Search Results

Search found 5554 results on 223 pages for 'cool cs'.

Page 142/223 | < Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >

  • How do you manually insert options into boost.Program_options?

    - by windfinder
    I have an application that uses Boost.Program_options to store and manage its configuration options. We are currently moving away from configuration files and using database loaded configuration instead. I've written an API that reads configuration options from the database by hostname and instance name. (cool!) However, as far as I can see there is no way to manually insert these options into the boost Program_options. Has anyone used this before, any ideas? The docs from boost seem to indicate the only way to get stuff in that map is by the store function, which either reads from the command line or config file (not what I want). Basically looking for a way to manually insert the DB read values in to the map.

    Read the article

  • How can I get Facebook Profile image from email?

    - by Forbini
    There's an outlook plugin called Xobni that has a really cool feature, if a contact has an email address, it will fetch that contact's profile picture and display it. Their FAQ states the following: Xobni sends an encrypted email address to Facebook to retrieve the Facebook profile for the person who is currently being viewed in the Xobni sidebar. Your own Facebook profile is never altered by Xobni, and all Facebook privacy settings are strictly followed when viewing other profiles. I'd like to duplicate this functionality. However, I can't figure out which API call they're using. I'm assuming when they say "encrypted email address" that's laymen's terms for the email hash. Once a username is derived, the graph api looks ideal for actually fetching the image, but I'm having trouble going from email hash to profile ID.

    Read the article

  • Visual Studio swapping code between projects?!?!?!?!??!

    - by Tom
    Are there any known issues with visual studio and code being swapped between projects? I had a project running in VS2008 and when i went back to it, the code from another project had been swapped in the Program.cs class. I havent made any mistakes, im not talking about some code- i mean the whole project had been swapped out. Its as if the .proj files or .soln files had been swapped from their project folders??? EDIT Ive restarted laptop, opened the code again and its still showing the wrong code BUT when i execute it, its the right code?!?!?!

    Read the article

  • How does youtube enable ascii videos?

    - by acidzombie24
    Just by messing around a little it seems that the video stream is not ascii. i tested by downloading the stream. It would be insane if it was. Theres so many videos. So that couldnt be it. Youtube seems to not work with javascript disable (not counting mobile if true). How is it being done? is it javascript magic? is the SWF running the video through a filter in realtime? (I doubt its a native filter so how is the filter compiled) its really cool. I cant imagine how this is running realtime yet it is!

    Read the article

  • can a program written in C be faster than one written in OCaml and translated to C?

    - by Ole Jak
    So I have some cool Image Processing algorithm. I have written it in OCaml. It performs well. I now I can compile it as C code with such command ocamlc -output-obj -o foo.c foo.ml (I have a situation where I am not alowed to use OCaml compiler to bild my programm for my arcetecture, I can use only specialy modified gcc. so I will compile that programm with sometyhing like gcc -L/usr/lib/ocaml foo.c -lcamlrun -lm -lncurses and Itll run on my archetecture.) I want to know in general case can a program written in C be faster than one written in OCaml and translated to C?

    Read the article

  • How is the implicit segment register of a near pointer determined?

    - by Daniel Trebbien
    In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

    Read the article

  • Example applications and benefits of using "C" , "C++" or "Java"

    - by Waltzy
    Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

    Read the article

  • .NET: Get all Outlook calendar items

    - by Qinnie
    How can I get all items from a specific calendar (for a specific date). Lets say for instance that I have a calendar with a recurring item every Monday evening. When I request all items like this: CalendarItems = CalendarFolder.Items; CalendarItems.IncludeRecurrences = true; I only get 1 item... Is there an easy way to get all items (main item + derived items) from a calendar? In my specific situation it can be possible to set a date limit but it would be cool just to get all items (my recurring items are time limited themselves). I'm using the Microsoft Outlook 12 Object library (Microsoft.Office.Interop.Outlook).

    Read the article

  • Method to register method to be called when event is raised

    - by zaidwaqi
    I have a Panel which contains 20 PictureBox controls. If a user clicks on any of the controls, I want a method within the Panel to be called. How do I do this? public class MyPanel : Panel { public MyPanel() { for(int i = 0; i < 20; i++) { Controls.Add(new PictureBox()); } } // DOESN'T WORK. // function to register functions to be called if the pictureboxes are clicked. public void RegisterFunction( <function pointer> func ) { foreach ( Control c in Controls ) { c.Click += new EventHandler( func ); } } } How do I implement RegisterFunction()? Also, if there are cool C# features that can make the code more elegant, please share.

    Read the article

  • avoid caching of page in browser

    - by Shan
    I am using an iframe to show the child pages.In that one one particular page contains hidden div and i am showing it as a pop-up like thing with javascript by changing the visibility of the hidden div. Problem is before showing the hidden div , some manipulations are done at server level and I am calling the div from C# code after the manipulations like Page.ClientScript.RegisterStartupScript(GetType(), "MyKey", "javascript:OpenModelPopup('cb','cs');", true); so the page is getting posted back and the div is shown. after this, after going to next page if i click browser back it shows that page with that hidden div and on next click of browser back gives the page without hidden div. but I want to show only the initial stage of the page ie. without showing the hidden div that stage with hidden div should not be cached or it should not be shown on click of browser back.

    Read the article

  • issue with c# xml documentation

    - by galford13x
    I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

    Read the article

  • Netbeans Intellisense for Rails

    - by irishfury
    Has anybody figured out a way to make the Netbeans intellisense for ruby and rails better? It either has too many options in the list (which I understand is a problem since it is a dynamic language). Or it has no options in the list, as if it is not dynamic enough to find everything. Are there any hacks to make it better, or is this just something that needs to be improved within the Netbeans source code? I'm currently using 6.8. Please spare me the posts about how I don't really need to use intellisense, and I should use vim or emacs. I'm sure the vim programmers are 10 times more productive than me with all their cool shortcuts, but I have no desire to learn these tools.

    Read the article

  • TFS: how to change custom field allowed values

    - by Budda
    I have my custom field of string type with predefined set of values: "1 - Cool", "2 - Good", "3 - Average",... Now it is necessary to remove "2 - Good" value and rename "3 - Average" into "2 - Average". I see easy solution: just delete 2 existing "2 - Good" and "3 - Average" and create the new "2 - Average". Question: Q1: What will happens with issues that contain values to be deleted? Probably, system won't accept such work item change? Q2: What is a good approach to do what I need? Thanks a lot! Any thoughts are welcome!

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to change Session for only one route in asp.net mvc?

    - by denis_n
    How to handle Application_BeginRequest using a custom filter in asp.net mvc? I want to restore session only for one route (~/my-url). It would be cool, if I could create a custom filter and handle that. protected void Application_BeginRequest(object sender, EventArgs e) { var context = HttpContext.Current; if (string.Equals("~/my-url", context.Request.AppRelativeCurrentExecutionFilePath, StringComparison.OrdinalIgnoreCase)) { string sessionId = context.Request.Form["sessionId"]; if (sessionId != null) { HttpCookie cookie = context.Request.Cookies.Get("ASP.NET_SessionId"); if (cookie == null) { cookie = new HttpCookie("ASP.NET_SessionId"); } cookie.Value = sessionId; context.Request.Cookies.Set(cookie); } }

    Read the article

  • Programmatically set browser cookie (Firefox)

    - by Andrew
    I know from this question that Firefox 3.0 and up stores its cookies in an SQLite database. My question is: can you access this database from other desktop programs in such a way that you could add a cookie? I realize this has security implications. However, I do not want to read them at all. I want to be able to set one cookie if possible. I don't even want to overwrite a cookie. I just want to add it if it isn't there already. This is sort of a personal project I'm working on for fun. This question is mostly language agnostic. I would prefer a solution in C#, but proof of concept in any language will suffice. Extra credit: It would be cool to set the same cookie in Internet Explorer, too

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • Is there a way to test if a scalar has been stringified or not?

    - by Yobert
    I am writing a thing to output something similar to JSON, from a perl structure. I want the quoting to behave like this: "string" outputs "string" "05" outputs "05" "5" outputs "5" 5 outputs 5 05 outputs 5, or 05 would be acceptable JSON::XS handles this by testing if a scalar has been "stringified" or not, which I think is very cool. But I can't find a way to do this test myself without writing XS, which I'd rather avoid. Is this possible? I can't find this anywhere on CPAN without finding vast pedantry about Scalar::Util::looks_like_number, etc which completely isn't what I want. The only stopgap I can find is Devel::Peek, which feels evil. And also, just like JSON::XS, I'm fine with this secenario: my $a = 5; print $a."\n"; # now $a outputs "5" instead of 5)

    Read the article

  • SiteCore 6.5 - GeneralLink

    - by Steve Ward
    Im new to SiteCore.. I have created a Page template and add a field for a URL of type General Link. I have created another field for the text for the link (this is standard practice in this project). I simply want to display the link in my user control but I just cant get it to work. This should be simple but Im going round in circles Here's an example of the code I've tried .. ascx : ascx.cs: lnkMain.NavigateUrl = SiteCore.Context.Item.GetGeneralLink("Link1"); lnkMain.Text = item.GetFieldValue("Link1Text");

    Read the article

  • Anyone plotting SO via code_swarm?

    - by Tim Post
    Is anyone working on something to render individual questions, or SO as a whole with codeswarm? If so, can you post a link to your work that transforms SO questions into revisions that codeswarm can understand (i.e. svn?) It would be really, really cool to see SO played (as a whole) via codeswarm, so I hope to not only ask if anyone is working it, but see if anyone is interested in trying to accomplish it. Augmenting that, will database dumps be made available? EDIT: Database dumps have since been made available :) Enough with user voice, is anyone doing it? If so, what VCS did you mock?

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • How to copy a structure with pointers to data inside (so to copy pointers and data they point to)?

    - by Kabumbus
    so I have a structure like struct GetResultStructure { int length; char* ptr; }; I need a way to make a full copy of it meaning I need a copy to have a structure with new ptr poinnting on to copy of data I had in original structure. Is It any how possible? I mean any structure I have which contains ptrs will have some fields with its lengths I need a function that would copy my structure coping all ptrs and data they point to by given array of lengthes... Any cool boost function for it? Or any way how to create such function?

    Read the article

  • Thread 0 crashed with X86 Thread State (32-bit): in cocoa Application

    - by John
    I am doing crash fixing in an osx application .The crash report shows Date/Time: 2012-05-01 16:05:58.004 +0200 OS Version: Mac OS X 10.5.8 (9L31a) Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000000545f5f00 Crashed Thread: 8 Thread 8 crashed with X86 Thread State (32-bit): eax: 0x140e0850 ebx: 0x00060fc8 ecx: 0x92df0ec0 edx: 0xc0000003 edi: 0x545f5f00 esi: 0x140e0870 ebp: 0xb0445988 esp: 0xb0445964 ss: 0x0000001f efl: 0x00010206 eip: 0x92dca68c cs: 0x00000017 ds: 0x0000001f es: 0x0000001f fs: 0x0000001f gs: 0x00000037 cr2: 0x545f5f00 How to tares the application code with this report? what is Thread 0 crashed with X86 Thread State (32-bit)? if anybody know please help me. Thanks in advance.

    Read the article

< Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >