Search Results

Search found 10071 results on 403 pages for 'operator module'.

Page 136/403 | < Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • Checking for uppercase/lowercase/numbers with Jquery

    - by user1725794
    Either I'm being really retarded here or its just the lack of sleep but why doesn't this work? If I use the "or" operator it works for each separate test but as soon as it change it to the "and" operator it stops working. I'm trying to test the password input of a form to see if its contains lowercase, uppercase and at least 1 number of symbol. I'm having a lot of trouble with this so help would be lovely, here is the code I have. var upperCase= new RegExp('[^A-Z]'); var lowerCase= new RegExp('[^a-z]'); var numbers = new RegExp('[^0-9]'); if(!$(this).val().match(upperCase) && !$(this).val().match(lowerCase) && !$(this).val().match(numbers)) { $("#passwordErrorMsg").html("Your password must be between 6 and 20 characters. It must contain a mixture of upper and lower case letters, and at least one number or symbol."); } else { $("#passwordErrorMsg").html("OK") }

    Read the article

  • converting string to int in C++

    - by xbonez
    I am trying to convert a string I read in from a file to an int value so I can store it in an integer variable. This is what my code looks like: ifstream sin; sin.open("movie_output.txt"); string line; getline(sin,line); myMovie.setYear(atoi(line)); Over here, setYear is a mutator in the Movie class (myMovie is an object of Movie class) that looks like this: void Movie::setYear(unsigned int year) { year_ = year; } When I run the code, I get the following error: error C2664: 'atoi' : cannot convert parameter 1 from 'std::string' to 'const char *' 1> No user-defined-conversion operator available that can perform this conversion, or the operator cannot be called

    Read the article

  • Iterator for second to last element in a list

    - by BSchlinker
    I currently have the following for loop: for(list<string>::iterator jt=it->begin(); jt!=it->end()-1; jt++) I have a list of strings which is in a larger list (list<list<string> >). I want to loop through the contents of the innerlist until I get to the 2nd to last element. This is because I have already processed the contents of the final element, and have no reason to process them again. However, using it->end()-1 is invalid -- I cannot use the - operator here. While I could use the -- operator, this would decrement this final iterator on each cycle. I believe a STL list is a doubly linked list, so from my perspective, it should be possible to do this. Advice? Thanks in advance

    Read the article

  • Help translating Reflector deconstruction into compilable code

    - by code poet
    So I am Reflector-ing some framework 2.0 code and end up with the following deconstruction fixed (void* voidRef3 = ((void*) &_someMember)) { ... } This won't compile due to 'The right hand side of a fixed statement assignment may not be a cast expression' I understand that Reflector can only approximate and generally I can see a clear path but this is a bit outside my experience. Question: what is Reflector trying to describe to me? Update: Am also seeing the following fixed (IntPtr* ptrRef3 = ((IntPtr*) &this._someMember)) Update: So, as Mitch says, it is not a bitwise operator, but an addressOf operator. Question is now: fixed (IntPtr* ptrRef3 = &_someMember) fails with an 'Cannot implicitly convert type 'xxx*' to 'System.IntPtr*'. An explicit conversion exists (are you missing a cast?)' compilation error. So I seemed to be damned if I do and damned if I dont. Any ideas?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • NHibernate - define where condition

    - by t.kehl
    Hi. In my application the user can defines search-conditions. He can choose a column, set an operator (equals, like, greater than, less or equal than, etc.) and give in the value. After the user clicks on a button and the application should do a search on the database with the condition. I use NHibernate and ask me now, what is the efficientest way to do this with NHibernate. Should I create a query with it like (Column=Name, Operator=Like, Value=%John%) var a = session.CreateCriteria<Customer>(); a.Add(Restrictions.Like("Name", "%John%")); return a.List<Customer>(); Or should I do this with HQL: var q = session.CreateQuery("from Customer where " + where); return q.List<Customer >(); Or is there a more bether solution? Thanks for your help. Best Regards, Thomas

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Aquamacs and IDLWAVE

    - by nicolavianello
    I've just installed the new Aquamacs 2.0 in my Mac Os X 10.6.3 and I'm an happy user of IDLWAVE on Aquamacs for programming in IDL. Unfortunately I run into a problem which I can't understand. I used in my configuration file to put the following (setq idlwave-surround-by-blank t) for the beautiful space around operator. This used to work till Aquamacs 2.0 preview b3 (third beta release) from that on, it stops to work and every time I type an operator (the same for '=' '<' '' etc) I got the following message Debugger entered--Lisp error: (void-variable idlwave-expand-equal) (lambda nil (interactive) (self-insert-command 1) idlwave-expand- equal -1 -1)() call-interactively((lambda nil (interactive) (self-insert-command 1) idlwave-expand-equal -1 -1) nil nil) Any help is welcommed

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • Silencing GCC warnings when using an "Uncopyable" class

    - by Kazade
    I have several classes that I don't want to be copyable, some of these classes have pointer data members. To make these classes uncopyable I privately inherit the following class template: template <class T> class Uncopyable { protected: Uncopyable() {} virtual ~Uncopyable() {} private: Uncopyable(const Uncopyable &); T & operator=(const T&); }; Which I used like so: class Entity : private Uncopyable<Entity> { } This works fine, however when I compile with -Weffc++ I still get the following warning: class Entity has pointer data members but does not override Entity(const Entity&) or operator=(const Entity&) Why is it still giving me this warning?

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • How to get this to compile?

    - by ShaChris23
    I have this code which compiles and works as expected: class Right {}; class Left { public: Left& operator = (Right const&) { //... Do something ... return *this; } }; int main() { Right right; Left left; // Assign individual object -- this works left = right; } But now, this one surprises me, I thought the template would work itself out since I already provided the = operator() to the Left class. int main() { ... std::list<Right> rightLst; std::list<Left> leftLst; // Assign a list of objects -- this doesn't compile leftLst = rightLst; } What can I do so that I could convert the rightLst to leftLst conversion in a single line?

    Read the article

< Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >