Search Results

Search found 16329 results on 654 pages for 'b long'.

Page 144/654 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Match subpatterns in any order

    - by Yaroslav
    I have long regexp with two complicated subpatters inside. How i can match that subpatterns in any order? Simplified example: /(apple)?\s?(banana)?\s?(orange)?\s?(kiwi)?/ and i want to match both of apple banana orange kiwi apple orange banana kiwi It is very simplified example. In my case banana and orange is long complicated subpatterns and i don't want to do something like /(apple)?\s?((banana)?\s?(orange)?|(orange)?\s?(banana)?)\s?(kiwi)?/ Is it possible to group subpatterns like chars in character class? UPD Real data as requested: 14:24 26,37 Mb 108.53 01:19:02 06.07 24.39 19:39 46:00 my strings much longer, but it is significant part. Here you can see two lines what i need to match. First has two values: length (14 min 24 sec) and size 26.37 Mb. Second one has three values but in different order: size 108.53 Mb, length 01 h 19 m 02 s and date June, 07 Third one has two size and length Fourth has only length There are couple more variations and i need to parse all values. I have a regexp that pretty close except i can't figure out how to match patterns in different order without writing it twice. (?<size>\d{1,3}\[.,]\d{1,2}\s+(?:Mb)?)?\s? (?<length>(?:(?:01:)?\d{1,2}:\d{2}))?\s* (?<date>\d{2}\.\d{2}))? NOTE: that is only part of big regexp that forks fine already.

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How safe and reliable are C++ String Literals?

    - by DoctorT
    So, I'm wanting to get a better grasp on how string literals in C++ work. I'm mostly concerned with situations where you're assigning the address of a string literal to a pointer, and passing it around. For example: char* advice = "Don't stick your hands in the toaster."; Now lets say I just pass this string around by copying pointers for the duration of the program. Sure, it's probably not a good idea, but I'm curious what would actually be going on behind the scenes. For another example, let's say we make a function that returns a string literal: char* foo() { // function does does stuff return "Yikes!"; // somebody's feeble attempt at an error message } Now lets say this function is called very often, and the string literal is only used about half the time it's called: // situation #1: it's just randomly called without heed to the return value foo(); // situation #2: the returned string is kept and used for who knows how long char* retVal = foo(); In the first situation, what's actually happening? Is the string just created but not used, and never deallocated? In the second situation, is the string going to be maintained as long as the user finds need for it? What happens when it isn't needed anymore... will that memory be freed up then (assuming nothing points to that space anymore)? Don't get me wrong, I'm not planning on using string literals like this. I'm planning on using a container to keep my strings in check (probably std::string). I'm mostly just wanting to know if these situations could cause problems either for memory management or corrupted data.

    Read the article

  • Python FTP grabbing and saving images issue

    - by PylonsN00b
    OK So I have been messing with this all day long. I am fairly new to Python FTP. So I have searched through here and came up w/ this: images = notions_ftp.nlst() for image_name in image_names: if found_url == False: try: for image in images: ftp_image_name = "./%s" % image_name if ftp_image_name == image: found_url = True image_name_we_want = image_name except: pass # We failed to find an image for this product, it will have to be done manually if found_url == False: log.info("Image ain't there baby -- SKU: %s" % sku) return False # Hey we found something! Open the image.... notions_ftp.retrlines("RETR %s" % image_name_we_want, open(image_name_we_want, "rb")) 1/0 So I have narrowed the error down to the line before I divide by zero. Here is the error: Traceback (most recent call last): File "<console>", line 6, in <module> File "<console>", line 39, in insert_image IOError: [Errno 2] No such file or directory: '411483CC-IT,IM.jpg' So if you follow the code you will see that the image IS in the directory because image_name_we_want is set if found in that directory listing on the first line of my code. And I KNOW it's there because I am looking at the FTP site myself and ...it's freakin there. So at some point during all of this I got the image to save locally, which is most desired, but I have long since forgot what I used to make it do that. Either way, why does it think that the image isn't there when it clearly finds it in the listing.

    Read the article

  • Select statement with multiple 'where' fields using same value without duplicating text

    - by kdbdallas
    I will start by saying that I don't think what I want can be done, but that said, I am hoping I am wrong and someone knows more than me. So here is your chance... Prove you are smarter than me :) I want to do a search against a SQLite table looking for any records that "are similar" without having to write out the query in long hand. To clarify this is how I know I can write the query: select * from Articles where title like '%Bla%' or category like '%Bla%' or post like '%Bla%' This works and is not a huge deal if you are only checking against a couple of columns, but if you need to check against a bunch then your query can get really long and nasty looking really fast, not to mention the chance for typos. (ie: 'Bla%' instead of '%Bla%') What I am wondering is if there is a short hand way to do this? *This next code does not work the way I want, but just shows kind of what I am looking for select * from Articles where title or category or post like '%Bla%' Anyone know if there is a way to specify that multiple 'where' columns should use the same search value without listing that same search value for every column? Thanks in advance!

    Read the article

  • Not loading associations without proxies in NHibernate

    - by Alice
    I don't like the idea of proxy and lazy loading. I don't need that. I want pure POCO. And I want to control loading associations explicitly when I need. Here is entity public class Post { public long Id { get; set; } public long OwnerId { get; set; } public string Content { get; set; } public User Owner { get; set; } } and mapping <class name="Post"> <id name="Id" /> <property name="OwnerId" /> <property name="Content" /> <many-to-one name="Owner" column="OwnerId" /> </class> However if I specify lazy="false" in the mapping, Owner is always eagerly fetched. I can't remove many-to-one mapping because that also disables explicit loading or a query like from x in session.Query<Comment>() where x.Owner.Title == "hello" select x; I specified lazy="true" and set use_proxy_validator property to false. But that also eager loads Owner. Is there any way to load only Post entity?

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • Drawing an image in Java, slow as hell on a netbook.

    - by Norswap
    In follow-up to my previous questions (especially this one : http://stackoverflow.com/questions/2684123/java-volatileimage-slower-than-bufferedimage), i have noticed that simply drawing an Image (it doesn't matter if it's buffered or volatile, since the computer has no accelerated memory*, and tests shows it's doesn't change anything), tends to be very long. (*) System.out.println(GraphicsEnvironment.getLocalGraphicsEnvironment() .getDefaultScreenDevice().getAvailableAcceleratedMemory()); --> 0 How long ? For a 500x400 image, about 0.04 seconds. This is only drawing the image on the backbuffer (obtained via buffer strategy). Now considering that world of warcraft runs on that netbook (tough it is quite laggy) and that online java games seems to have no problem whatsoever, this is quite thought provoking. I'm quite certain I didn't miss something obvious, I've searched extensively the web, but nothing will do. So do any of you java whiz have an idea of what obscure problem might be causing this (or maybe it is normal, tough I doubt it) ? PS : As I'm writing this I realized this might be cause by my Linux installation (archlinux) tough I have the correct Intel driver. But my computer normally has "Integrated Intel Graphics Media Accelerator 950", which would mean it should have accelerated video memory somehow. Any ideas about this side of things ?

    Read the article

  • Runnable to be run every second only runs once in Fragment onCreateView()

    - by jul
    I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

    Read the article

  • Can a WebServiceHost be changed to avoid the use of HttpListener?

    - by sbyse
    I am looking for a way to use a WCF WebServiceHost without having to rely on the HttpListener class and it's associated permission problems (see this question for details). I'm working on a application which communicates locally with another (third-party) application via their REST API. At the moment we are using WCF as an embedded HTTP server. We create a WebServiceHost as follows: String hostPath = "http://localhost:" + portNo; WebServiceHost host = new WebServiceHost(typeof(IntegrationService), new Uri(hostPath)); // create a webhttpbinding for rest/pox and enable cookie support for session management WebHttpBinding webHttpBinding = new WebHttpBinding(); webHttpBinding.AllowCookies = true; ServiceEndpoint ep = host.AddServiceEndpoint(typeof(IIntegrationService), webHttpBinding, ""); host.Open() ChannelFactory<IIntegrationService> cf = new ChannelFactory<IIntegrationService>(webHttpBinding, hostPath); IIntegrationService channel = cf.CreateChannel(); Everything works nicely as long as our application is run as administrator. If we run our application on a machine without administrative privileges the host.Open() will throw an HttpListenerException with ErrorCode == 5 (ERROR_ACCESS_DENIED). We can get around the problem by running httpcfg.exe from the command line but this is a one-click desktop application and that's not really as long term solution for us. We could ditch WCF and write our own HTTP server but I'd like to avoid that if possible. What's the easiest way to replace HttpListener with a standard TCP socket while still using all of the remaining HTTP scaffolding that WCF provides?

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • Why would an OS X bundle take about 30 seconds to open?

    - by Aftermathew
    Hi, We wrote a simple OS X executable in objective c. It opens and runs very quickly when called. We then put that executable into a .app bundle. When calling "open" from the command line on that bundle, or double clicking the app from the finder the "open" call can take upwards of 30 seconds to return. This is especially confusing because "open" clearly starts the executable right away (I can see it running in the process list right away, and have other indications that it's doing work), but when done from the command line, the "open" command takes a long time to return, and when done from the Finder the icon will bounce for a very long time before acting normal. I know the executable itself still opens very quickly because calling "open" on the executable inside my bundle returns very quickly, however calling it on the .app runs the code right away but takes 30 seconds or so to return. Has anyone run into this before? Do you have any suggestions for what could cause something like this? I've not been able to see anything funny in the bundle structure or the plist, but maybe I'm missing something. Thanks,

    Read the article

  • Modify this code to read bytes in the reverse endian?

    - by ibiza
    Hi, I have this bit of code which reads an 8 bytes array and converts it to a int64. I would like to know how to tweak this code so it would work when receiving data represented with the reverse endian... protected static long getLong(byte[] b, int off) { return ((b[off + 7] & 0xFFL) >> 0) + ((b[off + 6] & 0xFFL) << 8) + ((b[off + 5] & 0xFFL) << 16) + ((b[off + 4] & 0xFFL) << 24) + ((b[off + 3] & 0xFFL) << 32) + ((b[off + 2] & 0xFFL) << 40) + ((b[off + 1] & 0xFFL) << 48) + (((long) b[off + 0]) << 56); } Thanks for the help!

    Read the article

  • EditText items in a scrolling list lose their changes when scrolled off the screen

    - by ianww
    I have a long scrolling list of EditText items created by a SimpleCursorAdapter and prepopulated with values from an SQLite database. I make this by: cursor = db.rawQuery("SELECT _id, criterion, localweight, globalweight FROM " + dbTableName + " ORDER BY criterion", null); startManagingCursor(cursor); mAdapter = new SimpleCursorAdapter(this, R.layout.weight_edit_items, cursor, new String[]{"criterion","localweight","globalweight"}, new int[]{R.id.criterion_edit, R.id.localweight_edit, R.id.globalweight_edit}); this.setListAdapter(mAdapter); The scrolling list is several emulator screens long. The items display OK - scrolling through them shows that each has the correct value from the database. I can make an edit change to any of the EditTexts and the new text is accepted and displayed in the box. But...if I then scroll the list far enough to take the edited item off the screen, when I scroll back to look at it again its value has returned to what it was before I made the changes, ie. my edits have been lost. In trying to sort this out, I've done a getText to look at what's in the EditText after I've done my edits (and before a scroll) and getText returns the original text, even though the EditText is displaying my new text. It seems that the EditText has only accepted my edits superficially and they haven't been bound to the EditText, meaning they get dropped when scrolled off the screen. Can anyone please tell me what's going on here and what I need to do to force the EditText to retain its edits? Thanks Ian

    Read the article

  • Why NOT use POST method here?

    - by Camran
    I have a classifieds website. In the main page (index) I have several form fields which the user may or may not fill in, in order to specify a detailed search of classifieds. Ex: Category: Cars Price from: 3000 Price to: 10000 Color: Red Area: California The forms' action is set to a php page: <form action='query_sql.php' method='post'> In query_sql.php I fetch the variables like this: category=$_POST['category']; etc etc... Then query MySql: $query="SELECT........WHERE category='$category' etc etc.... $results = mysql_query($query); Then I simply display the results of the query to the user by creating a table which is filled in dynamically depending on the results set. However, according to an answer by Col. Shrapnel in my previous Q I shouldn't use POST here: http://stackoverflow.com/questions/3004754/how-to-hide-url-from-users-when-submitting-this-form The reason I use post is simply to hide the "one-page-word-document" long URL in the browsers adress bar. I am very confused, is it okay to use POST or not? It is working fine both when I use GET or POST now... And it is already on a production server... Btw, in the linked question, I wasn't referring to make URL invisible (or hide it) I just wanted it too look better (which I have accomplished with mod_rewrite). UPDATE: If I use GET, then how should I make the url better looking (beautiful)? Check this previous Q out: http://stackoverflow.com/questions/3000524/how-to-make-this-very-long-url-appear-short

    Read the article

  • Deserialize xml which uses attribute name/value pairs

    - by Bodyloss
    My application receives a constant stream of xml files which are more or less a direct copy of the database record <record type="update"> <field name="id">987654321</field> <field name="user_id">4321</field> <field name="updated">2011-11-24 13:43:23</field> </record> And I need to deserialize this into a class which provides nullable property's for all columns class Record { public long? Id { get; set; } public long? UserId { get; set; } public DateTime? Updated { get; set; } } I just cant seem to work out a method of doing this without having to parse the xml file manually and switch on the field's name attribute to store the values. Is their a way this can be achieved quickly using an XmlSerializer? And if not is their a more efficient way of parsing it manually? Regards and thanks My main problem is that the attribute name needs to have its value set to a property name and its value as the contents of a <field>..</field> element

    Read the article

  • MSForms.ListBox Type Mismatch in Access

    - by Jason
    I have an Access database where I use a Tab control (without tabs) to simulate a wizard. One of the tab pages has an MSForms.ListBox control called lstPorts, and a button named cmdAdd which adds the contents of a textbox to the List Box. I then try to keep the contents of the ListBox sorted. However, the call to the Sort method causes a type mismatch. Here is the cmdAdd_Click() code behind: Private Sub cmdAdd_Click() Dim test As MSForms.ListBox lstPorts2.AddItem (txtPortName) Call SortListBox(lstPorts2) End Sub Here is the SortListBox Sub: Public Sub SortListBox(ByRef oLb As MSForms.ListBox) Dim vaItems As Variant Dim i As Long, j As Long Dim vTemp As Variant 'Put the items in a variant array vaItems = oLb.List For i = LBound(vaItems, 1) To UBound(vaItems, 1) - 1 For j = i + 1 To UBound(vaItems, 1) If vaItems(i, 0) > vaItems(j, 0) Then vTemp = vaItems(i, 0) vaItems(i, 0) = vaItems(j, 0) vaItems(j, 0) = vTemp End If Next j Next i 'Clear the listbox oLb.Clear 'Add the sorted array back to the listbox For i = LBound(vaItems, 1) To UBound(vaItems, 1) oLb.AddItem vaItems(i, 0) Next i End Sub Any help out there? Since the Sort routine explicitly references the MSForms.ListBox, most of the results from Google aren't applicable. Jason

    Read the article

  • With C# 3.0, how to write Interface based code with generic collection?

    - by Deecay
    I want to write code that is decouple and clean, and I know that by programming to an interface instead of the implementation, my code will be more flexible and extensible. So, instead of writing methods like: bool IsProductAvailable(ProductTypeA product); I write methods like: bool IsProductAvailable(IProduct product); As long as my products implement IProduct: class ProductTypeA : IProduct I should be OK. All is well until I start using generic collections. Since C# 3.0 doesn't support covariant and contravariant, even though both ProuctTypeA and ProductTypeB implements IProduct, you cannot put List in List. This is pretty troublesome because a lot of times I want to write something like: bool AreProductsAvailable(List<IProduct> products); So that I can check product avaialbility by writing: List<ProductA> productsArrived = GetDataFromDataabase(); bool result = AreProductsAvailable(productsArrived); And I want to write just one AreProductsAvailable() method that works with all IProduct collections. I know that C# 4.0 is going to support covariant and contravariant, but I also realize that there other libraries that seemed to have the problem solved. For instance, I was trying out ILOG Gantt the gantt chart control, and found that they have a lot of collection intefaces that looks like this: IActivityCollection ILinkCollection So it seems like their approach is wrapping the generic collection with an interface. So instead of "bool AreProductsAvailable(List products);", I can do: bool AreProductsAvailable(IProductCollection products); And then write some code so that IProductCollection takes whatever generic collection of IProduct, be it List or List. However, I don't know how to write an IProductCollection interface that does that "magic". :-< (ashame) .... Could someone shed me some light? This has been bugging me for so long, and I so wanted to do the "right thing". Well, thanks!

    Read the article

  • IIS doesn't send two responses to the same client at the same time (only for ASP)

    - by dr. evil
    I've got 2 ASP pages. I do a request to the first page from Firefox (which takes 30 seconds to process on server-side), and during the execution of 30 seconds I do another request from Firefox to the second page (takes less than 1 second in server-side), but it does come after 31 second. Because it waits first requests to finish. When I request to the first page from Firefox and then request the second page from IE it's just instant. So basically ASP - IIS 6 somehow limiting every client to one request (long processing request) at a time. I need to get around this problem in my .NET client application. This is tested in 3 different systems. If you want to test you can try the ASP scripts at the end. This behaviour is same in a long SQL execution or just in a time consuming ASP operation. Note: It's not about HTTP Keep Alive It's not about persistent connection limit (we tried to increase this in firefox and in .NET with Net.ServicePointManager.DefaultConnectionLimit) It's not about User Agent This doesn't happen in ASP.NET so I assume it's something to the with ASP.dll I'm trying to solve this on the client not the server. I don't have direct control over the server it's a 3rd party solution. Is there any way to get around this? Sample ASP Code: First ASP: <% Set cnn = Server.CreateObject("Adodb.Connection") cnn.Open "Provider=sqloledb;Data Source=.;Initial Catalog=master;User Id=sa;Password=;" cnn.Execute("WAITFOR DELAY '0:0:30'") cnn.Close %> Second ASP: <% Response.Write "bla bla" %>

    Read the article

  • How to detect column conflicts with Hibernate?

    - by Slim
    So let's say I have an ArrayList full of Products that need to be committed to the database via Hibernate. There are already a large number of Products in the database. Each product has an ID. Note this is NOT the PK that is autogenerated by Hibernate. My questions is: what is the best way to detect conflicts with this ID? I am looking for a relatively efficient method of obtaining, from the the database, a List of Products that share an ID with any of the Products in my ArrayList. This is all in a single table called Products and the ID attribute is in column ProductID. The way I've done it is grabbing a list of all Products in the database, and compared each one with each entry in my ArrayList - but that is seriously inefficient and I don't think it would work well with a larger database. How should it be done? Thanks. I say "relatively" efficient because efficiency is not the primary concern, but it shouldn't take noticeably long to test against a table of ~1000-5000 rows. Help? EDIT* I'm very new to hibernate and below is the best I've come up with. How does this look? for(long id : idList){ //idList just holds the IDs of each Product in my ArrayList Query query = session.createQuery("select product from Product product where product.id = :id"); query.setLong("id", id); for(int i = 0; i < query.list().size(); i++){ listOfConflictingProducts.add((Product) query.list().get(i)); } }

    Read the article

  • How can I send GET data to multiple URLs at the same time using cURL?

    - by Rob
    My apologies, I've actually asked this question multiple times, but never quite understood the answers. Here is my current code: while($resultSet = mysql_fetch_array($SQL)){ $ch = curl_init($resultSet['url'] . $fullcurl); //load the urls and send GET data curl_setopt($ch, CURLOPT_TIMEOUT, 2); //Only load it for two seconds (Long enough to send the data) curl_exec($ch); //Execute the cURL curl_close($ch); //Close it off } //end while loop What I'm doing here, is taking URLs from a MySQL Database ($resultSet['url']), appending some extra variables to it, just some GET data ($fullcurl), and simply requesting the pages. This starts the script running on those pages, and that's all that this script needs to do, is start those scripts. It doesn't need to return any output. Just the load the page long enough for the script to start. However, currently it's loading each URL (currently 11) one at a time. I need to load all of them simultaneously. I understand I need to use curl_multi_*, but I haven't the slightest idea on how cURL functions work, so I don't know how to change my code to use curl_multi_* in a while loop. So my questions are: How can I change this code to load all of the URLs simultaneously? Please explain it and not just give me code. I want to know what each individual function does exactly. Will curl_multi_exec even work in a while loop, since the while loop is just sending each row one at a time? And of course, any references, guides, tutorials about cURL functions would be nice, as well. Preferably not so much from php.net, as while it does a good job of giving me the syntax, its just a little dry and not so good with the explanations.

    Read the article

  • What's the best way to store Logon User information for Web Application?

    - by Morgan Cheng
    I was once in a project of web application developed on ASP.NET. For each logon user, there is an object (let's call it UserSessionObject here) created and stored in RAM. For each HTTP request of given user, matching UserSessoinObject instance is used to visit user state information and connection to database. So, this UserSessionObject is pretty important. This design brings several problems found later: 1) Since this UserSessionObject is cached in ASP.NET memory space, we have to config load balancer to be sticky connection. That is, HTTP request in single session would always be sent to one web server behind. This limit scalability and maintainability. 2) This UserSessionObject is accessed in every HTTP request. To keep the consistency, there is a exclusive lock for the UserSessionObject. Only one HTTP request can be processed at any given time because it must to obtain the lock first. The performance and response time is affected. Now, I'm wondering whether there is better design to handle such logon user case. It seems Sharing-Nothing-Architecture helps. That means long user info is retrieved from database each time. I'm afraid that would hurt performance. Is there any design pattern for long user web app? Thanks.

    Read the article

  • I can not get the text from a selected item in a listview...pleeeeasss help.

    - by Miguel
    I always get an ClassCastException error... i do not what else to do... - I'm using a data biding concept to populated the listview from a sqlite3 database. - I just want to get the selected item text after a long press click. This is the code of the activity: public class ItemConsultaGastos extends ListActivity { private DataHelper dh ; TextView seleccion; private static String[] FROM = {DataHelper.MES, DataHelper.ANO}; private static int[] TO = {R.id.columnaMes, R.id.columnaAno }; public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.muestrafechas); this.dh = new DataHelper(this); Cursor cursor = dh.selectAllMeses(); startManagingCursor(cursor); this.mostrarFechas(cursor); ListView lv = getListView(); lv.setOnItemLongClickListener(new OnItemLongClickListener(){ @Override public boolean onItemLongClick(AdapterView<?> arg0, View arg1,int row, long arg3) { //here is where i got the classCastException. String[] tmp = (String[]) arg0.getItemAtPosition(row); //tmp[0] ist the Text of the first TextView displayed by the clicked ListItem Log.w("Gastos: ", "El texto: " + tmp[0].toString()); return true; } }); } private void mostrarFechas(Cursor cursor) { SimpleCursorAdapter adapter = new SimpleCursorAdapter(this,R.layout.muestrafechasitem,cursor, FROM, TO); setListAdapter(adapter); } } ///// This is the xml where a define the rows to show on the listview <TextView android:id="@+id/espacio" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text=" " /> <TextView android:id="@+id/columnaAno" android:layout_width="wrap_content" android:layout_height="wrap_content" android:textSize="20sp" android:layout_toRightOf="@+id/espacio"/> <TextView android:id="@+id/separador1" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text=" -- " android:layout_toRightOf="@+id/columnaAno" android:textSize="20sp" /> <TextView android:id="@+id/columnaMes" android:layout_width="fill_parent" android:layout_height="wrap_content" android:layout_toRightOf="@+id/separador1" android:textSize="20sp"/>

    Read the article

  • Need Help finding an appropriate task assignment algorithm for a college project involving coordinat

    - by Trif Mircea
    I am a long time lurker here and have found over time many answers regarding jquery and web development topics so I decided to ask a question of my own. This time I have to create a c++ project for college which should help manage the workflow of a company providing all kinds of services through in the field teams. The ideas I have so far are: client-server application; the server is a dispatcher where all the orders from clients get and the clients are mobile devices (PDAs) each team in the field having one a order from a client is a task. Each task is made up of a series of subtasks. You have a database with estimations on how long a task should take to complete you also know what tasks or subtasks each team on the field can perform based on what kind of specialists made up the team (not going to complicate the problem by adding needed materials, it is considered that if a member of a team can perform a subtask he has the stuff needed) Now knowing these factors, what would a good task assignment algorithm be? The criteria is: how many tasks can a team do, how many tasks they have in the queue, it could also be location, how far away are they from the place but I don't think I can implement that.. It needs to be efficient and also to adapt quickly is the human dispatcher manually assigns a task. Any help or leads would be really appreciated. Also I'm not 100% sure in the idea so if you have another way you would go about creating such an application please share, even if it just a quick outline. I have to write a theoretical part too so even if the ideas are far more complex that what i outlined that would be ok ; I'd write those and implement what I can. Edit: C++ is the only language I know unfortunately.

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >