Search Results

Search found 40595 results on 1624 pages for 'string processing'.

Page 14/1624 | < Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • matrix image processing in OpenGL CE

    - by iHorse
    im trying to create an image filter in OpenGL CE. currently I am trying to create a series of 4x4 matrices and multiply them together. then use glColorMask and glColor4f to adjust the image accordingly. I've been able to integrate hue rotation, saturation, and brightness. but i am having trouble adding contrast. thus far google hasn't been to helpful. I've found a few matrices but they don't seem to work. do you guys have any ideas?

    Read the article

  • What image processing Library should I use

    - by Swippen
    I have been reading What is the best image manipulation library? And tried a few libraries and are now looking for inputs on what is the best for our need. I will start by describing our current setting and problems. We have a system that needs to resize and crop a large amount of images from big original images. We handle 50 000+ images every day on 2 powerfull servers. Today we use ImageGlue from WebSupergoo but we don't like it at all, it is slow and hangs the service now and then (Its in another unanswered stack overflow question). We have a threaded windows service that uses Microsoft ThreadPool to resize as much as possible on the 8 core machines. I have tried AForge and it went very well it was loads faster and never crashed or anything. But I had problems with quality on a few images. This due to what algorithms I used ofc so can be tweaked. But want to widen our eyes to see if thats the right way to go. so: It needs to be c# .net and run in a windows service. (Since we wont change the rest of the service only image handling) It needs to handle threaded environment well. We have a great need of it being fast since today its too slow. But we also want good quality and small filesize since the images are later displayed on webpage with loads of visitors and needs good quality. So we have a lot of demands on ability to get god quality at a fast pace, and also secondary keep filesizes lowered even if that can be adjusted with compression a bit. Any comments or suggestions on what library to use?

    Read the article

  • matlab image processing 3d

    - by jaysean
    i have 100 b&w image of smthing.the probllem is i want to scan each image in 0&1 formatin mby n format and then place each image to one over one and again scan and save them in mbynby100 form. how i do this and from where i should start _jaysean

    Read the article

  • Image processing: smart solution for converting superixel (128x128 pixel) coordinates needed

    - by zhengtonic
    Hi, i am searching for a smart solution for this problem: A cancer ct picture is stored inside a unsigned short array (1-dimensional). I have the location information of the cancer region inside the picture, but the coordinates (x,y) are in superpixel (128x128 unsigned short). My task is to highlight this region. I already solved this one by converting superpixel coordinates into a offset a can use for the unsigned short array. It works fine but i wonder if there is a smarter way to solve this problem, since my solution needs 3 nested for-loops. Is it possible to access the ushort array "superpixelwise", so i can navigate the ushort array in superpixels. ... // i know this does no work ... just to give you an idea what i was thinking of ... typedef struct { unsigned short[128x128] } spix; spix *spixptr; unsigned short * bufptr = img->getBuf(); spixptr = bufptr; ... best regards, zhengtonic

    Read the article

  • how to apply an animation into a triangle(Processing)

    - by dc_ou
    I want to create a simple animation, that can only show in a specific area, such as triange. I already have the animation, a rotating picture. but I dont know how to put it into the triangle. the function texture() can only apply images into a specific area. is there other ways to do that? thx!

    Read the article

  • Make a loop that draws lines in processing

    - by theolc
    I have this piece of code, and i am wondering how to make a loop that will draw these lines... Every 50 pixels on the x-axis... I am curious as to how this can be done and would like to use a loop rather than manually drawing each line! The following is the code for the lines... Please any help would be much appreciated! //set sidewalk fill(255,255,255); rect(0,490,500,10); line(50,490,50,500); line(100,490,100,500); line(150,490,150,500); line(200,490,200,500); line(250,490,250,500); line(300,490,300,500); line(350,490,350,500); line(400,490,400,500); line(450,490,450,500);

    Read the article

  • image processing problem

    - by riyana
    i'm working on detecting shape of any object.i've a binary image where background is white pixels and foreground/object is black pixel. now i need to detect the shape of the area where there are black pixels.how can i do it?the shape may be of a man/car/box etc. plz help

    Read the article

  • image processing

    - by sam
    hi folks, i have some images..if these images are selected then it should generate another image which is the combination of all the selected images.. can anyone suggest as how to start with? thanks

    Read the article

  • AdvancedFormatProvider: Making string.format do more

    - by plblum
    When I have an integer that I want to format within the String.Format() and ToString(format) methods, I’m always forgetting the format symbol to use with it. That’s probably because its not very intuitive. Use {0:N0} if you want it with group (thousands) separators. text = String.Format("{0:N0}", 1000); // returns "1,000"   int value1 = 1000; text = value1.ToString("N0"); Use {0:D} or {0:G} if you want it without group separators. text = String.Format("{0:D}", 1000); // returns "1000"   int value2 = 1000; text2 = value2.ToString("D"); The {0:D} is especially confusing because Microsoft gives the token the name “Decimal”. I thought it reasonable to have a new format symbol for String.Format, "I" for integer, and the ability to tell it whether it shows the group separators. Along the same lines, why not expand the format symbols for currency ({0:C}) and percent ({0:P}) to let you omit the currency or percent symbol, omit the group separator, and even to drop the decimal part when the value is equal to the whole number? My solution is an open source project called AdvancedFormatProvider, a group of classes that provide the new format symbols, continue to support the rest of the native symbols and makes it easy to plug in additional format symbols. Please visit https://github.com/plblum/AdvancedFormatProvider to learn about it in detail and explore how its implemented. The rest of this post will explore some of the concepts it takes to expand String.Format() and ToString(format). AdvancedFormatProvider benefits: Supports {0:I} token for integers. It offers the {0:I-,} option to omit the group separator. Supports {0:C} token with several options. {0:C-$} omits the currency symbol. {0:C-,} omits group separators, and {0:C-0} hides the decimal part when the value would show “.00”. For example, 1000.0 becomes “$1000” while 1000.12 becomes “$1000.12”. Supports {0:P} token with several options. {0:P-%} omits the percent symbol. {0:P-,} omits group separators, and {0:P-0} hides the decimal part when the value would show “.00”. For example, 1 becomes “100 %” while 1.1223 becomes “112.23 %”. Provides a plug in framework that lets you create new formatters to handle specific format symbols. You register them globally so you can just pass the AdvancedFormatProvider object into String.Format and ToString(format) without having to figure out which plug ins to add. text = String.Format(AdvancedFormatProvider.Current, "{0:I}", 1000); // returns "1,000" text2 = String.Format(AdvancedFormatProvider.Current, "{0:I-,}", 1000); // returns "1000" text3 = String.Format(AdvancedFormatProvider.Current, "{0:C-$-,}", 1000.0); // returns "1000.00" The IFormatProvider parameter Microsoft has made String.Format() and ToString(format) format expandable. They each take an additional parameter that takes an object that implements System.IFormatProvider. This interface has a single member, the GetFormat() method, which returns an object that knows how to convert the format symbol and value into the desired string. There are already a number of web-based resources to teach you about IFormatProvider and the companion interface ICustomFormatter. I’ll defer to them if you want to dig more into the topic. The only thing I want to point out is what I think are implementation considerations. Why GetFormat() always tests for ICustomFormatter When you see examples of implementing IFormatProviders, the GetFormat() method always tests the parameter against the ICustomFormatter type. Why is that? public object GetFormat(Type formatType) { if (formatType == typeof(ICustomFormatter)) return this; else return null; } The value of formatType is already predetermined by the .net framework. String.Format() uses the StringBuilder.AppendFormat() method to parse the string, extracting the tokens and calling GetFormat() with the ICustomFormatter type. (The .net framework also calls GetFormat() with the types of System.Globalization.NumberFormatInfo and System.Globalization.DateTimeFormatInfo but these are exclusive to how the System.Globalization.CultureInfo class handles its implementation of IFormatProvider.) Your code replaces instead of expands I would have expected the caller to pass in the format string to GetFormat() to allow your code to determine if it handles the request. My vision would be to return null when the format string is not supported. The caller would iterate through IFormatProviders until it finds one that handles the format string. Unfortunatley that is not the case. The reason you write GetFormat() as above is because the caller is expecting an object that handles all formatting cases. You are effectively supposed to write enough code in your formatter to handle your new cases and call .net functions (like String.Format() and ToString(format)) to handle the original cases. Its not hard to support the native functions from within your ICustomFormatter.Format function. Just test the format string to see if it applies to you. If not, call String.Format() with a token using the format passed in. public string Format(string format, object arg, IFormatProvider formatProvider) { if (format.StartsWith("I")) { // handle "I" formatter } else return String.Format(formatProvider, "{0:" + format + "}", arg); } Formatters are only used by explicit request Each time you write a custom formatter (implementer of ICustomFormatter), it is not used unless you explicitly passed an IFormatProvider object that supports your formatter into String.Format() or ToString(). This has several disadvantages: Suppose you have several ICustomFormatters. In order to have all available to String.Format() and ToString(format), you have to merge their code and create an IFormatProvider to return an instance of your new class. You have to remember to utilize the IFormatProvider parameter. Its easy to overlook, especially when you have existing code that calls String.Format() without using it. Some APIs may call String.Format() themselves. If those APIs do not offer an IFormatProvider parameter, your ICustomFormatter will not be available to them. The AdvancedFormatProvider solves the first two of these problems by providing a plug-in architecture.

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • while installing kde 4.11 through terminal showing error while 'processing initramfs-tools'

    - by saptarshi nag
    the full output is------- Setting up initramfs-tools (0.103ubuntu0.2.1) ... update-initramfs: deferring update (trigger activated) Processing triggers for initramfs-tools ... update-initramfs: Generating /boot/initrd.img-3.5.0-42-generic cp: cannot stat ‘/module-files.d/libpango1.0-0.modules’: No such file or directory cp: cannot stat ‘/modules/pango-basic-fc.so’: No such file or directory E: /usr/share/initramfs-tools/hooks/plymouth failed with return 1. update-initramfs: failed for /boot/initrd.img-3.5.0-42-generic with 1. dpkg: error processing initramfs-tools (--configure): subprocess installed post-installation script returned error exit status 1 Errors were encountered while processing: initramfs-tools E: Sub-process /usr/bin/dpkg returned an error code (1)

    Read the article

  • apt-get install problem: Errors were encountered while processing: sun-j2sdk1.6

    - by pyeleven
    I have the following problem every time i run apt-get install: for example : installing python-django-south ... Unpacking python-django-south (from .../python-django-south_0.5-2_all.deb) ... Setting up sun-j2sdk1.6 (1.6.0+update22-linux-i586.) ... update-alternatives: error: alternative path /usr/lib/j2sdk1.6-sun/jre/plugin/amd64/ns7/libjavaplugin_oji.so doesn't exist. dpkg: error processing sun-j2sdk1.6 (--configure): subprocess installed post-installation script returned error exit status 2 Setting up python-django-south (0.5-2) ... Processing triggers for python-support ... Errors were encountered while processing: sun-j2sdk1.6 E: Sub-process /usr/bin/dpkg returned an error code (1) What could be the problem? I have 9.10 Ubuntu

    Read the article

  • java: decoding URI query string

    - by Jason S
    I need to decode a URI that contains a query string; expected input/output behavior is something like the following: abstract class URIParser { /** example input: * something?alias=pos&FirstName=Foo+A%26B%3DC&LastName=Bar */ URIParser(String input) { ... } /** should return "something" for the example input */ public String getPath(); /** should return a map * {alias: "pos", FirstName: "Foo+A&B=C", LastName: "Bar"} */ public Map<String,String> getQuery(); } I've tried using java.net.URI, but it seems to decode the query string so in the above example I'm left with "alias=pos&FirstName=Foo+A&B=C&LastName=Bar" so there is ambiguity whether a "&" is a query separator or is a character in a query component. edit: just tried URI.getRawQuery() and it doesn't do the encoding, so I can split the query string with a "&", but then what do I do? Any suggestions?

    Read the article

  • Java: Print and access List <String[]>

    - by battousai622
    Im reading in a file and storing it in t1. How do i access the elements in t1? When i try to print it i get addresses instead of values. Also whats the dif between string and string[]? CSVReader reader = new CSVReader(new FileReader("src/new_acquisitions.csv")); List <String[]> t1 = reader.readAll(); int i = 0 while(i < t1.size()) { System.out.println(t1.get(i)); i++; } output: [Ljava.lang.String;@9304b1 [Ljava.lang.String;@190d11 [Ljava.lang.String;@a90653 [Ljava.lang.String;@de6ced

    Read the article

  • return new string vs .ToString()

    - by Leroy Jenkins
    Take the following code: public static string ReverseIt(string myString) { char[] foo = myString.ToCharArray(); Array.Reverse(foo); return new string(foo); } I understand that strings are immutable, but what I dont understand is why a new string needs to be called return new string(foo); instead of return foo.ToString(); I have to assume it has something to do with reassembling the CharArray (but thats just a guess). Whats the difference between the two and how do you know when to return a new string as opposed to returning a System.String that represents the current object?

    Read the article

  • Formatting a string in Java using class attributes

    - by Jason R. Coombs
    I have a class with an attribute and getter method: public Class MyClass { private String myValue = "foo"; public String getMyValue(); } I would like to be able to use the value of foo in a formatted string as such: String someString = "Your value is {myValue}." String result = Formatter.format(someString, new MyClass()); // result is now "Your value is foo." That is, I would like to have some function like .format above which takes a format string specifying properties on some object, and an instance with those properties, and formats the string accordingly. Is it possible to do accomplish this feat in Java?

    Read the article

  • Only show items owned by the currently logged in user in category list view

    - by jalbasri
    I'd like to be able to provide a "Category List" view that only shows Articles that the currently logged in user owns. Is there somewhere I can edit the query used to populate the Category List view or an extension that provides this functionality. Thank you for any help you can provide. -J. Thank you for your answer. I've written the plugin. Instead of passing in an array of Articles the onContentBeforeDisplay function is called for every article and an ArrayObject of the single article gets passed in. I've been able to identify the articles I want not to be displayed but still cannot get them not to display. The $params variable has values such as "list_show_xxx" but I can't seem to change or access them. here is a var_dump($params): object(Joomla\Registry\Registry)#190 (1) { ["data":protected]=> object(stdClass)#250 (83) { ["article_layout"]=> string(9) "_:default" ["show_title"]=> string(1) "1" ["link_titles"]=> string(1) "1" ["show_intro"]=> string(1) "1" ["info_block_position"]=> string(1) "1" ["show_category"]=> string(1) "1" ["link_category"]=> string(1) "1" ["show_parent_category"]=> string(1) "0" ["link_parent_category"]=> string(1) "0" ["show_author"]=> string(1) "1" ["link_author"]=> string(1) "0" ["show_create_date"]=> string(1) "0" ["show_modify_date"]=> string(1) "0" ["show_publish_date"]=> string(1) "1" ["show_item_navigation"]=> string(1) "1" ["show_vote"]=> string(1) "0" ["show_readmore"]=> string(1) "1" ["show_readmore_title"]=> string(1) "1" ["readmore_limit"]=> string(3) "100" ["show_tags"]=> string(1) "1" ["show_icons"]=> string(1) "1" ["show_print_icon"]=> string(1) "1" ["show_email_icon"]=> string(1) "1" ["show_hits"]=> string(1) "1" ["show_noauth"]=> string(1) "0" ["urls_position"]=> string(1) "0" ["show_publishing_options"]=> string(1) "0" ["show_article_options"]=> string(1) "0" ["save_history"]=> string(1) "1" ["history_limit"]=> int(10) ["show_urls_images_frontend"]=> string(1) "0" ["show_urls_images_backend"]=> string(1) "1" ["targeta"]=> int(0) ["targetb"]=> int(0) ["targetc"]=> int(0) ["float_intro"]=> string(4) "left" ["float_fulltext"]=> string(4) "left" ["category_layout"]=> string(9) "_:default" ["show_category_heading_title_text"]=> string(1) "1" ["show_category_title"]=> string(1) "0" ["show_description"]=> string(1) "0" ["show_description_image"]=> string(1) "0" ["maxLevel"]=> string(1) "1" ["show_empty_categories"]=> string(1) "0" ["show_no_articles"]=> string(1) "1" ["show_subcat_desc"]=> string(1) "1" ["show_cat_num_articles"]=> string(1) "0" ["show_base_description"]=> string(1) "1" ["maxLevelcat"]=> string(2) "-1" ["show_empty_categories_cat"]=> string(1) "0" ["show_subcat_desc_cat"]=> string(1) "1" ["show_cat_num_articles_cat"]=> string(1) "1" ["num_leading_articles"]=> string(1) "1" ["num_intro_articles"]=> string(1) "4" ["num_columns"]=> string(1) "1" ["num_links"]=> string(1) "4" ["multi_column_order"]=> string(1) "0" ["show_subcategory_content"]=> string(1) "0" ["show_pagination_limit"]=> string(1) "1" ["filter_field"]=> string(5) "title" ["show_headings"]=> string(1) "1" ["list_show_date"]=> string(1) "0" ["date_format"]=> string(0) "" ["list_show_hits"]=> string(1) "1" ["list_show_author"]=> string(1) "1" ["orderby_pri"]=> string(5) "order" ["orderby_sec"]=> string(5) "rdate" ["order_date"]=> string(9) "published" ["show_pagination"]=> string(1) "2" ["show_pagination_results"]=> string(1) "1" ["show_feed_link"]=> string(1) "1" ["feed_summary"]=> string(1) "0" ["feed_show_readmore"]=> string(1) "0" ["display_num"]=> string(2) "10" ["menu_text"]=> int(1) ["show_page_heading"]=> int(0) ["secure"]=> int(0) ["page_title"]=> string(16) "Non-K2 News List" ["page_description"]=> string(33) "Bahrain Business Incubator Centre" ["page_rights"]=> NULL ["robots"]=> NULL ["access-edit"]=> bool(true) ["access-view"]=> bool(true) } } I've tried $params-data-list_show_author = "0" but then the page doesn't load, problem is accessing and changing the variables in $param. So the last step is to figure out how not to show the article. Any ideas?

    Read the article

  • PHP strip_tags only at the end of the string

    - by Solomon Closson
    Ok, well, I just want to use strip_tags function on the very end of a string to get rid of any <br /> tags. Here's what I have now, but this is no good because it strips these tags from everywhere in the string, which is not what I want. I only need them stripped out if it's at the end of the string... $string = strip_tags($string, strtr($string, array('<br />' => '&#10;'))); How can I do this same thing, except only at the very end of a string?? Thanks guys!!

    Read the article

  • Parsing String to TreeNode

    - by Krusu70
    Anyone have a good algorithm how to parse a String to TreeNode in Java? Let's say we have a string s which says how to build a TreeNode. A(B,C) means that A is the name (String) of TreeNode, B is child of A (Treenode), C is sibling of A (TreeNode). So if I call function with string A(B(D,E(F,G)),C) (just a example), then I get a TreeNode equals to: level A (String: name), B - Child (TreeNode), C - Sibling (TreeNode) level B (String: name), D - Child of B (TreeNode), E - Sibling of B (TreeNode) level E (String: name), F - Child of E (TreeNode), G - Sibling of E (TreeNode) The name may not be 1 letter, it could be like real name (many letters).

    Read the article

< Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >