Search Results

Search found 38328 results on 1534 pages for 'write xml'.

Page 132/1534 | < Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • How to marshall non-string objects with JAXB and Spring

    - by lesula
    I was trying to follow this tutorial in order to create my own restful web-service using Spring framework. The client do a GET request to, let's say http://api.myapp/app/students and the server returns an xml version of the object classroom: @XmlRootElement(name = "class") public class Classroom { private String classId = null; private ArrayList<Student> students = null; public Classroom() { } public String getClassId() { return classId; } public void setClassId(String classId) { this.classId = classId; } @XmlElement(name="student") public ArrayList<Student> getStudents() { return students; } public void setStudents(ArrayList<Student> students) { this.students = students; } } The object Student is another bean containing only Strings. In my app-servlet.xml i copied this lines: <bean id="studentsView" class="org.springframework.web.servlet.view.xml.MarshallingView"> <constructor-arg ref="jaxbMarshaller" /> </bean> <!-- JAXB2 marshaller. Automagically turns beans into xml --> <bean id="jaxbMarshaller" class="org.springframework.oxm.jaxb.Jaxb2Marshaller"> <property name="classesToBeBound"> <list> <value>com.spring.datasource.Classroom</value> <value>com.spring.datasource.Student</value> </list> </property> </bean> Now my question is: what if i wanted to insert some non-string objects as class variables? Let's say i want a tag containing the String version of an InetAddress, such as <inetAddress>192.168.1.1</inetAddress> How can i force JAXB to call the method inetAddress.toString() in such a way that it appears as a String in the xml? In the returned xml non-string objects are ignored!

    Read the article

  • How do i write this jpql query?

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Data Contract Serialization Not Working For All Elements

    - by splatto
    I have an XML file that I'm trying to serialize into an object. Some elements are being ignored. My XML File: <?xml version="1.0" encoding="utf-8" ?> <License xmlns="http://schemas.datacontract.org/2004/07/MyApp.Domain"> <Guid>7FF07F74-CD5F-4369-8FC7-9BF50274A8E8</Guid> <Url>http://www.gmail.com</Url> <ValidKey>true</ValidKey> <CurrentDate>3/1/2010 9:39:28 PM</CurrentDate> <RegistrationDate>3/8/2010 9:39:28 PM</RegistrationDate> <ExpirationDate>3/8/2099 9:39:28 PM</ExpirationDate> </License> My class definition: [DataContract] public class License { [DataMember] public virtual int Id { get; set; } [DataMember] public virtual string Guid { get; set; } [DataMember] public virtual string ValidKey { get; set; } [DataMember] public virtual string Url { get; set; } [DataMember] public virtual string CurrentDate { get; set; } [DataMember] public virtual string RegistrationDate { get; set; } [DataMember] public virtual string ExpirationDate { get; set; } } And my Serialization attempt: XmlDocument Xmldoc = new XmlDocument(); Xmldoc.Load(string.Format(url)); string xml = Xmldoc.InnerXml; var serializer = new DataContractSerializer(typeof(License)); var memoryStream = new MemoryStream(Encoding.UTF8.GetBytes(xml)); License license = (License)serializer.ReadObject(memoryStream); memoryStream.Close(); The following elements are serialized: Guid ValidKey The following elements are not serialized: Url CurrentDate RegistrationDate ExpirationDate Replacing the string dates in the xml file with "blah" doesn't work either. What gives?

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • Strategies for serializing an object for auditing/logging purpose in .NET?

    - by Jiho Han
    Let's say I have an application that processes messages. Messages are just objects in this case that implements IMessage interface which is just a marker. In this app, if a message fails to process, then I want to log it, first of all for auditing and troubleshooting purposes. Secondly I might want to use it for re-processing. Ideally, I want the message to be serialized into a format that is human-readable. The first candidate is XML although there are others like JSON. If I were to serialize the messages as XML, I want to know whether the message object is XML-serializable. One way is to reflect on the type and to see if it has a parameter-less constructor and the other is to require IXmlSerializable interface. I'm not too happy with either of these approaches. There is a third option which is to try to serialize it and catch exceptions. This doesn't really help - I want to, in some way, stipulate that IMessage (or a derived type) should be xml-serializable. The reflection route has obvious disadvantages such as security, performance, etc. IXmlSerializable route locks down my messages to one format, when in the future, I might want to change the serialization format to be JSON. The other thing is even the simplest objects now must implement ReadXml and WriteXml methods. Is there a route that involves the least amount of work that lets me serialize an arbitrary object (as long as it implements the marker interface) into XML but not lock future messages into XML?

    Read the article

  • Translate XSD element names to English

    - by Coov
    I have an XML Schema Definition file .XSD who's elements are in Spanish. I have an XML data file that is also in Spanish that matches the schema definition. I created a dataset from the xsd using xsd.exe and I'm loading the XML into the dataset. I want to translate the element names to English. I can think of two options off the top of my head. Either scrape the XSD & XML files and translate the elements prior to generating the dataset with esd.exe, or iterate the dataset after I have loaded it with the xml, and translate my objects. I do have a written document that provides the English names for every element name in Spanish. The problem is there are hundreds of elements and I was trying to avoid coding that manually. Getting precise translations is not that important, it just needs to be readable by an English speaking person. Here is an example of what an element may look like "Apellidos": <xs:element name="Apellidos" type="xs:string"/> that I will translate to "SirName": <xs:element name="SirName" type="xs:string"/> I'm looking for ideas and or opinions on a quick way to do this. It's a one time deal so I'm not working about it scaling or being functional for things other than this single xml file. I'll be taking this dataset and writing out a flat file for English speaking users to read.

    Read the article

  • getting expat to use .dtd for entity replacement in python

    - by nicolas78
    I'm trying to read in an xml file which looks like this <?xml version="1.0" encoding="ISO-8859-1"?> <!DOCTYPE dblp SYSTEM "dblp.dtd"> <dblp> <incollection> <author>Jos&eacute; A. Blakeley</author> </incollection> </dblp> The point that creates the problem looks is the Jos&eacute; A. Blakeley part: The parser calls its character handler twice, once with "Jos", once with " A. Blakeley". Now I understand this may be the correct behaviour if it doesn't know the eacute entity. However, this is defined in the dblp.dtd, which I have. I don't seem to be able to convince expat to use this file, though. All I can say is p = xml.parsers.expat.ParserCreate() # tried with and without following line p.SetParamEntityParsing(xml.parsers.expat.XML_PARAM_ENTITY_PARSING_ALWAYS) p.UseForeignDTD(True) f = open(dblp_file, "r") p.ParseFile(f) but expat still doesn't recognize my entity. Why is there no way to tell expat which DTD to use? I've tried putting the file into the same directory as the XML putting the file into the program's working directory replacing the reference in the xml file by an absolute path What am I missing? Thx.

    Read the article

  • Write simple data to iphone sandbox?

    - by fuzzygoat
    I want to write a small bit of data from my app to the iphone so I can load it when the app next starts. I am going to write the data using NSCoding, but I don't know what I should be specifying as a path. I understand I would write the data to the application sandbox, just not sure how to specify that. gary

    Read the article

  • How do i write this jpql query? java

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Flash/Flex sending XML to Rails App

    - by bdicasa
    I'm trying to send some XML to a rails app in Flex. I'm using the URLRequest and URLLoader objects. However, I'm having trouble determining how to send the XML and _method parameter to the rails app using these flash objects. Below is how I'm currently trying to achieve this. var request:URLRequest = new URLRequest(); request.method = URLRequestMethod.POST; request.data = new Object(); request.data.xml = Blog.xml.toXMLString(); request.contentType = "text/xml"; var loader:URLLoader = new URLLoader(); loader.addEventListener(Event.COMPLETE, saveCompleteHandler); var saveUrl:String = ""; saveUrl = BASE_URL; if (Blog.isNewBlog) { // Set the rails REST method. request.data._method = "POST"; saveUrl += "blogs.xml"; } else { // Set the rails REST method. request.data._method = "PUT"; saveUrl += "blogs/" + Blog.id.toString() + ".xml"; } request.url = saveUrl; //trace(request.data.toString()); loader.load(request); However the only data that is getting sent to the server is [Object object]. If some one could let me know where I'm going wrong I'd greatly appreciate it. Thanks.

    Read the article

  • I find a problem with sending receiving parameter

    - by kawtousse
    how to get the xml translation to html dropdownlist with ajax. I send the parameter with GET method but the JSP FILE THAT GENERATES THE XML DONT RECEIVE IT. var url="responsexml.jsp"; url=url+"?projectCode="+prj.options[prj.selectedIndex].value; xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); and then in responsexml.jsp I do like that: <% String projectcode= (String)request.getParameter("projectCode"); System.out.println("++++projectCode:=" +projectcode); Session s = null; Transaction tx; try { s = HibernateUtil.currentSession(); tx = s.beginTransaction(); Query query = s.createQuery("SELECT from Wa wa where wa.ProjectCode='"+projectcode+"'"); response.setContentType("text/xml"); PrintWriter output = response.getWriter(); output.write( "<?xml version=\"1.0\" encoding=\"utf-8\"?>"); //response.setHeader("Cache-Control", "no-cache"); //constriure le xml if(projectcode!=null) { for(Iterator it=query.iterate();it.hasNext();) { if(it.hasNext()) { Wa object=(Wa)it.next(); //out.print( "<item id=\"" +object.getIdWA() + "\" name=\"" + object.getWAName() + "\" />"); output.write("<wa>"); output.write( "<item id=\"" + object.getIdWA() + "\" name=\"" + object.getWAName() + "\" />"); output.write("</wa>"); } } } } catch (HibernateException e) { e.printStackTrace(); } %> </body> </html> With this code I dont have my xml file. I got this error: The server did not understand the request, or the request was invalid. Erreur de traitement de la ressource http://www.w3.o... PLEASE HELP.

    Read the article

  • .NET Single Line Logging (ala Trace.Write/WriteLine) using Instrumentation.Logging

    - by KnownColor
    Hello Everyone, My question is whether it is possible to get line/multiline (very unsure of correct term for this) behaviour of the Trace.Write and Trace.WriteLine methods but using the Microsoft Instrumentation Logging framework in .NET 2.0. Desired Output Hello World! Oh Hai. What I Currently Have Trace.Write("Hello "); Trace.WriteLine("World!"); Trace.Write("Oh Hai."); I would prefer to use instrumentation to log rather than writing to a log file using Debug.Trace. EDIT: By Instrumentation Logging I mean using a 'loggingConfiguration' block in my App.config and writing Log Entries using using Microsoft.Practices.EnterpriseLibrary.Logging.Logger.Write(LogEntry logEntry); Microsoft.Practices.EnterpriseLibrary.Logging.Configuration.FlatFileTraceListenerData, Microsoft.Practices.EnterpriseLibrary.Logging, Version=2.0.0.0 for example. Ta, KnownColor

    Read the article

  • how to check the read write status of storing media in python

    - by mukul sharma
    Hi All, How can i check the read/ write permission of the file storing media? ie assume i have to write some file inside a directory and that directory may be available on read only media like (cd or dvd)or etc. So how can i check that storing media ( cd, hard disk) having a read only or read write both permission. I am using windows xp os. Thanks.

    Read the article

  • Writing/Reading struct w/ dynamic array through pipe in C

    - by anrui
    I have a struct with a dynamic array inside of it: struct mystruct{ int count; int *arr; }mystruct_t; and I want to pass this struct down a pipe in C and around a ring of processes. When I alter the value of count in each process, it is changed correctly. My problem is with the dynamic array. I am allocating the array as such: mystruct_t x; x.arr = malloc( howManyItemsDoINeedToStore * sizeof( int ) ); Each process should read from the pipe, do something to that array, and then write it to another pipe. The ring is set up correctly; there's no problem there. My problem is that all of the processes, except the first one, are not getting a correct copy of the array. I initialize all of the values to, say, 10 in the first process; however, they all show up as 0 in the subsequent ones. for( j = 0; j < howManyItemsDoINeedToStore; j++ ){ x.arr[j] = 10; } Initally: 10 10 10 10 10 After Proc 1: 9 10 10 10 15 After Proc 2: 0 0 0 0 0 After Proc 3: 0 0 0 0 0 After Proc 4: 0 0 0 0 0 After Proc 5: 0 0 0 0 0 After Proc 1: 9 10 10 10 15 After Proc 2: 0 0 0 0 0 After Proc 3: 0 0 0 0 0 After Proc 4: 0 0 0 0 0 After Proc 5: 0 0 0 0 0 Now, if I alter my code to, say, struct mystruct{ int count; int arr[10]; }mystruct_t; everything is passed correctly down the pipe, no problem. I am using READ and WRITE, in C: write( STDOUT_FILENO, &x, sizeof( mystruct_t ) ); read( STDIN_FILENO, &x, sizeof( mystruct_t ) ); Any help would be appreciated. Thanks in advance!

    Read the article

  • Serial: write() throttling?

    - by damian
    Hi everyone, I'm working on a project sending serial data to control animation of LED lights, which need to stay in sync with a sound engine. There seems to be a large serial write buffer (OSX (POSIX) + FTDI chipset usb serial device), so without manually restricting the transmission rate, the animation system can get several seconds ahead of the serial transmission. Currently I'm manually restricting the serial write speed to the baudrate (8N1 = 10 bytes serial frame per 8 bytes data, 19200 bps serial - 1920 bytes per second max), but I am having a problem with the sound drifting out of sync over time - it starts fine, but after 10 minutes there's a noticeable (100ms+) lag between the sound and the lights. This is the code that's restricting the serial write speed (called once per animation frame, 'elapsed' is the duration of the current frame, 'baudrate' is the bps (19200)): void BufferedSerial::update( float elapsed ) { baud_timer += elapsed; if ( bytes_written > 1024 ) { // maintain baudrate float time_should_have_taken = (float(bytes_written)*10)/float(baudrate); float time_actually_took = baud_timer; // sleep if we have > 20ms lag between serial transmit and our write calls if ( time_should_have_taken-time_actually_took > 0.02f ) { float sleep_time = time_should_have_taken - time_actually_took; int sleep_time_us = sleep_time*1000.0f*1000.0f; //printf("BufferedSerial::update sleeping %i ms\n", sleep_time_us/1000 ); delayUs( sleep_time_us ); // subtract 128 bytes bytes_written -= 128; // subtract the time it should have taken to write 128 bytes baud_timer -= (float(128)*10)/float(baudrate); } } } Clearly there's something wrong, somewhere. A much better approach would be to be able to determine the number of bytes currently in the transmit queue, and try and keep that below a fixed threshold. Any advice appreciated.

    Read the article

  • Cannot write to SD card -- canWrite is returning false

    - by Fizz
    Sorry for the ambiguous title but I'm doing the following to write a simple string to a file: try { File root = Environment.getExternalStorageDirectory(); if (root.canWrite()){ System.out.println("Can write."); File def_file = new File(root, "default.txt"); FileWriter fw = new FileWriter(def_file); BufferedWriter out = new BufferedWriter(fw); String defbuf = "default"; out.write(defbuf); out.flush(); out.close(); } else System.out.println("Can't write."); }catch (IOException e) { e.printStackTrace(); } But root.canWrite() seems to be returning false everytime. I am not running this off of an emulator, I have my android Eris plugged into my computer via USB and running the app off of my phone via Eclipse. Is there a way of giving my app permission so this doesn't happen? Also, this code seems to be create the file default.txt but what if it already exists, will it ignore the creation and just open it to write or do I have to catch something like FileAlreadyExists(if such an exception exists) which then just opens it and writes? Thanks for any help guys.

    Read the article

  • JAXB, how to marshal without a namespace

    - by Alvin
    I have a fairly large repetitive XML to create using JAXB. Storing the whole object in the memory then do the marshaling takes too much memory. Essentially, my XML looks like this: <Store> <item /> <item /> <item /> ..... </Store> Currently my solution to the problem is to "hard code" the root tag to an output stream, and marshal each of the repetitive element one by one: aOutputStream.write("<?xml version="1.0"?>") aOutputStream.write("<Store>") foreach items as item aMarshaller.marshall(item, aOutputStream) end aOutputStream.write("</Store>") aOutputStream.close() Somehow the JAXB generate the XML like this <Store xmlns="http://stackoverflow.com"> <item xmlns="http://stackoverflow.com"/> <item xmlns="http://stackoverflow.com"/> <item xmlns="http://stackoverflow.com"/> ..... </Store> Although this is a valid XML, but it just look ugly, so I'm wonder is there any way to tell the marshaller not to put namespace for the item elements? Or is there better way to use JAXB to serialize to XML chunk by chunk?

    Read the article

< Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >