Search Results

Search found 40479 results on 1620 pages for 'binary files'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 135/1620 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

  • $_POST goes empty after adding a new input type "file"

    - by heldrida
    Hi, I'm not finding a way to understand and fix this and I've done a lot. I've got a script, wish is a simple form, that sends a file trough POST. The second file, process the info. By default, I give to the user a few fields, one of them being a input field of type "file" and there's also, a few "hidden" one's, that gives me values to work with on POST. I found that, when adding a new input of type "file", the $_POST returns array 0, even $_FILES returns nothing. I have no idea how to fix this, and it works just fine when keeping the default input box of type "file". This is the form http://pastie.org/872488 This only happens when: Exists! var_dump( $_POST ), or $_FILES, print_r(), etc Returns nothing. I've tryed to create a array on the input of type "files", like img_p_child[], but nothing. How to solve this ? Thanks for taking your time!

    Read the article

  • Redirected site files for desktop downloader

    - by Jeje
    Hi, i temporarily change place for static files on site. But this files must have access from old URL, i've create a script that make's redirect to the right place, but this files are downloading by third-part program. The problem is that program ignoring redirect. I tryed to use permanent redirecting but no success.

    Read the article

  • Grep all files in a directory and print matches with file name

    - by javanix
    I have a list of log files that I create as part of a video encoding script that I wrote. I would like to search all of them and print out certain statistics from the encode - how fast they were encoded, what settings were used, etc. I can search for the average framerate in one file via this 1 liner: cat ${filename} | grep average which outputs: work: average encoding speed for job is 23.211176 fps and search for the ratefactor: cat ${filename} | grep RF I would like to search all files in the directory and print off one, or prefereably both pieces of information along with the filename. Is there any way I can use find or grep to get this in a one-liner, or do I need to write a script? I would like output like this: /home/javanix/filename.log <RF line> <average line> I would like this to either work using FreeBSD 9 or Ubuntu 12.04.

    Read the article

  • How to manage Libraries/jar files in eclipse?

    - by pvsnp
    I might be missing something but how do you manage Java projects in eclipse that need a lot of Jar files. I know maven manages libraries well if there are new updates but maybe I'm missing something, is there a way that eclipse can update new jar files (it would be especially useful for projects using apache-commons, say). I don't want to sound like asking for a feature request, but I'm looking at if there are ways to keep libraries jar files that a Java project uses to keep them updated automatically the way maven does. With more languages coming with this type of features, finding the right Jar files probably should be easier than this.

    Read the article

  • Shell script to copy files

    - by Hulk
    If there exist a directory, /backup/ And the files in it are a.gz b.gz c.gz And another directory /backup-directorybackup And the files in it are a.gz I need a shells script to compare two directories if the files are present then ignore it and if the filesare not present copy it to the destination directory Thanks..

    Read the article

  • Dreamweaver Files uploaded to Win 2008 server cause login prompt

    - by Lil
    I have a customer who uses a 4 year old version of Dreamweaver to edit her webpages. My hosting reseller account is with a company that uses Windows Server 2008. Every time my customer edits a page and uploads it, I have to set the permissions for that file to be readable, manually from the site's control panel. The customer is furious with me because her files cause the login prompt. I am able to upload files myself that remain readable to the site with both Filezilla and with Frontpage. I am assuming that her Dreamweaver settings are the cause of the problem but I don't have that program myself and don't know what to advise her. Any suggestions?

    Read the article

  • Files slow to save sometimes after Ubuntu upgrade

    - by Matchu
    I haven't quite been able to track down why this happens sometimes in Ubuntu 10.04 and not other times. I'll go into gedit or OpenOffice.org and try to save files, and, during some sessions, it will take up to 10 seconds to save the file, sometimes causing the program to become unresponsive. But during these same sessions, the files sometimes save instantly. This didn't start happening until after the 10.04 (Lucid) upgrade. I suspect that something is reading all the changes I make, or that there's some other big file action going on, or something like that. I disabled Tracker a while back, before the upgrade, and don't see it under the settings - could it be back under a different name under Lucid? You probably don't already know the answer, but how can I go about finding the cause of this problem?

    Read the article

  • Django fails to find static files served by nginx

    - by Simon
    I know this is a really noobish question but I can't find any solution despite finding the problem trivial. I have a django application deployed with gunicorn. The static files are served by the nginx server with the following url : myserver.com/static/admin/css/base.css. However, my django application keep looking for the static files at myserver.com:8001/static/admin/css/base.css and is obviously failing (404). I don't know how to fix this. Is it a django or an nginx problem ? Here is my nginx configuration file : server { server_name myserver.com; access_log off; location /static/ { alias /home/myproject/static/; } location / { proxy_pass http://127.0.0.1:8001; proxy_set_header X-Forwarded-Host $server_name; proxy_set_header X-Real-IP $remote_addr; add_header P3P 'CP="ALL DSP COR PSAa PSDa OUR NOR ONL UNI COM NAV"'; } } Thanks for the help !

    Read the article

  • Cannot chown my own files from NFS

    - by valpa
    We have a NFS server provide home directory for many account, which provided by a NIS server. I have account A and B. In /home/A, I try to copy "cp -a /home/B/somedir ~/". Then I found in /home/A/somedir, all files are owned by user A. Then if I do "chown -R B:B somedir", I got "Operation not permitted" error. I am user A, "cp -a" didn't preserve the original user (B). Then I cannot chown my own files. Any suggestion? I fix my own issue by "chmod 777 /home/A", "su - B" and "cp -a somedir /home/A/", and "su - A", then "chmod 755 /home/A". But it is not a good solution.

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • Encrypt shared files on AD Domain.

    - by Walter
    Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. Can be implemented this ? What technology should be used?

    Read the article

  • Encrypt shared files on AD Domain.

    - by Walter
    Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. How can be implemented this using EFS?

    Read the article

  • Windows 7 Locking Executable Files

    - by James Burgess
    Since I've been using Windows 7 RTM (as opposed to the Beta and RCs), I've been having a peculiar issue with executable files. I first noticed it whilst using Visual Studio, in that when building a project, it would often fail saying that the output file was locked - but the problem has stemmed further. When I've executed an application, closed it (cleanly), and attempted to delete/move/rename/overwrite said file, Windows 7 tells me that the file is locked/access is denied. I've made use of software like LockHunter/Unlocker but it is seemingly unable to remove these locks (most of the time, it shows no locks at all). After about 5-10 minutes, the respective files are unlocked again, but needless to say this is a bit of a workflow-breaker (as it's not simply constrained to VS). I've done the usual tasks of virus/malware scanning, and turned up with absolutely nothing. I've got no peculiar services running, and the problem was not present before I installed a Windows 7 RTM version. Any help is greatly appreciated.

    Read the article

  • Combine and compress script files in asp.net mvc

    - by victor_foster
    I am working in Visual Studio 2008, IIS7 and using asp.net MVC. I would like to know the best way to combine all of my Javascript files into one file to reduce the number of HTTP requests to the server. I have seen many articles on this subject but I'm not sure which one I should look at first (many of them are over a year old). Here are the things I would like to do: Combine my Javascript and css files Safely compress my Javascript files when I publish, but keep them uncompressed while I am debugging Cache my Css and Javascript files but allow them to refreshed with a hard refresh when they are updated without having to rename them.

    Read the article

  • get a set of files that have been modified after a certain date

    - by jcollum
    Does anyone have a handy powershell script that gets a set of files from TFS based on a modification date? I'd like to say "give me all the files in this folder (or subfolder) that were modified after X/Y/ZZZZ" and dump those files to a folder other than the folder they would normally go to. I know enough powershell to hack about and get this done, eventually, but I'm hoping to avoid that.

    Read the article

  • Bash or python for changing spacing in files

    - by Werner
    Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

    Read the article

  • Haskell lazy I/O and closing files

    - by Jesse
    I've written a small Haskell program to print the MD5 checksums of all files in the current directory (searched recursively). Basically a Haskell version of md5deep. All is fine and dandy except if the current directory has a very large number of files, in which case I get an error like: <program>: <currentFile>: openBinaryFile: resource exhausted (Too many open files) It seems Haskell's laziness is causing it not to close files, even after its corresponding line of output has been completed. The relevant code is below. The function of interest is getList. import qualified Data.ByteString.Lazy as BS main :: IO () main = putStr . unlines =<< getList "." getList :: FilePath -> IO [String] getList p = let getFileLine path = liftM (\c -> (hex $ hash $ BS.unpack c) ++ " " ++ path) (BS.readFile path) in mapM getFileLine =<< getRecursiveContents p hex :: [Word8] -> String hex = concatMap (\x -> printf "%0.2x" (toInteger x)) getRecursiveContents :: FilePath -> IO [FilePath] -- ^ Just gets the paths to all the files in the given directory. Are there any ideas on how I could solve this problem? The entire program is available here: http://haskell.pastebin.com/PAZm0Dcb

    Read the article

  • tool for advanced ID3 tags handling and audio files ordering

    - by Juhele
    I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • hosting acounts for large uploads

    - by Phil Jackson
    Hi, im wondering if anyone knows of any host providers ( uk preferably ) that deals mostly with accepting large file uploads. Most hosts only let you push something like 1.5mb ( thats taking into account the connection and the max execution time ). What i am looking for is a host specificaly for storing files on. I was going to create an upload script onto my application which posted the file to the external host and then return back ( using headers so the user doen't even know they have left ). Does anyone know of a host for this?

    Read the article

  • CVS list of files only in working directories

    - by Joshua Berry
    Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >