Search Results

Search found 14131 results on 566 pages for 'note'.

Page 144/566 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is it bad to explicitly compare against boolean constants e.g. if (b == false) in Java?

    - by polygenelubricants
    Is it bad to write: if (b == false) //... while (b != true) //... Is it always better to instead write: if (!b) //... while (!b) //... Presumably there is no difference in performance (or is there?), but how do you weigh the explicitness, the conciseness, the clarity, the readability, etc between the two? Note: the variable name b is just used as an example, ala foo and bar.

    Read the article

  • C++ Coding Style Conventions Doc

    - by uray
    I need to write some coding style convention document in C++ for my team, is there any example or reference how such document is made, what should I define? which convention is should be avoided? is there any C++ coding style standard defined somewhere? or care to share some if you have one? *note: I know its been asked many time, but what I need is something like this http://java.sun.com/docs/codeconv/html/CodeConvTOC.doc.html but specifically for C++

    Read the article

  • How do I Scroll parent page to top when child page is click within iframe?

    - by Evan
    Hello, When someone clicks on a link within an iframe (child page), how do I get the parent page to scroll to the top? The issue is the child page will remain in the same spot of the page, because the iframe has a lot of height larger than the parent page. Please note: the parent and child pages are on different sub domains. I created a demo to show this: http://www.apus.edu/_test/iframe/index.htm

    Read the article

  • Introduction to F#

    - by masfenix
    How do I get started with F#? I can't seem to find any good information for beginners (note that I know intermediate C#). I am pretty much looking for how to videos rather then reading.

    Read the article

  • PowerShell and interactive external programs

    - by CC
    Hi all I'm attempting to write a PowerShell script that, among other things, runs two external programs, harvesting the output of one and providing it to the other. The problem is that the second program is interactive and asks for: - a password - an option (1, 2, or 3) - an option (Y or N) - output of external program 1 Note also that this is on XP with PowerShell v1 and .net v2.0 (no I can't upgrade) Any ideas how I would do this? CC

    Read the article

  • Reducing width of bar chart series

    - by gAMBOOKa
    Note: by width i mean the height here, I use width because by default, bar charts are vertical and flex uses the width property I want to reduce the width of the following barchart so Type 5, Type 4, Type 3, Type 2, Type 1 are very close to each other. I tried playing with the barWidthRatio, the horizontalAxisRatio and the maxBarWidth properties. Neither is giving me the desired result. I can only manage to reduce the width of the orange bars, how do I reduce the width of the blue bars?

    Read the article

  • Maintaining a secure database of user logins and info?

    - by Rafe Kettler
    I want to have a login form on a charity website I am building (it's for a friend, and I'm learning on the go), and I want to know what languages/software should I learn to build databases for user logins and info? Note: it HAS to be secure and relatively simple to learn for someone with moderate programming experience. Update: I understand that CMSs offer good tools for logins etc. but I want to do this all by myself.

    Read the article

  • Redirect a specific IP address to a special page of my homepage with .htaccess

    - by Jim Knopf
    How can I use .htaccess to forward a visitor of a specific IP address to a webpage on my server? This example causes an infinite loop: RewriteCond %{REMOTE_ADDR} ^123\.\123\.123\.123$ RewriteRule ^(.*)$ /specialpage.php [R,L] I found this on the web but it just does not work: SetEnvIf REMOTE_ADDR 123.123.123.123 REDIR="redir" RewriteCond %{REDIR} redir RewriteRule ^(.*)$ /specialpage.php Note: My website consists of .htm, html and .php pages. Your help would be very much appreciated.

    Read the article

  • Can one create Sized Types in Scala?

    - by Jens Schauder
    Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

    Read the article

  • sending +-200 emails using php mail() function in a loop

    - by Glenn
    Note: It is worth noting that the mail() function is not suitable for larger volumes of email in a loop. This function opens and closes an SMTP socket for each email, which is not very efficient. Source: PHP manual What are larger volumes? A 100 or a 1000?? Can I safely make it loop 200 times without much problems? (I can't install pear)

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

  • send the new password - Asp.net - using gmail ( smtp.gmail.com )

    - by user331225
    Hi All, I've gone through all helps and all forums., but none of them have helped me. Here is my problem Developing a site on localhost using ASP.NET 3.5 I want to provide 'forgot password' functionality using <asp:PasswordRecovery> Any real help is greatly appreciated. Please note that I want to send it by either changing web.config OR programatically. Thanks

    Read the article

  • what is the best and easiest to draw a multi bar chart in php

    - by gin
    i want to display the results of students scores in a multi-vertical bar chart (red bar for correct , green bar for false) for each question,, i already tried Google chart, but it gives me result in this way:link text note: the bars that reached the top , should not be at top ,, only because they have the highest value (75%), Google chart makes it at top which i don't want.. any suggestions about how to draw simple vertical bar chart with php

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >