Search Results

Search found 14131 results on 566 pages for 'note'.

Page 144/566 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

• MS-Access: TableAdapter UpdateCommand for table without primary key

  - by Steven

  What is the syntax for an Update query for a table without a primary key? Disclaimer: Frustratingly, adding a primary key is not an option. My program is a small program in a much larger system with poor data management. My development time does not include rewriting the other software. Note: The database is Microsoft Access.

  Read the article

• HttpWebRequest possibly slowing website

  - by Steven Smith

  Using Visual studio 2012, C#.net 4.5 , SQL Server 2008, Feefo, Nopcommerce Hey guys I have Recently implemented a new review service into a current site we have. When the change went live the first day all worked fine. Since then though the sending of sales to Feefo hasnt been working, There are no logs either of anything going wrong. In the OrderProcessingService.cs in Nop Commerce's Service, i call a HttpWebrequest when an order has been confirmed as completed. Here is the code. var email = HttpUtility.UrlEncode(order.Customer.Email.ToString()); var name = HttpUtility.UrlEncode(order.Customer.GetFullName().ToString()); var description = HttpUtility.UrlEncode(productVariant.ProductVariant.Product.MetaDescription != null ? productVariant.ProductVariant.Product.MetaDescription.ToString() : "product"); var orderRef = HttpUtility.UrlEncode(order.Id.ToString()); var productLink = HttpUtility.UrlEncode(string.Format("myurl/p/{0}/{1}", productVariant.ProductVariant.ProductId, productVariant.ProductVariant.Name.Replace(" ", "-"))); string itemRef = ""; try { itemRef = HttpUtility.UrlEncode(productVariant.ProductVariant.ProductId.ToString()); } catch { itemRef = "0"; } var url = string.Format("feefo Url", login, password,email,name,description,orderRef,productLink,itemRef); var request = (HttpWebRequest)WebRequest.Create(url); request.KeepAlive = false; request.Timeout = 5000; request.Proxy = null; using (var response = (HttpWebResponse)request.GetResponse()) { if (response.StatusDescription == "OK") { var stream = response.GetResponseStream(); if(stream != null) { using (var reader = new StreamReader(stream)) { var content = reader.ReadToEnd(); } } } } So as you can see its a simple webrequest that is processed on an order, and all product variants are sent to feefo. Now: this hasnt been happening all week since the 15th (day of the implementation) the site has been grinding to a halt recently. The stream and reader in the the var content is there for debugging. Im wondering does the code redflag anything to you that could relate to the process of website? Also note i have run some SQL statements to see if there is any deadlocks or large escalations, so far seems fine, Logs have also been fine just the usual logging of Bots. Any help would be much appreciated! EDIT: also note that this code is in a method that is called and wrapped in A try catch UPDATE: well forget about the "not sending", thats because i was just told my code was rolled back last week

  Read the article

• Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

  - by Vatsala

  Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

  Read the article

• jQuery, Animate opacity to 1 then remove the opacity property to make it better looking on IE

  - by Emily

  Hi everyone, I tried the jQuery fadeIn animation in all browsers and it work good, but not that much on IE. the Alpha png images are so creepy after appending the CSS opacity, but i have an idea and i don't know how to implement it using jQuery. The idea is to fadeIn the element and when the animation is finished it will automatically remove the opacity property in order to make the picture quality better. How to do that? Note: i'm using Animate and not FadeIn. Thanks

  Read the article

• Parse string as if it were a querystring in Ruby on Rails

  - by Koning WWWWWWWWWWWWWWWWWWWWWWW

  I have a string like this: "foo=bar&bar=foo&hello=hi" Does Ruby on Rails provide methods to parse this as if it is a querystring, so I get a hash like this: { :foo => "bar", :bar => "foo", :hello => "hi" } Or must I write it myself? EDIT Please note that the string above is not a real querystring from a URL, but rather a string stored in a cookie from Facebook Connect.

  Read the article

• Qt: How can I access the actual widgets on a page in WebKit?

  - by Jen

  Is there a way to access the widgets generated by INPUT and SELECT on a page in WebKit, using Qt? On a related note, does WebKit provide these widgets, or does it delegate back to Qt to generate them?

  Read the article

• No pre-built ActionBar for Android pre-3.0?

  - by Ollie C

  I note the release a few days ago of the static library bringing fragments to Android versions prior to 3.0, but does this library include the ActionBar? I suspect not. I assume that for an app that will work on pre-3.0 versions, that it needs a hand-built ActionBar implementation for versions up to 2.3 and then to use the OS default ActionBar in v3.0? for some reason I assumed the library had ActionBar in it, but as I dig further I'm not finding any evidence of its presence.

  Read the article

• PowerShell and interactive external programs

  - by CC

  Hi all I'm attempting to write a PowerShell script that, among other things, runs two external programs, harvesting the output of one and providing it to the other. The problem is that the second program is interactive and asks for: - a password - an option (1, 2, or 3) - an option (Y or N) - output of external program 1 Note also that this is on XP with PowerShell v1 and .net v2.0 (no I can't upgrade) Any ideas how I would do this? CC

  Read the article

• Introduction to F#

  - by masfenix

  How do I get started with F#? I can't seem to find any good information for beginners (note that I know intermediate C#). I am pretty much looking for how to videos rather then reading.

  Read the article

• Reducing width of bar chart series

  - by gAMBOOKa

  Note: by width i mean the height here, I use width because by default, bar charts are vertical and flex uses the width property I want to reduce the width of the following barchart so Type 5, Type 4, Type 3, Type 2, Type 1 are very close to each other. I tried playing with the barWidthRatio, the horizontalAxisRatio and the maxBarWidth properties. Neither is giving me the desired result. I can only manage to reduce the width of the orange bars, how do I reduce the width of the blue bars?

  Read the article

• cyrtsal report how to hide records based on condition of a field like date

  - by hatemgamil

  hi all i have a question about hiding records in crystal report and i am using cyrstal report in vs 2008 ,i dont know its version as i am new in crystal reporting lets say i have report like that customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 3 dre 7 07/02/2009 4 kila 3 08/02/2009 i wana ask is there a pssibilty to hide the record if Order_Date year in 2009 and show only the records where Order_date year in 2010 to be like that : customer_Id customer_name OrderAmount Order_date 0 xyz 5 03/02/2010 1 abc 6 04/02/2010 **note i do need the data of 2009 to make a bar chart for this year thanks in advance

  Read the article

• How to detect double click on WebBrower control?

  - by Tim Murphy

  In a WinForms application I need to detect when the contents of a System.Windows.Forms.WebBrowser is double clicked which in turn opens custom winform dialog box. I note that WebBrowserBase disables the Control.DoubleClick event but I've not worked out how to override this behaviour.

  Read the article

• iPhone Battery Time with GPS

  - by Mustafa

  What's the battery time of iPhone 3G and 3Gs with GPS active? I'm getting approx. 2 hours of battery life with active GPS (Note: I'm using my own App).

  Read the article

• sending +-200 emails using php mail() function in a loop

  - by Glenn

  Note: It is worth noting that the mail() function is not suitable for larger volumes of email in a loop. This function opens and closes an SMTP socket for each email, which is not very efficient. Source: PHP manual What are larger volumes? A 100 or a 1000?? Can I safely make it loop 200 times without much problems? (I can't install pear)

  Read the article

• Is it bad to explicitly compare against boolean constants e.g. if (b == false) in Java?

  - by polygenelubricants

  Is it bad to write: if (b == false) //... while (b != true) //... Is it always better to instead write: if (!b) //... while (!b) //... Presumably there is no difference in performance (or is there?), but how do you weigh the explicitness, the conciseness, the clarity, the readability, etc between the two? Note: the variable name b is just used as an example, ala foo and bar.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Is it correct to correct properties values on the fly?

  - by Sein Kraft

  Is it correct to correct properties values on the fly? for example: (note the .ToLower) Public Property X() As String Get Return _x.ToLower End Get Set(ByVal Value As String) _x = value.ToLower End Set End Property

  Read the article

• How to access html request parameters for a .rhtml page served by webrick?

  - by cibercitizen1

  I'm using webrick (the built-in ruby webserver) to serve .rhtml files (html with ruby code embedded --like jsp). It works fine, but I can't figure out how to access parameters (e.g. http://localhost/mypage.html?foo=bar) from within the ruby code in the .rhtml file. (Note that I'm not using the rails framework, only webrick + .rhtml files) Thanks

  Read the article

• Can one create Sized Types in Scala?

  - by Jens Schauder

  Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

  Read the article

• groovy: how to escape "(" regrex etc in textarea?

  - by user311884

  I have some text area field in my grails application. I got the following errors: .PatternSyntaxException: Unmatched closing ')' near index 36 Name: note: 1) data listing .... how could i espace the regular expressions in the text area field? thanks.

  Read the article

• How to get the Queue name that NServiceBus pulled the message from.

  - by Simon

  I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

  Read the article

• convert a list of booleans to string

  - by compie

  How do I convert this: [True, True, False, True, True, False, True] Into this: 'AB DE G' Note: C and F are missing in the output because the corresponding items in the input list are False.

  Read the article

• MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

  - by themoch

  I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

  Read the article

• Maintaining a secure database of user logins and info?

  - by Rafe Kettler

  I want to have a login form on a charity website I am building (it's for a friend, and I'm learning on the go), and I want to know what languages/software should I learn to build databases for user logins and info? Note: it HAS to be secure and relatively simple to learn for someone with moderate programming experience. Update: I understand that CMSs offer good tools for logins etc. but I want to do this all by myself.

  Read the article

• how to clear the the activity stack in android.

  - by Sam

  Hi, im having following application flow in my android app, Login-Home-screen1-screen2-screen3-screen4- logout In the screen4 i've a log out button,which allow user to logout from the application and re login.when i re-logn to the app previous data still be shown,is there way to start the application in fresh when user log out from the app NOTE: all the above activities launch mode set to "single task", regards, Sam.

  Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >