Search Results

Search found 14131 results on 566 pages for 'note'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 144/566 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Introduction to F#

    - by masfenix
    How do I get started with F#? I can't seem to find any good information for beginners (note that I know intermediate C#). I am pretty much looking for how to videos rather then reading.

    Read the article

  • HttpWebRequest possibly slowing website

    - by Steven Smith
    Using Visual studio 2012, C#.net 4.5 , SQL Server 2008, Feefo, Nopcommerce Hey guys I have Recently implemented a new review service into a current site we have. When the change went live the first day all worked fine. Since then though the sending of sales to Feefo hasnt been working, There are no logs either of anything going wrong. In the OrderProcessingService.cs in Nop Commerce's Service, i call a HttpWebrequest when an order has been confirmed as completed. Here is the code. var email = HttpUtility.UrlEncode(order.Customer.Email.ToString()); var name = HttpUtility.UrlEncode(order.Customer.GetFullName().ToString()); var description = HttpUtility.UrlEncode(productVariant.ProductVariant.Product.MetaDescription != null ? productVariant.ProductVariant.Product.MetaDescription.ToString() : "product"); var orderRef = HttpUtility.UrlEncode(order.Id.ToString()); var productLink = HttpUtility.UrlEncode(string.Format("myurl/p/{0}/{1}", productVariant.ProductVariant.ProductId, productVariant.ProductVariant.Name.Replace(" ", "-"))); string itemRef = ""; try { itemRef = HttpUtility.UrlEncode(productVariant.ProductVariant.ProductId.ToString()); } catch { itemRef = "0"; } var url = string.Format("feefo Url", login, password,email,name,description,orderRef,productLink,itemRef); var request = (HttpWebRequest)WebRequest.Create(url); request.KeepAlive = false; request.Timeout = 5000; request.Proxy = null; using (var response = (HttpWebResponse)request.GetResponse()) { if (response.StatusDescription == "OK") { var stream = response.GetResponseStream(); if(stream != null) { using (var reader = new StreamReader(stream)) { var content = reader.ReadToEnd(); } } } } So as you can see its a simple webrequest that is processed on an order, and all product variants are sent to feefo. Now: this hasnt been happening all week since the 15th (day of the implementation) the site has been grinding to a halt recently. The stream and reader in the the var content is there for debugging. Im wondering does the code redflag anything to you that could relate to the process of website? Also note i have run some SQL statements to see if there is any deadlocks or large escalations, so far seems fine, Logs have also been fine just the usual logging of Bots. Any help would be much appreciated! EDIT: also note that this code is in a method that is called and wrapped in A try catch UPDATE: well forget about the "not sending", thats because i was just told my code was rolled back last week

    Read the article

  • cyrtsal report how to hide records based on condition of a field like date

    - by hatemgamil
    hi all i have a question about hiding records in crystal report and i am using cyrstal report in vs 2008 ,i dont know its version as i am new in crystal reporting lets say i have report like that customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 3 dre 7 07/02/2009 4 kila 3 08/02/2009 i wana ask is there a pssibilty to hide the record if Order_Date year in 2009 and show only the records where Order_date year in 2010 to be like that : customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 **note i do need the data of 2009 to make a bar chart for this year thanks in advance

    Read the article

  • jQuery, Animate opacity to 1 then remove the opacity property to make it better looking on IE

    - by Emily
    Hi everyone, I tried the jQuery fadeIn animation in all browsers and it work good, but not that much on IE. the Alpha png images are so creepy after appending the CSS opacity, but i have an idea and i don't know how to implement it using jQuery. The idea is to fadeIn the element and when the animation is finished it will automatically remove the opacity property in order to make the picture quality better. How to do that? Note: i'm using Animate and not FadeIn. Thanks

    Read the article

  • Avoiding SQL Injection in SQL query with Like Operator using parameters?

    - by MikeJ
    Taking over some code from my predecessor and I found a query that uses the Like operator: SELECT * FROM suppliers WHERE supplier_name like '%'+name+%'; Trying to avoid SQL Injection problem and parameterize this but I am not quite sure how this would be accomplished. Any suggestions ? note, I need a solution for classic ADO.NET - I don't really have the go-ahead to switch this code over to something like LINQ.

    Read the article

  • PowerShell and interactive external programs

    - by CC
    Hi all I'm attempting to write a PowerShell script that, among other things, runs two external programs, harvesting the output of one and providing it to the other. The problem is that the second program is interactive and asks for: - a password - an option (1, 2, or 3) - an option (Y or N) - output of external program 1 Note also that this is on XP with PowerShell v1 and .net v2.0 (no I can't upgrade) Any ideas how I would do this? CC

    Read the article

  • Reducing width of bar chart series

    - by gAMBOOKa
    Note: by width i mean the height here, I use width because by default, bar charts are vertical and flex uses the width property I want to reduce the width of the following barchart so Type 5, Type 4, Type 3, Type 2, Type 1 are very close to each other. I tried playing with the barWidthRatio, the horizontalAxisRatio and the maxBarWidth properties. Neither is giving me the desired result. I can only manage to reduce the width of the orange bars, how do I reduce the width of the blue bars?

    Read the article

  • No pre-built ActionBar for Android pre-3.0?

    - by Ollie C
    I note the release a few days ago of the static library bringing fragments to Android versions prior to 3.0, but does this library include the ActionBar? I suspect not. I assume that for an app that will work on pre-3.0 versions, that it needs a hand-built ActionBar implementation for versions up to 2.3 and then to use the OS default ActionBar in v3.0? for some reason I assumed the library had ActionBar in it, but as I dig further I'm not finding any evidence of its presence.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Maintaining a secure database of user logins and info?

    - by Rafe Kettler
    I want to have a login form on a charity website I am building (it's for a friend, and I'm learning on the go), and I want to know what languages/software should I learn to build databases for user logins and info? Note: it HAS to be secure and relatively simple to learn for someone with moderate programming experience. Update: I understand that CMSs offer good tools for logins etc. but I want to do this all by myself.

    Read the article

  • How to handle authorization in the view layout

    - by mathk
    Authorize attribute are good to do some access control base on Action but suppose that I have some UI element in the layout that should note be output unless the user is authorize. I could possibly set some boolean in the ViewBag but that is not the good solution I guess. Somewhere in the Layout.cshtml: @if (ViewBag.IsAuthorized) { <li>@Html.ActionLink("Index", "Admin")</li> } Let me know if there is a better solution. Thanks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Is it bad to explicitly compare against boolean constants e.g. if (b == false) in Java?

    - by polygenelubricants
    Is it bad to write: if (b == false) //... while (b != true) //... Is it always better to instead write: if (!b) //... while (!b) //... Presumably there is no difference in performance (or is there?), but how do you weigh the explicitness, the conciseness, the clarity, the readability, etc between the two? Note: the variable name b is just used as an example, ala foo and bar.

    Read the article

  • Can one create Sized Types in Scala?

    - by Jens Schauder
    Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

    Read the article

  • Check for Windsor Container Component Instance

    - by jeffn825
    How can I use my Windsor container to check if an instance (not just a component) has been registered? ie. container.ContainsInstance(typeof(MyType)) [EDIT] Another way of writing this might be Kernel.GetAssignableHandlers(typeof(object)) .Where(handler => handler.Service == typeof(MyType) || handler.ComponentModel.Implementation == typeof(MyType)) .Any(handler => handler.***Instance*** != null) Note that the property Instance doesn't exist in the API. Thanks.

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

  • sending +-200 emails using php mail() function in a loop

    - by Glenn
    Note: It is worth noting that the mail() function is not suitable for larger volumes of email in a loop. This function opens and closes an SMTP socket for each email, which is not very efficient. Source: PHP manual What are larger volumes? A 100 or a 1000?? Can I safely make it loop 200 times without much problems? (I can't install pear)

    Read the article

  • three rows divs streach ! plz

    - by rich wecks
    Dear ALl: Thank you for this amazing site, what I am trying to do is to make three divs top (nav) center and footer div top and bottom divs have fixed height My question how can I make the center div streach 100% and subtract the height of the others (divs [top and bottom])? here is the path to the test page thank you in advance note: I have given the body, html height 100%

    Read the article

  • Redirect a specific IP address to a special page of my homepage with .htaccess

    - by Jim Knopf
    How can I use .htaccess to forward a visitor of a specific IP address to a webpage on my server? This example causes an infinite loop: RewriteCond %{REMOTE_ADDR} ^123\.\123\.123\.123$ RewriteRule ^(.*)$ /specialpage.php [R,L] I found this on the web but it just does not work: SetEnvIf REMOTE_ADDR 123.123.123.123 REDIR="redir" RewriteCond %{REDIR} redir RewriteRule ^(.*)$ /specialpage.php Note: My website consists of .htm, html and .php pages. Your help would be very much appreciated.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >