Search Results

Search found 10005 results on 401 pages for 'regex trouble'.

Page 140/401 | < Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • extracting multiple fields from a text file using php

    - by Dave
    Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • How can I improve this regular expression?

    - by Michael Haren
    I want a regular expression to match valid input into a Tags input field with the following properties: 1-5 tags Each tag is 1-30 characters long Valid tag characters are [a-zA-Z0-9-] input and tags can be separated by any amount of whitespace Here's what I have so far--it seems to work but I'm interested how it could be simplified or if it has any major flaws: \s*[a-zA-Z0-9-]{1,30}(\s+[a-zA-Z0-9-]{1,30}){0,4}\s* // that is: \s* // match all beginning whitespace [a-zA-Z0-9-]{1,30} // match the first tag (\s+[a-zA-Z0-9-]{1,30}){0,4} // match all subsequent tags \s* // match all ending whitespace Preprocessing the input to make the whitespace issue easier isn't an option (e.g. trimming or adding a space). If it matters, this will be used in javascript. Any suggestions would be appreciated, thanks!

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • PHP: Is_numeric returns false on 0

    - by Industrial
    Hi everyone, Is_numeric() as well as is_int() returns false if the value is 0. What can i do instead to verify that a specific value is numbers only in PHP? Are we heading straight for the Regular Expressions camp, or are there some nice, handy feature for this out there already? Thanks!

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • Need some help setting up subdomains for my site

    - by KarimSaNet
    I'm setting up my website and want to have it so all subdomain requests are rewritten to the appropriate subdirectory. For example http://projects.karimsa.net/ -> http://karimsa.net/projects/ But I want to use the Apache rewrite mod to do this so that the URL in the browser stays the same. Here is what my config looks like at the moment: ## rewrite subdomains RewriteEngine On RewriteCond %{HTTP_HOST} ^(.*).karimsa.net RewriteCond %{HTTP_HOST} !^www.karimsa.net [NC] RewriteRule ^(.*)$ http://karimsa.net/%1/$1 [R=301,L] And my CNAME records on 'projects.karimsa.net': Domain TTL Data Type projects.karimsa.net 14400 karimsa.net CNAME Theoretically, I feel this should work. But when I go to the URL, it gives me a server misconfiguration error, my provider's default webpage. What I should see is the index.php under /projects/. What am I doing wrong? Any help would be appreciated, thanks for reading. Addition: I realized I forgot to mention some of the problem. The domain 'karimsa.net' is parked at 'karimsa.x10.mx'. If I set up the same configuration on 'projects.karimsa.x10.mx', the rewrite and CNAME work. But on the parked domain I still get the default webpage.

    Read the article

  • Regular expression one or more times JAVA

    - by user1381564
    Hi i am trying to match a string against a pattern this is the possible string signal CS, NS, dl: stateType := writeOrRead0; signal CS, pS : stateType := writeOrRead0; signal dS : stateType := writeOrRead0; i am only concerned with the pattern as far as the first colon. but the number of signals define can be more than one it could be three or four even this is the regular expression i have ^signal\\s*(\\w+),*\\s*(\\w+)\\s*: it will pick up the second two signal but and for the second one it picks up CS and pS and but the d and S in the next signal when i use matcher.group() come up seperately Can anyone give me an expression that will pick up all signal names whether there is one two three or more?

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • mine phrases (up to 3 words) from a given text

    - by DS_web_developer
    I asked before for a simple solution to my problem (using sphinx search service) but I got nowhere... someone has kindly provided me with this code <?php /** * $Project: GeoGraph $ * $Id$ * * GeoGraph geographic photo archive project * This file copyright (C) 2005 Barry Hunter ([email protected]) * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. */ /** * Provides the methods for updating the worknet tables * * @package Geograph * @author Barry Hunter <[email protected]> * @version $Revision$ */ function addTwoLetterPhrase($phrase) { global $w2; $w2[$phrase] = (isset($w2[$phrase]))?($w2[$phrase]+1):1; } function addThreeLetterPhrase($phrase) { global $w3; $w3[$phrase] = (isset($w3[$phrase]))?($w3[$phrase]+1):1; } function updateWordnet(&$db,$text,$field,$id) { global $w1,$w2,$w3; $alltext = strtolower(preg_replace('/\W+/',' ',str_replace("'",'',$text))); if (strlen($text)< 1) return; $words = preg_split('/ /',$alltext); $w1 = array(); $w2 = array(); $w3 = array(); //build a list of one word phrases foreach ($words as $word) { $w1[$word] = (isset($w1[$word]))?($w1[$word]+1):1; } //build a list of two word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); //build a list of three word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+) (\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); foreach ($w1 as $word=>$count) { $db->Execute("insert into wordnet1 set gid = $id,words = '$word',$field = $count");// ON DUPLICATE KEY UPDATE $field=$field+$count"); } foreach ($w2 as $word=>$count) { $db->Execute("insert into wordnet2 set gid = $id,words = '$word',$field = $count"); } foreach ($w3 as $word=>$count) { $db->Execute("insert into wordnet3 set gid = $id,words = '$word',$field = $count"); } } ?> It works fine and does almost exactly what I need....... except.... it is not utf8 friendly... I mean... it splits whole words into parts (on special chars) where it shouldn't! so my guess is I should use multibyte functions instead of regular preg_replace... I tried to replace preg_replace with mb_ereg_replace but it is not working as it should... at least not for 2 and 3 words phrases any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Match Phrases (in array) in text string

    - by Tim Hanssen
    I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • [Qt] Check octal number

    - by sterh
    Hello, I write simple application in C++/Qt. And i have a text and some octal number in it. My app splits this text by spaces. And i need to check octal numbers from text. How can i select octal numbers from this text with regular expressions? Thank you.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

< Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >