

• Sending HTML email from PHP

  - by KevinM

  I am trying to send a simple HTML e-mail from PHP. The code below simply results in a blank e-mail in GMail. It also has an empty attachment called 'noname', which is not at all what I want; though that might just be a symptom of it not working. The code I am using is: <?php //define the receiver of the email $to = '[email protected]'; //define the subject of the email $subject = 'Test HTML email'; //create a boundary string. It must be unique //so we use the MD5 algorithm to generate a random hash $random_hash = md5(date('r', time())); //define the headers we want passed. Note that they are separated with \r\n $headers = "From: [email protected]\r\nReply-To: [email protected]"; //add boundary string and mime type specification $headers .= "\r\nContent-Type: multipart/alternative; boundary=\"PHP-alt-".$random_hash."\""; //define the body of the message. ob_start(); //Turn on output buffering ?> --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Hello World!!! This is simple text email message. --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: 7bit <h2>Hello World!</h2> <p>This is something with <b>HTML</b>formatting.</p> --PHP-alt-<?php echo $random_hash; ?>-- <? //copy current buffer contents into $message variable and delete current output buffer $message = ob_get_clean(); //send the email $mail_sent = @mail( $to, $subject, $message, $headers ); //if the message is sent successfully print "Mail sent". Otherwise print "Mail failed" echo $mail_sent ? "Mail sent" : "Mail failed";

  Read the article

• Performance of SHA-1 Checksum from Android 2.2 to 2.3 and Higher

  - by sbrichards

  In testing the performance of: package com.srichards.sha; import android.app.Activity; import android.os.Bundle; import android.widget.TextView; import java.io.IOException; import java.io.InputStream; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import com.srichards.sha.R; public class SHAHashActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); TextView tv = new TextView(this); String shaVal = this.getString(R.string.sha); long systimeBefore = System.currentTimeMillis(); String result = shaCheck(shaVal); long systimeResult = System.currentTimeMillis() - systimeBefore; tv.setText("\nRunTime: " + systimeResult + "\nHas been modified? | Hash Value: " + result); setContentView(tv); } public String shaCheck(String shaVal){ try{ String resultant = "null"; MessageDigest digest = MessageDigest.getInstance("SHA1"); ZipFile zf = null; try { zf = new ZipFile("/data/app/com.blah.android-1.apk"); // /data/app/com.blah.android-2.apk } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } ZipEntry ze = zf.getEntry("classes.dex"); InputStream file = zf.getInputStream(ze); byte[] dataBytes = new byte[32768]; //65536 32768 int nread = 0; while ((nread = file.read(dataBytes)) != -1) { digest.update(dataBytes, 0, nread); } byte [] rbytes = digest.digest(); StringBuffer sb = new StringBuffer(""); for (int i = 0; i< rbytes.length; i++) { sb.append(Integer.toString((rbytes[i] & 0xff) + 0x100, 16).substring(1)); } if (shaVal.equals(sb.toString())) { resultant = ("\nFalse : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } else { resultant = ("\nTrue : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } return resultant; } catch (IOException e) { e.printStackTrace(); } catch (NoSuchAlgorithmException e) { e.printStackTrace(); } return null; } } On a 2.2 Device I get average runtime of ~350ms, while on newer devices I get runtimes of 26-50ms which is substantially lower. I'm keeping in mind these devices are newer and have better hardware but am also wondering if the platform and the implementation affect performance much and if there is anything that could reduce runtimes on 2.2 devices. Note, the classes.dex of the .apk being accessed is roughly 4MB. Thanks!

  Read the article

• Using Constants in Perl

  - by David W.

  I am trying to define constants in Perl using the use Constant pragma: use Constant { FOO => "bar", BAR => "foo" }; I'm running into a bit of trouble, and hoping there's a standard way of handling it. First of all... I am defining a hook script for Subversion. To make things simple, I want to have a single file where the class (package) I'm using is in the same file as my actual script. Most of this package will have constants involved in it: print "This is my program"; package "MyClass"; use constant { FOO => "bar" }; sub new { yaddah, yaddah, yaddah. I would like my constant FOO to be accessible to my main program. I would like to do this without having to refer to it as MyClass::FOO. Normally, when the package is a separate file, I could do this in my main program: use MyClass qw(FOO); but, since my class and program are a single file, I can't do that. What would be the best way for my main program to be able to access my constants defined in my class? The second issue... I would like to use the constant values as hash keys: $myHash{FOO} = "bar"; The problem is that %myHash has the literal string FOO as the key and not the value of the constant. This causes problems when I do things like this: if (defined($myHash{FOO})) { print "Key " . FOO . " does exist!\n"; } I could force the context: if (defined("" . FOO . "")) { I could add parentheses: if (defined(FOO())) { Or, I could use a temporary variable: my $foo = FOO; if (defined($foo)) { None of these are really nice ways of handling this issue. So, what is the best way? Is there one way I'm missing? By the way, I don't want to use Readonly::Scalar because it is 1). slow, and 2). not part of the standard Perl package. I want to define my hook not to require additional Perl packages and to be as simple as possible to work.

  Read the article

• Ruby: Parse, replace, and evaluate a string formula

  - by Swartz

  I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

  Read the article

• AngularJS: download pdf file from the server

  - by Bartosz Bialecki

  I want to download a pdf file from the web server using $http. I use this code which works great, my file only is save as a html file, but when I open it it is opened as pdf but in the browser. I tested it on Chrome 36, Firefox 31 and Opera 23. This is my angularjs code (based on this code): UserService.downloadInvoice(hash).success(function (data, status, headers) { var filename, octetStreamMime = "application/octet-stream", contentType; // Get the headers headers = headers(); if (!filename) { filename = headers["x-filename"] || 'invoice.pdf'; } // Determine the content type from the header or default to "application/octet-stream" contentType = headers["content-type"] || octetStreamMime; if (navigator.msSaveBlob) { var blob = new Blob([data], { type: contentType }); navigator.msSaveBlob(blob, filename); } else { var urlCreator = window.URL || window.webkitURL || window.mozURL || window.msURL; if (urlCreator) { // Try to use a download link var link = document.createElement("a"); if ("download" in link) { // Prepare a blob URL var blob = new Blob([data], { type: contentType }); var url = urlCreator.createObjectURL(blob); $window.saveAs(blob, filename); return; link.setAttribute("href", url); link.setAttribute("download", filename); // Simulate clicking the download link var event = document.createEvent('MouseEvents'); event.initMouseEvent('click', true, true, window, 1, 0, 0, 0, 0, false, false, false, false, 0, null); link.dispatchEvent(event); } else { // Prepare a blob URL // Use application/octet-stream when using window.location to force download var blob = new Blob([data], { type: octetStreamMime }); var url = urlCreator.createObjectURL(blob); $window.location = url; } } } }).error(function (response) { $log.debug(response); }); On my server I use Laravel and this is my response: $headers = array( 'Content-Type' => $contentType, 'Content-Length' => strlen($data), 'Content-Disposition' => $contentDisposition ); return Response::make($data, 200, $headers); where $contentType is application/pdf and $contentDisposition is attachment; filename=" . basename($fileName) . '"' $filename - e.g. 59005-57123123.PDF My response headers: Cache-Control:no-cache Connection:Keep-Alive Content-Disposition:attachment; filename="159005-57123123.PDF" Content-Length:249403 Content-Type:application/pdf Date:Mon, 25 Aug 2014 15:56:43 GMT Keep-Alive:timeout=3, max=1 What am I doing wrong?

  Read the article

• Need help converting Ruby code to php code

  - by newprog

  Yesterday I posted this queston. Today I found the code which I need but written in Ruby. Some parts of code I have understood (I don't know Ruby) but there is one part that I can't. I think people who know ruby and php can help me understand this code. def do_create(image) # Clear any old info in case of a re-submit FIELDS_TO_CLEAR.each { |field| image.send(field+'=', nil) } image.save # Compose request vm_params = Hash.new # Submitting a file in ruby requires opening it and then reading the contents into the post body file = File.open(image.filename_in, "rb") # Populate the parameters and compute the signature # Normally you would do this in a subroutine - for maximum clarity all # parameters are explicitly spelled out here. vm_params["image"] = file # Contents will be read by the multipart object created below vm_params["image_checksum"] = image.image_checksum vm_params["start_job"] = 'vectorize' vm_params["image_type"] = image.image_type if image.image_type != 'none' vm_params["image_complexity"] = image.image_complexity if image.image_complexity != 'none' vm_params["image_num_colors"] = image.image_num_colors if image.image_num_colors != '' vm_params["image_colors"] = image.image_colors if image.image_colors != '' vm_params["expire_at"] = image.expire_at if image.expire_at != '' vm_params["licensee_id"] = DEVELOPER_ID #in php it's like this $vm_params["sequence_number"] = -rand(100000000);????? vm_params["sequence_number"] = Kernel.rand(1000000000) # Use a negative value to force an error when calling the test server vm_params["timestamp"] = Time.new.utc.httpdate string_to_sign = CREATE_URL + # Start out with the URL being called... #vm_params["image"].to_s + # ... don't include the file per se - use the checksum instead vm_params["image_checksum"].to_s + # ... then include all regular parameters vm_params["start_job"].to_s + vm_params["image_type"].to_s + vm_params["image_complexity"].to_s + # (nil.to_s => '', so this is fine for vm_params we don't use) vm_params["image_num_colors"].to_s + vm_params["image_colors"].to_s + vm_params["expire_at"].to_s + vm_params["licensee_id"].to_s + # ... then do all the security parameters vm_params["sequence_number"].to_s + vm_params["timestamp"].to_s vm_params["signature"] = sign(string_to_sign) #no problem # Workaround class for handling multipart posts mp = Multipart::MultipartPost.new query, headers = mp.prepare_query(vm_params) # Handles the file parameter in a special way (see /lib/multipart.rb) file.close # mp has read the contents, we can close the file now response = post_form(URI.parse(CREATE_URL), query, headers) logger.info(response.body) response_hash = ActiveSupport::JSON.decode(response.body) # Decode the JSON response string ##I have understood below def sign(string_to_sign) #logger.info("String to sign: '#{string_to_sign}'") Base64.encode64(HMAC::SHA1.digest(DEVELOPER_KEY, string_to_sign)) end # Within Multipart modul I have this: class MultipartPost BOUNDARY = 'tarsiers-rule0000' HEADER = {"Content-type" => "multipart/form-data, boundary=" + BOUNDARY + " "} def prepare_query (params) fp = [] params.each {|k,v| if v.respond_to?(:read) fp.push(FileParam.new(k, v.path, v.read)) else fp.push(Param.new(k,v)) end } query = fp.collect {|p| "--" + BOUNDARY + "\r\n" + p.to_multipart }.join("") + "--" + BOUNDARY + "--" return query, HEADER end end end Thanks for your help.

  Read the article

• C++ using cdb_read returns extra characters on some reads

  - by Moe Be

  Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

  Read the article

• How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

  - by DarkWalker

  So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

  Read the article

• In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

  - by Pedro Silva

  I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

  Read the article

• Delphi - Read File To StringList, then delete and write back to file.

  - by Jkraw90

  I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• In what circumstances are instance variables declared as '_var' in 'use fields' private?

  - by Pedro Silva

  I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

  Read the article

• Java replacement for C macros

  - by thkala

  Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

  Read the article

• Database schema for simple stats project

  - by Bubnoff

  Backdrop: I have a file hierarchy of cvs files for multiple locations named by dates they cover ...by month specifically. Each cvs file in the folder is named after the location. eg', folder name: 2010-feb contains: location1.csv location2.csv Each CSV file holds records like this: 2010-06-28, 20:30:00 , 0 2010-06-29, 08:30:00 , 0 2010-06-29, 09:30:00 , 0 2010-06-29, 10:30:00 , 0 2010-06-29, 11:30:00 , 0 meaning of record columns ( column names ): Date, time, # of sessions I have a perl script that pulls the data from this mess and originally I was going to store it as json files, but am thinking a database might be more appropriate long term ...comparing year to year trends ...fun stuff like that. Pt 2 - My question/problem: So I now have a REST service that coughs up json with a test database. My question is [ I suck at db design ], how best to design a database backend for this? I am thinking the following tables would suffice and keep it simple: Location: (PK)location_code, name session: (PK)id, (FK)location_code, month, hour, num_sessions I need to be able to average sessions (plus min and max) for each hour across days of week in addition to days of week in a given month or months. I've been using perl hashes to do this and am trying to decide how best to implement this with a database. Do you think stored procedures should be used? As to the database, depending on info gathered here, it will be postgresql or sqlite. If there is no compelling reason for postgresql I'll stick with sqlite. How and where should I compare the data to hours of operation. I am storing the hours of operation in a yaml file. I currently 'match' the hour in the data to a hash from the yaml to do this. Would a database open simpler methods? I am thinking I would do this comparison as I do now then insert the data. Can be recalled with: SELECT hour, num_sessions FROM session WHERE location_code=LOC1 Since only hours of operation are present, I do not need to worry about it. Should I calculate all results as I do now then store as a stats table for different 'reports'? This, rather than processing on demand? How would this look? Anyway ...I ramble. Thanks for reading! Bubnoff

  Read the article

• Jquery-UI tabs : Double loading of the default tab with

  - by Stephane

  I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

  Read the article

• ScrollTo and toggle div

  - by user1466260

  I'm a big fan ov 8020.com and my goal is to create a porfolio with the same functionality like the one they have. Here is my markup This section should be hidden <section id="work-container"> <div id="work-list-51" class="work-details"> <h1> <div class="close-project"> </div> <div id="work-list-52" class="work-details"> <h1> <div class="close-project"> </div> <div id="work-list-53" class="work-details"> <h1> <div class="close-project"> </div> </section> This section will hold the thumbnails. When you click a thumbnail you will scroll to the top and the div will slidetoggle. <ul id="work-list"> <li id="work-list-51"><a data-page="51" href="#work-list-51"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> <li id="work-list-52"><a data-page="52" href="#work-list-52"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> <li id="work-list-53"><a data-page="53" href="#work-list-53"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> </ul> I have come this far: $(document).ready(function(){ $("#work-list a").click(function(event){ event.preventDefault(); $('html, body').animate ( {scrollTop: $('#top').offset().top}, 800 ); }); $('#work-list a').click(function(e) { $('#work-container > div').hide(); $(this.hash).slideToggle(1600); }); }); It scrolls to top and the div becomes visible but it does not work correctly :)

  Read the article

• Infinite Refresh Loop in Firefox 3.0

  - by Martin Gordon

  I'm having a strange issue with my Javascript in Firefox 3.0.x. In Firefox 3.0.12, the page constantly reloads as soon as the list body is loaded. Neither Firefox 3.5, Safari 4 nor Chrome 5 (all on Mac) experience this issue. EDIT: I've created an isolated example rather than pulling this from my existing code. test.js function welcomeIndexOnLoad() { $("#options a").live('click', function () { optionClicked($(this), "get_list_body.html"); return false; }); $(document).ready(function() { optionClicked(null, "get_list_body.html"); }); } function optionClicked(sender, URL) { queryString = ""; if (sender != null) { queryString = $(sender).attr("rel"); } $("#list_body").load(URL + "?" + queryString, function(resp, status, AJAXReq) { console.log(resp); console.log("" + status); location.hash = queryString; }); }? test.html <html> <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.js"></script> <script type="text/javascript" src="test.js"></script> <script> welcomeIndexOnLoad(); </script> </head> <body> <div id="container"> Outside of list body. <div id="list_body"> </div> </div> </body> </html> get_list_body.html <h3> <div id="options"> <a href="#" rel="change_list">Change List</a> </div> <ul> <li>li</li> </ul> jQuery line 5252 (an xhr.send() call) shows up in the console as soon as the page reloads: xhr.send( type === "POST" || type === "PUT" || type === "DELETE" ? s.data : null );

  Read the article

• Python: (sampling with replacement): efficient algorithm to extract the set of UNIQUE N-tuples from a set

  - by Homunculus Reticulli

  I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

  Read the article

• Python: (sampling with replacement): efficient algorithm to extract the set of DISSIMILAR N-tuples from a set

  - by Homunculus Reticulli

  I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] # Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

  Read the article

< Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >