Search Results

Search found 14131 results on 566 pages for 'note'.

Page 144/566 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • AWK Shift empty column to left (to start position)

    - by Filip Zembol
    INPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro vovo OUTPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro popo NOTE: Please help me, I need to shift all rows, which have first column empty. Every fields are tab delimited. In this file some rows start from first column, but some rows start from second or third column. Thank you

    Read the article

  • cyrtsal report how to hide records based on condition of a field like date

    - by hatemgamil
    hi all i have a question about hiding records in crystal report and i am using cyrstal report in vs 2008 ,i dont know its version as i am new in crystal reporting lets say i have report like that customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 3 dre 7 07/02/2009 4 kila 3 08/02/2009 i wana ask is there a pssibilty to hide the record if Order_Date year in 2009 and show only the records where Order_date year in 2010 to be like that : customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 **note i do need the data of 2009 to make a bar chart for this year thanks in advance

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • Check for Windsor Container Component Instance

    - by jeffn825
    How can I use my Windsor container to check if an instance (not just a component) has been registered? ie. container.ContainsInstance(typeof(MyType)) [EDIT] Another way of writing this might be Kernel.GetAssignableHandlers(typeof(object)) .Where(handler => handler.Service == typeof(MyType) || handler.ComponentModel.Implementation == typeof(MyType)) .Any(handler => handler.***Instance*** != null) Note that the property Instance doesn't exist in the API. Thanks.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • C++ Coding Style Conventions Doc

    - by uray
    I need to write some coding style convention document in C++ for my team, is there any example or reference how such document is made, what should I define? which convention is should be avoided? is there any C++ coding style standard defined somewhere? or care to share some if you have one? *note: I know its been asked many time, but what I need is something like this http://java.sun.com/docs/codeconv/html/CodeConvTOC.doc.html but specifically for C++

    Read the article

  • Can one create Sized Types in Scala?

    - by Jens Schauder
    Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

    Read the article

  • ASp.NET Dropdown and Dictionary

    - by Lijo
    Hi Team, I am using a dropdown list in ASP.NET with C#. I am trying to bind a dictionary to the dropdownlist. How can we specify the "Text" (key of dictionary as Text of drop down) and "value" (value as Value) for the dropdown? Could you please help? Note: There is a constraint that a class should not be introduced for this purpose. That is why I am trying to use a dictionary. Thanks Lijo

    Read the article

  • fread and fwrite are not recommended for use with structured data

    - by forest58
    A book beginning linux programming 3ed says "Note that fread and fwrite are not recommended for use with structured data.Part of the problem is that files written with fwrite are potentially nonportable between different machines." What does that mean exactly? what calls should I use if I want to write a portable structured data reader or writer? direct system calls?

    Read the article

  • How do I Scroll parent page to top when child page is click within iframe?

    - by Evan
    Hello, When someone clicks on a link within an iframe (child page), how do I get the parent page to scroll to the top? The issue is the child page will remain in the same spot of the page, because the iframe has a lot of height larger than the parent page. Please note: the parent and child pages are on different sub domains. I created a demo to show this: http://www.apus.edu/_test/iframe/index.htm

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • How can get autosuggest in cake php

    - by rajesh
    i hav entered my code in controller like below function keyup(){ $this-Note-simple(); if(strlen($searchq)0){ while ($row = mysql_fetch_array($getRecord)) { echo $row['name']; echo $row['department']; } return $row; } } as soon as i entered this one it doesn't display any info .... what correction should require.......

    Read the article

  • Redirect a specific IP address to a special page of my homepage with .htaccess

    - by Jim Knopf
    How can I use .htaccess to forward a visitor of a specific IP address to a webpage on my server? This example causes an infinite loop: RewriteCond %{REMOTE_ADDR} ^123\.\123\.123\.123$ RewriteRule ^(.*)$ /specialpage.php [R,L] I found this on the web but it just does not work: SetEnvIf REMOTE_ADDR 123.123.123.123 REDIR="redir" RewriteCond %{REDIR} redir RewriteRule ^(.*)$ /specialpage.php Note: My website consists of .htm, html and .php pages. Your help would be very much appreciated.

    Read the article

  • three rows divs streach ! plz

    - by rich wecks
    Dear ALl: Thank you for this amazing site, what I am trying to do is to make three divs top (nav) center and footer div top and bottom divs have fixed height My question how can I make the center div streach 100% and subtract the height of the others (divs [top and bottom])? here is the path to the test page thank you in advance note: I have given the body, html height 100%

    Read the article

  • How to implement == or >= operators for generic type

    - by momsd
    I have a generic type Foo which has a internal generic class Boo. Boo class a property Value of type K. In a method inside Foo i want to do a boo.Value >= value Note that second operand value is of type T. while compiling i am getting following error: Operator '=' cannot be applied to operands of type 'T' and 'T' Can anyone please tell me whats the problem here?

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

  • Introduction to F#

    - by masfenix
    How do I get started with F#? I can't seem to find any good information for beginners (note that I know intermediate C#). I am pretty much looking for how to videos rather then reading.

    Read the article

  • When, if ever, is "number of lines of code" a useful metric?

    - by user15071
    Some people claim that code's worst enemy is its size, and I tend to agree. Yet every day you keep hearing things like I write blah lines of code in a day. I own x lines of code. Windows is x million lines of code. Question: When is "#lines of code" useful? ps: Note that when such statements are made, the tone is "more is better".

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >