Search Results

Search found 3872 results on 155 pages for 'argument deduction'.

Page 146/155 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • asp.net mvc radio button state

    - by Josh Bush
    I'm trying out asp.net mvc for a new project, and I ran across something odd. When I use the MVC UI helpers for textboxes, the values get persisted between calls. But, when I use a series of radio buttons, the checked state doesn't get persisted. Here's an example from my view. <li> <%=Html.RadioButton("providerType","1")%><label>Hospital</label> <%=Html.RadioButton("providerType","2")%><label>Facility</label> <%=Html.RadioButton("providerType","3")%><label>Physician</label> </li> When the form gets posted back, I build up an object with "ProviderType" as one of it's properties. The value on the object is getting set, and then I RedirectToAction with the provider as a argument. All is well, and I end up at a URL like "http://localhost/Provider/List?ProviderType=1" with ProviderType showing. The value gets persisted to the URL, but the UI helper isn't picking up the checked state. I'm having this problem with listbox, dropdownlist, and radiobutton. Textboxes pick up the values just fine. Do you see something I'm doing wrong? I'm assuming that the helpers will do this for me, but maybe I'll just have to take care of this on my own. I'm just feeling my way through this, so your input is appreciated. Edit: I just found the override for the SelectList constructor that takes a selected value. That took care of my dropdown issue I mentioned above. Edit #2: I found something that works, but it pains me to do it this way. I feel like this should be inferred. <li> <%=Html.RadioButton("ProviderType","1",Request["ProviderType"]=="1")%><label>Hospital</label> <%=Html.RadioButton("ProviderType", "2", Request["ProviderType"] == "2")%><label>Facility</label> <%=Html.RadioButton("ProviderType", "3", Request["ProviderType"] == "3")%><label>Physician</label> </li> Hopefully someone will come up with another way.

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Haskell type classes and type families (cont'd)

    - by Giuseppe Maggiore
    I need some help in figuring a compiler error which is really driving me nuts... I have the following type class: infixl 7 --> class Selectable a s b where type Res a s b :: * (-->) :: (CNum n) => (Reference s a) -> (n,(a->b),(a->b->a)) -> Res a s b which I instance twice. First time goes like a charm: instance Selectable a s b where type Res a s b = Reference s b (-->) (Reference get set) (_,read,write) = (Reference (\s -> let (v,s') = get s in (read v,s')) (\s -> \x -> let (v,s') = get s v' = write v x (_,s'') = set s' v' in (x,s''))) since the type checker infers (-->) :: Reference s a -> (n,a->b,a->b->a) -> Reference s b and this signature matches with the class signature for (--) since Res a s b = Reference s b Now I add a second instance and everything breaks: instance (Recursive a, Rec a ~ reca) => Selectable a s (Method reca b c) where type Res a s (Method reca b c) = b -> Reference s c (-->) (Reference get set) (_,read,write) = \(x :: b) -> from_constant( Constant(\(s :: s)-> let (v,s') = get s :: (a,s) m = read v ry = m x :: Reference (reca) c (y,v') = getter ry (cons v) :: (c,reca) v'' = elim v' (_,s'') = set s' v'' in (y,s''))) :: Reference s c the compiler complains that Couldn't match expected type `Res a s (Method reca b c)' against inferred type `b -> Reference s c' The lambda expression `\ (x :: b) -> ...' has one argument, which does not match its type In the expression: \ (x :: b) -> from_constant (Constant (\ (s :: s) -> let ... in ...)) :: Reference s c In the definition of `-->': --> (Reference get set) (_, read, write) = \ (x :: b) -> from_constant (Constant (\ (s :: s) -> ...)) :: Reference s c reading carefully the compiler is telling me that it has inferred the type of (--) thusly: (-->) :: Reference s a -> (n,a->(Method reca b c),a->(Method reca b c)->a) -> (b -> Reference s c) which is correct since Res a s (Method reca b c) = b -> Reference s c but why can't it match the two definitions? Sorry for not offering a more succint and standalone example, but in this case I cannot figure how to do it...

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • passing a class method as opposed to a function in std::sort

    - by memC
    hi, Within a class, I am trying to sort a vector, by passing a method of the same class. But it gives errors at the time of compilation. Can anyone tell what the problem is? Thank you! it gives the following error: argument of type bool (Sorter::)(D&, D&)' does not matchbool (Sorter::*)(D&, D&)' I have also tried using sortBynumber(D const& d1, D const& d2) #include<vector> #include<stdio.h> #include<iostream> #include<algorithm> class D { public: int getNumber(); D(int val); ~D(){}; private: int num; }; D::D(int val){ num = val; }; int D::getNumber(){ return num; }; class Sorter { public: void doSorting(); bool sortByNumber(D& d1, D& d2); std::vector<D> vec_D; Sorter(); ~Sorter(){}; private: int num; }; Sorter::Sorter(){ int i; for ( i = 0; i < 10; i++){ vec_D.push_back(D(i)); } }; bool Sorter::sortByNumber(D& d1, D& d2){ return d1.getNumber() < d2.getNumber(); }; void Sorter::doSorting(){ std::sort(vec_D.begin(), vec_D.end(), this->sortByNumber); }; int main(){ Sorter s; s.doSorting(); std::cout << "\nPress RETURN to continue..."; std::cin.get(); return 0; }

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

  • Damaged data when gzipping

    - by RadiantHeart
    This is the script I hva written for gzipping content on my site, which is located in 'gzip.php'. The way i use it is that on pages where I want to enable gzipping i include the file at the top and at the bottom i call the output function like this: print_gzipped_page('javascript') If the file is a css-file i use 'css' as the $type-argument and if its a php file i call the function without declaring any arguments. The script works fine in all browsers except Opera which gives an error saying it could not decode the page due to damaged data. Can anyone tell me what I have done wrong? <?php function print_gzipped_page($type = false) { if(headers_sent()){ $encoding = false; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'], 'x-gzip') !== false ){ $encoding = 'x-gzip'; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'],'gzip') !== false ){ $encoding = 'gzip'; } else{ $encoding = false; } if ($type!=false) { $type_header_array = array("css" => "Content-Type: text/css", "javascript" => "Content-Type: application/x-javascript"); $type_header = $type_header_array[$type]; } $contents = ob_get_contents(); ob_end_clean(); $etag = '"' . md5($contents) . '"'; $etag_header = 'Etag: ' . $etag; header($etag_header); if ($type!=false) { header($type_header); } if (isset($_SERVER['HTTP_IF_NONE_MATCH']) and $_SERVER['HTTP_IF_NONE_MATCH']==$etag) { header("HTTP/1.1 304 Not Modified"); exit(); } if($encoding){ header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); } echo $contents; exit(); } ob_start(); ob_implicit_flush(0); ?> Additional info: The script works if the length og the document beeing compressed is only 10-15 characters.

    Read the article

  • Returning JSON in CFFunction and appending it to layer is causing an error

    - by Mel
    I'm using the qTip jQuery plugin to generate a dynamic tooltip. I'm getting an error in my JS, and I'm unsure if its source is the JSON or the JS. The tooltip calls the following function: (sorry about all this code, but it's necessary) <cffunction name="fGameDetails" access="remote" returnType="any" returnformat="JSON" output="false" hint="This grabs game details for the games.cfm page"> <!---Argument, which is the game ID---> <cfargument name="gameID" type="numeric" required="true" hint="CFC will look for GameID and retrieve its details"> <!---Local var---> <cfset var qGameDetails = ""> <!---Database query---> <cfquery name="qGameDetails" datasource="#REQUEST.datasource#"> SELECT titles.titleName AS tName, titles.titleBrief AS tBrief, games.gameID, games.titleID, games.releaseDate AS rDate, genres.genreName AS gName, platforms.platformAbbr AS pAbbr, platforms.platformName AS pName, creviews.cReviewScore AS rScore, ratings.ratingName AS rName FROM games Inner Join platforms ON platforms.platformID = games.platformID Inner Join titles ON titles.titleID = games.titleID Inner Join genres ON genres.genreID = games.genreID Inner Join creviews ON games.gameID = creviews.gameID Inner Join ratings ON ratings.ratingID = games.ratingID WHERE (games.gameID = #ARGUMENTS.gameID#); </cfquery> <cfreturn qGameDetails> </cffunction> This function returns the following JSON: { "COLUMNS": [ "TNAME", "TBRIEF", "GAMEID", "TITLEID", "RDATE", "GNAME", "PABBR", "PNAME", "RSCORE", "RNAME" ], "DATA": [ [ "Dark Void", "Ancient gods known as 'The Watchers,' once banished from our world by superhuman Adepts, have returned with a vengeance.", 154, 54, "January, 19 2010 00:00:00", "Action & Adventure", "PS3", "Playstation 3", 3.3, "14 Anos" ] ] } The problem I'm having is every time I try to append the JSON to the layer #catalog, I get a syntax error that says "missing parenthetical." This is the JavaScript I'm using: $(document).ready(function() { $('#catalog a[href]').each(function() { $(this).qtip( { content: { url: '/gamezilla/resources/components/viewgames.cfc?method=fGameDetails', data: { gameID: $(this).attr('href').match(/gameID=([0-9]+)$/)[1] }, method: 'get' }, api: { beforeContentUpdate: function(content) { var json = eval('(' + content + ')'); content = $('<div />').append( $('<h1 />', { html: json.TNAME })); return content; } }, style: { width: 300, height: 300, padding: 0, name: 'light', tip: { corner: 'leftMiddle', size: { x: 40, y : 40 } } }, position: { corner: { target: 'rightMiddle', tooltip: 'leftMiddle' } } }); }); }); Any ideas where I'm going wrong? I tried many things for several days and I can't find the issue. Many thanks!

    Read the article

  • Error With Sending mail (kSKPSMTPPartMessageKey is nil)

    - by user1553381
    I'm trying to send mail in iPhone using "SKPSMTPMessage" and I added the libraries, In my class I added the following code: - (IBAction)sendMail:(id)sender { // if there are a connection if ([theConnection isEqualToString:@"true"]) { if ([fromEmail.text isEqualToString:@""] || [toEmail.text isEqualToString:@""]) { UIAlertView *warning = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ??? ????? ???? ????????" delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [warning show]; }else { SKPSMTPMessage *test_smtp_message = [[SKPSMTPMessage alloc] init]; test_smtp_message.fromEmail = fromEmail.text; test_smtp_message.toEmail = toEmail.text; test_smtp_message.relayHost = @"smtp.gmail.com"; test_smtp_message.requiresAuth = YES; test_smtp_message.login = @"[email protected]"; test_smtp_message.pass = @"myPass"; test_smtp_message.wantsSecure = YES; NSString *subject= @"Suggest a book for you"; test_smtp_message.subject = [NSString stringWithFormat:@"%@ < %@ > ",fromEmail.text, subject]; test_smtp_message.delegate = self; NSMutableArray *parts_to_send = [NSMutableArray array]; NSDictionary *plain_text_part = [NSDictionary dictionaryWithObjectsAndKeys: @"text/plain\r\n\tcharset=UTF-8;\r\n\tformat=flowed", kSKPSMTPPartContentTypeKey, [messageBody.text stringByAppendingString:@"\n"], kSKPSMTPPartMessageKey, @"quoted-printable", kSKPSMTPPartContentTransferEncodingKey, nil]; [parts_to_send addObject:plain_text_part]; // to send attachment NSString *image_path = [[NSBundle mainBundle] pathForResource:BookCover ofType:@"jpg"]; NSData *image_data = [NSData dataWithContentsOfFile:image_path]; NSDictionary *image_part = [NSDictionary dictionaryWithObjectsAndKeys: @"inline;\r\n\tfilename=\"image.png\"",kSKPSMTPPartContentDispositionKey, @"base64",kSKPSMTPPartContentTransferEncodingKey, @"image/png;\r\n\tname=Success.png;\r\n\tx-unix-mode=0666",kSKPSMTPPartContentTypeKey, [image_data encodeWrappedBase64ForData],kSKPSMTPPartMessageKey, nil]; [parts_to_send addObject:image_part]; test_smtp_message.parts = parts_to_send; Spinner.hidden = NO; [Spinner startAnimating]; ProgressBar.hidden = NO; HighestState = 0; [test_smtp_message send]; } }else { UIAlertView *alertNoconnection = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ???? ???? " delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [alertNoconnection show]; } } but when I tried to send it gives me the following Exception: *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFString appendString:]: nil argument' and it highlighted this line in SKPSMTPMessage.m [message appendString:[part objectForKey:kSKPSMTPPartMessageKey]]; and I Can't understand what is nil exactly Can Anyone help me in this issue? Thanks in Advance.

    Read the article

  • Applying styles to a GridView matching certain criteria

    - by NickK
    Hi everyone. I'm fairly new to ASP.Net so it's probably just me being a bit stupid, but I just can't figure out why this isn't working. Basically, I have a GridView control (GridView1) on a page which is reading from a database. I already have a CSS style applied to the GridView and all I want to do is change the background image applied in the style depending on if a certain cell has data in it or not. The way I'm trying to handle this change is updating the CSS class applied to each row through C#. I have the code below doing this: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s.Length > 0) { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } In theory, the data from Cell[7] will either be null or be a string (in this case, likely a person's name). The problem is that when the page loads, every row in the GridView has the new style applied to it, whether it's empty or not. However, when I change it to use hard coded examples, it works fine. So for example, the below would work exactly how I want it to: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s == "Smith") //Matching a name in one of the rows { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } It seems as if the top piece of code is always returning the string with a value greater than 0, but when I check the database the fields are all null (except for my test record of "Smith"). I'm probably doing something very simple that's wrong here, but I can't see what. Like I said, I'm still very new to this. One thing I have tried is changing the argument in the if statement to things like: if (s != null), if (s != "") and if (s == string.empty) all with no luck. Any help is greatly appreciated and don't hesitate to tell me if I'm just being stupid here. :)

    Read the article

  • Passing enums to functions in C++

    - by rocknroll
    Hi all, I have a header file with all the enums listed (#ifndef #define #endif construct has been used to avoid multiple inclusion of the file) that I use in multiple cpp files in my application.One of the enums in the files is enum StatusSubsystem {ENABLED,INCORRECT_FRAME,INVALID_DATA,DISABLED}; There are functions in the application delcared as ShowStatus(const StatusSubsystem&); Earlier in the application when I made calls to the above function like ShowStatus(INCORRECT_FRAME); my application used to compile perfectly. But after some code was added The compilation halts giving the following error: File.cpp:71: error: invalid conversion from `int' to `StatusSubsystem' File.cpp:71: error: initializing argument 1 of `void Class::ShowStatus(const StatusSubsystem&) I checked the code for any conflicting enums in the new code and it looked fine. My Question is what is wrong with the function call that compiler shows as erroneous? For your reference the function definition is: void Class::ShowStatus(const StatusSubsystem& eStatus) { QPalette palette; mStatus=eStatus;//store current Communication status of system if(eStatus==DISABLED) { //select red color for label, if it is to be shown disabled palette.setColor(QPalette::Window,QColor(Qt::red)); mLabel->setText("SYSTEM"); } else if(eStatus==ENABLED) { //select green color for label,if it is to be shown enabled palette.setColor(QPalette::Window,QColor(Qt::green)); mLabel->setText("SYSTEM"); } else if(eStatus==INCORRECT_FRAME) { //select yellow color for label,to show that it is sending incorrect frames palette.setColor(QPalette::Window,QColor(Qt::yellow)); mLabel->setText("SYSTEM(I)"); } //Set the color on the Label mLabel->setPalette(palette); } A strange side effect of this situation is it compiles when I cast all the calls to ShowStatus() as ShowStatus((StatusSubsystem)INCORRECT_FRAME); Though this removes any compilation error, but a strange thing happens. Though I make call to INCORRECT_FRAME above but in function definition it matches with ENABLED. How on earth is that possible? Its like while passing INCORRECT_FRAME by reference, it magically converts to ENABLED, which should be impossible. This is driving me nuts. Can you find any flaw in what I am doing? or is it something else? The application is made using C++,Qt-4.2.1 on RHEL4. Thanks.

    Read the article

  • New to MVC. Actionscript 3.0 Appreciate your help.

    - by Combustion007
    Hello Everyone, I am new to design patterns and am trying to learn the MVC implementation. I have written four classes: DataModel DataView DataController Main Main serves as the application facade. The main FLA is called HelloWorld. I have a symbol called "Box" in HelloWorld. I just would like to add an instance of the "Box" on the stage. Eventually I would like to place a button and when the button is clicked, the Box instance color will be changed. I would appreciate any help, please help me figure out what am I doing wrong. Here are my Classes: DATAMODEL CLASS: package { import flash.events.*; public class DataModel extends EventDispatcher { public static const UPDATE:String = "modelUpdate"; private var _color:Number = (Math.round(Math.random()* 0xffffff)); public function DataModel() { trace("DATA MODEL INIT"); } public function get color():Number { return _color; } public function set color(p:Number):void { _color = p; notifyObserver(); } public function notifyObserver():void { dispatchEvent(new Event(DataModel.UPDATE)); } } } //DATACONTROLLER CLASS: package { import flash.events.; import flash.display.; import flash.errors.*; public class DataController { private var _model:DataModel; public function DataController(m:DataModel) { trace("DATACONTROLLER INIT"); _model = m; } } } DATAVIEW CLASS: package { import flash.events.; import flash.display.; import flash.errors.*; public class DataView extends Sprite { private var _model:DataModel; private var _controller:DataController; private var b:Box; public function DataView(m:DataModel, c:DataController) { _model = m; _controller = c; b = new Box(); b.x = b.y = 100; addChild(b); } } } And Finally THE FACADE: package { import flash.display.; import flash.events.; import flash.text.; import flash.errors.; public class Main extends Sprite { private var _model:DataModel; private var _controller:DataController; private var _view:DataView; public function Main(m:DataModel, c:DataController, v:DataView) { _model = m; _controller = c; _view = v; addChild(v); } } } When I test the movie: I get this error: ArgumentError: Error #1063: Argument count mismatch on Main(). Expected 3, got 0. Thanks alot.

    Read the article

  • Where are the function literals c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • How to get Augmented Reality: A Practical Guide examples working?

    - by Glen
    I recently bought the book: Augmented Reality: A Practical Guide (http://pragprog.com/titles/cfar/augmented-reality). It has example code that it says runs on Windows, MacOS and Linux. But I can't get the binaries to run. Has anyone got this book and got the binaries to run on ubuntu? I also can't figure out how to compile the examples in Ubuntu. How would I do this? Here is what it says to do: Compiling for Linux Refreshingly, there are no changes required to get the programs in this chapter to compile for Linux, but as with Windows, you’ll first have to find your GL and GLUT files. This may mean you’ll have to download the correct version of GLUT for your machine. You need to link in the GL, GLU, and GLUT libraries and provide a path to the GLUT header file and the files it includes. See whether there is a glut.h file in the /usr/include/GL directory; otherwise, look elsewhere for it—you could use the command find / -name "glut.h" to search your entire machine, or you could use the locate command (locate glut.h). You may need to customize the paths, but here is an example of the compile command: gcc -o opengl_template opengl_template.cpp -I /usr/include/GL -I /usr/include -lGL -lGLU -lglut gcc is a C/C++ compiler that should be present on your Linux or Unix machine. The -I /usr/include/GL command-line argument tells gcc to look in /usr/include/GL for the include files. In this case, you’ll find glut.h and what it includes. When linking in libraries with gcc, you use the -lX switch—where X is the name of your library and there is a correspond- ing libX.a file somewhere in your path. For this example, you want to link in the library files libGL.a, libGLU.a, and libglut.a, so you will use the gcc arguments -lGL -lGLU -lglut. These three files are found in the default directory /usr/lib/, so you don’t need to specify their location as you did with glut.h. If you did need to specify the library path, you would add -L to the path. To run your compiled program, type ./opengl_template or, if the current directory is in your shell’s paths, just opengl_template. When working in Linux, it’s important to know that you may need to keep your texture files to a maximum of 256 by 256 pixels or find the settings in your system to raise this limit. Often an OpenGL program will work in Windows but produce a blank white texture in Linux until the texture size is reduced. The above instructions make no sense to me. Do I have to use gcc to compile or can I use eclipse? If I use either eclipse or gcc what do I need to do to compile and run the program?

    Read the article

  • Directly Jump to another C++ function

    - by maligree
    I'm porting a small academic OS from TriCore to ARM Cortex (Thumb-2 instruction set). For the scheduler to work, I sometimes need to JUMP directly to another function without modifying the stack nor the link register. On TriCore (or, rather, on tricore-g++), this wrapper template (for any three-argument-function) works: template< class A1, class A2, class A3 > inline void __attribute__((always_inline)) JUMP3( void (*func)( A1, A2, A3), A1 a1, A2 a2, A3 a3 ) { typedef void (* __attribute__((interrupt_handler)) Jump3)( A1, A2, A3); ( (Jump3)func )( a1, a2, a3 ); } //example for using the template: JUMP3( superDispatch, this, me, next ); This would generate the assembler instruction J (a.k.a. JUMP) instead of CALL, leaving the stack and CSAs unchanged when jumping to the (otherwise normal) C++ function superDispatch(SchedulerImplementation* obj, Task::Id from, Task::Id to). Now I need an equivalent behaviour on ARM Cortex (or, rather, for arm-none-linux-gnueabi-g++), i.e. generate a B (a.k.a. BRANCH) instruction instead of BLX (a.k.a. BRANCH with link and exchange). But there is no interrupt_handler attribute for arm-g++ and I could not find any equivalent attribute. So I tried to resort to asm volatile and writing the asm code directly: template< class A1, class A2, class A3 > inline void __attribute__((always_inline)) JUMP3( void (*func)( A1, A2, A3), A1 a1, A2 a2, A3 a3 ) { asm volatile ( "mov.w r0, %1;" "mov.w r1, %2;" "mov.w r2, %3;" "b %0;" : : "r"(func), "r"(a1), "r"(a2), "r"(a3) : "r0", "r1", "r2" ); } So far, so good, in my theory, at least. Thumb-2 requires function arguments to be passed in the registers, i.e. r0..r2 in this case, so it should work. But then the linker dies with undefined reference to `r6' on the closing bracket of the asm statement ... and I don't know what to make of it. OK, I'm not the expert in C++, and the asm syntax is not very straightforward... so has anybody got a hint for me? A hint to the correct __attribute__ for arm-g++ would be one way, a hint to fix the asm code would be another. Another way maybe would be to tell the compiler that a1..a3 should already be in the registers r0..r2 when the asm statement is entered (I looked into that a bit, but did not find any hint).

    Read the article

  • How do I properly register the Type Library of A VB.NET COM+ Component?

    - by k_Dank
    I am looking to upgrade legacy VB6 COM+ components to VB.NET components. I have seemingly upgraded one already, called EventPackage, which has one class, IEventListener. Another, TradeOrders, Implements EventPackage.IEventListener. When attempting to build TradeOrders, I get the following Errors/Warnings; Cannot load type library for reference "EventPackage". Library not registered. (Exception from HRESULT: 0x8002801D (TYPE_E_LIBNOTREGISTERED)) The referenced component 'EventPackage' could not be found. Type 'EventPackage.IEventListener' is not defined. In the .vbproj, I notice this reference <COMReference Include="EventPackage"> <Guid>{0D76C094-21A6-4E04-802B-6E539F7102D7}</Guid> <Lcid>0</Lcid> <VersionMajor>2</VersionMajor> <VersionMinor>0</VersionMinor> <WrapperTool>tlbimp</WrapperTool> </COMReference> When I search the registry for this Guid, I find nothing. When using GUIDs for similar COM+ objects, I find them in HKEY_CLASSES_ROOT\CLSID\{...}\TypeLib ("..." being the GUID of the other component). When I go to the registry key name corresponding to EventPackage.IEventListener, I find that there is no \TypeLib subkey. As you might suspect, searching the reg for "0D76C094-21A6-4E04-802B-6E539F7102D7" yields no results. So I know this must be a registry problem, But I have tried seemingly every google result I have found. I have tried Regasm and regsvcs .exe's to no avail. Many pages just tell me that dragging the dll to the COM+ manager should automatically register the component. So how do I register the Type library? Details on how I made EventPackage COM+ component Ran the VB6-VB.NET wizard Then I added some lines to the assemblyinfo.vb file added Imports System.EnterpriseServices added Imports System.EnterpriseServices Imports System.Data.SqlClient <Assembly: CLSCompliant(True)> <Assembly: AssemblyKeyFileAttribute("...")> for a strong name <Assembly: Guid("...")> (Where "..." is the COM+ CLSID of the old component) I added the following to the class file IEventListener.VB Imports System.EnterpriseServices <ComClass("...")> _ (Where ... is the proper COM+ CLSID, that is the only argument) Inherits ServicedComponent changed the ID made by the Conversion wizard to the proper value (from <System.Runtime.InteropServices.ProgId("IEventListener_NET.IEventListener)> to <System.Runtime.InteropServices.ProgId("EventPackage.IEventListener")> _ Then I dragged the DLL into the COM+ manager in the proper COM+ application (although, the "Path" is not specified and only says mscoree.dll)

    Read the article

  • StringIndexOutOfBoundsException: String index out of range 0

    - by Evan F
    I'm trying to write a program to take the first letter of the user input to generate a username. I'm trying to write it so that if the user leaves the input blank, then the letter that would otherwise be taken to generate the username defaults to the letter 'z'. Here is my full code: import java.util.Scanner; /** UsernameGenerator.java Generates a username based on the users inputs. @author: Evan Fravert */ public class UsernameGenerator { /** * Generates a username based on the users inputs. *@param args command line argument */ public static void main(String[] args) { // abcde String first; String middle; String last; String password1; String password2; int randomNum; randomNum = (int) (Math.random() * 1000) + 100; Scanner userInput = new Scanner(System.in); System.out.println("Please enter your first name:"); first = userInput.nextLine(); String firstLower = first.toLowerCase(); System.out.println("Please enter your middle name:"); middle = userInput.nextLine(); String middleLower = middle.toLowerCase(); System.out.println("Please enter your last name:"); last = userInput.nextLine(); int lastEnd = last.length()-1; String lastLower = last.toLowerCase(); System.out.println("Please enter your password:"); password1 = userInput.nextLine(); System.out.println("Please enter your password again:"); password2 = userInput.nextLine(); char firstLetter = firstLower.charAt(0); char middleLetter = middleLower.charAt(0); char lastLetter = lastLower.charAt(0); char lastLast = lastLower.charAt(lastEnd); if first.length() == 0) { firstLetter = 'z'; } else { firstLetter = firstLower.charAt(0); } System.out.println("Your username is " + firstLetter + "" + middleLetter + "" + lastLetter + "" + "" + lastLast + "" + randomNum); System.out.println("Your password is " + password1); System.out.println("Welcome " + first + " " + middle + " " + last + "!"); } }

    Read the article

  • Is there anything wrong with having a few private methods exposing IQueryable<T> and all public meth

    - by Nate Bross
    I'm wondering if there is a better way to approach this problem. The objective is to reuse code. Let’s say that I have a Linq-To-SQL datacontext and I've written a "repository style" class that wraps up a lot of the methods I need and exposes IQueryables. (so far, no problem). Now, I'm building a service layer to sit on top of this repository, many of the service methods will be 1<-1 with repository methods, but some will not. I think a code sample will illustrate this better than words. public class ServiceLayer { MyClassDataContext context; IMyRepository rpo; public ServiceLayer(MyClassDataContext ctx) { context = ctx; rpo = new MyRepository(context); } private IQueryable<MyClass> ReadAllMyClass() { // pretend there is some complex business logic here // and maybe some filtering of the current users access to "all" // that I don't want to repeat in all of the public methods that access // MyClass objects. return rpo.ReadAllMyClass(); } public IEnumerable<MyClass> GetAllMyClass() { // call private IQueryable so we can do attional "in-database" processing return this.ReadAllMyClass(); } public IEnumerable<MyClass> GetActiveMyClass() { // call private IQueryable so we can do attional "in-database" processing // in this case a .Where() clause return this.ReadAllMyClass().Where(mc => mc.IsActive.Equals(true)); } #region "Something my class MAY need to do in the future" private IQueryable<MyOtherTable> ReadAllMyOtherTable() { // there could be additional constrains which define // "all" for the current user return context.MyOtherTable; } public IEnumerable<MyOtherTable> GetAllMyOtherTable() { return this.ReadAllMyOtherTable(); } public IEnumerable<MyOtherTable> GetInactiveOtherTable() { return this.ReadAllMyOtherTable.Where(ot => ot.IsActive.Equals(false)); } #endregion } This particular case is not the best illustration, since I could just call the repository directly in the GetActiveMyClass method, but let’s presume that my private IQueryable does some extra processing and business logic that I don't want to replicate in both of my public methods. Is that a bad way to attack an issue like this? I don't see it being so complex that it really warrants building a third class to sit between the repository and the service class, but I'd like to get your thoughts. For the sake of argument, lets presume two additional things. This service is going to be exposed through WCF and that each of these public IEnumerable methods will be calling a .Select(m => m.ToViewModel()) on each returned collection which will convert it to a POCO for serialization. The service will eventually need to expose some context.SomeOtherTable which wont be wrapped into the repository.

    Read the article

  • How do i know in the detail view what cell in tableview was selected?

    - by Daniel Rotaru
    how can i know what tableview cell was selected?(being in the detail view) The problem is that. I have an table view controller. Here are parsed from the internet entries to the table. So it's a dynamic tabe view that loads from internet. I will not know how many entries will be in the table so i will not know what details view to call when i click a row. So i have maked one view. This view contains an calendar. On this calendar(wich is the detail iew) i will parse data from internet depending on the selected row. For exemple: i have table: entry 1, entry 2,entry 3,entry 4 When i click entry 2 i need to call a php with the argument entry 2. The php will know what entry on the table i have selected and will generate me the correct xml that i will parse. Here is my tableview didSelectRow function: - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic -- create and push a new view controller if(bdvController == nil) bdvController = [[BookDetailViewController alloc] initWithNibName:@"BookDetailView" bundle:[NSBundle mainBundle]]; Villa *aVilla = [appDelegate.villas objectAtIndex:indexPath.row]; [self.navigationController pushViewController:bdvController animated:YES] And here is my self view function on detailviewcontroller: -(void)loadView { [super loadView]; self.title=@"Month" UIBarButtonItem *addButtonItem = [[UIBarButtonItem alloc] initWithTitle:@"ListView" style:UIBarButtonItemStyleDone target:self action:@selector(add:)]; self.navigationItem.rightBarButtonItem = addButtonItem; calendarView = [[[KLCalendarView alloc] initWithFrame:CGRectMake(0.0f, 0.0f, 320.0f, 373.0f) delegate:self] autorelease]; appDelegate1 = (XMLAppDelegate *)[[UIApplication sharedApplication] delegate]; myTableView=[[UITableView alloc]initWithFrame:CGRectMake(0, 260, 320, 160)style:UITableViewStylePlain]; myTableView.dataSource=self; myTableView.delegate=self; UIView *myHeaderView=[[UIView alloc]initWithFrame:CGRectMake(0, 0, myTableView.frame.size.width,2)]; myHeaderView.backgroundColor=[UIColor grayColor]; [myTableView setTableHeaderView:myHeaderView]; [self.view addSubview:myTableView]; [self.view addSubview:calendarView]; [self.view bringSubviewToFront:myTableView]; } I think that here in self load i need to make the if procedure.. If indexPath.row=x parse fisier.php?variabila=title_of_rowx but the question is how i know the indexPath variable?

    Read the article

  • Perfect Forwarding to async lambda

    - by Alexander Kondratskiy
    I have a function template, where I want to do perfect forwarding into a lambda that I run on another thread. Here is a minimal test case which you can directly compile: #include <thread> #include <future> #include <utility> #include <iostream> #include <vector> /** * Function template that does perfect forwarding to a lambda inside an * async call (or at least tries to). I want both instantiations of the * function to work (one for lvalue references T&, and rvalue reference T&&). * However, I cannot get the code to compile when calling it with an lvalue. * See main() below. */ template <typename T> std::string accessValueAsync(T&& obj) { std::future<std::string> fut = std::async(std::launch::async, [](T&& vec) mutable { return vec[0]; }, std::forward<T>(obj)); return fut.get(); } int main(int argc, char const *argv[]) { std::vector<std::string> lvalue{"Testing"}; // calling with what I assume is an lvalue reference does NOT compile std::cout << accessValueAsync(lvalue) << std::endl; // calling with rvalue reference compiles std::cout << accessValueAsync(std::move(lvalue)) << std::endl; // I want both to compile. return 0; } For the non-compiling case, here is the last line of the error message which is intelligible: main.cpp|13 col 29| note: no known conversion for argument 1 from ‘std::vector<std::basic_string<char> >’ to ‘std::vector<std::basic_string<char> >&’ I have a feeling it may have something to do with how T&& is deduced, but I can't pinpoint the exact point of failure and fix it. Any suggestions? Thank you! EDIT: I am using gcc 4.7.0 just in case this could be a compiler issue (probably not)

    Read the article

  • Defined variables and arrays vs functions in php

    - by Frank Presencia Fandos
    Introduction I have some sort of values that I might want to access several times each page is loaded. I can take two different approaches for accessing them but I'm not sure which one is 'better'. Three already implemented examples are several options for the Language, URI and displaying text that I describe here: Language Right now it is configured in this way: lang() is a function that returns different values depending on the argument. Example: lang("full") returns the current language, "English", while lang() returns the abbreviation of the current language, "en". There are many more options, like lang("select"), lang("selectact"), etc that return different things. The code is too long and irrelevant for the case so if anyone wants it just ask for it. Url The $Url array also returns different values depending on the request. The whole array is fully defined in the beginning of the page and used to get shorter but accurate links of the current page. Example: $Url['full'] would return "http://mypage.org/path/to/file.php?page=1" and $Url['file'] would return "file.php". It's useful for action="" within the forms and many other things. There are more values for $Url['folder'], $Url['file'], etc. Same thing about the code, if wanted, just request it. Text [You can skip this section] There's another array called $Text that is defined in the same way than $Url. The whole array is defined at the beginning, making a mysql call and defining all $Text[$i] for current page with a while loop. I'm not sure if this is more efficient than multiple calls for a single mysql cell. Example: $Text['54'] returns "This is just a test array!" which this could perfectly be implemented with a function like text(54). Question With the 3 examples you can see that I use different methods to do almost the same function (no pun intended), but I'm not sure which one should become the standard one for my code. I could create a function called url() and other called text() to output what I want. I think that working with functions in those cases is better, but I'm not sure why. So I'd really appreciate your opinions and advice. Should I mix arrays and functions in the way I described or should I just use funcions? Please, base your answer in this: The source needs to be readable and reusable by other developers Resource consumption (processing, time and memory). The shorter the code the better. The more you explain the reasons the better. Thank you PS, now I know the differences between $Url and $Uri.

    Read the article

  • C++ stream as a parameter when overloading operator<<

    - by TheOm3ga
    I'm trying to write my own logging class and use it as a stream: logger L; L << "whatever" << std::endl; This is the code I started with: #include <iostream> using namespace std; class logger{ public: template <typename T> friend logger& operator <<(logger& log, const T& value); }; template <typename T> logger& operator <<(logger& log, T const & value) { // Here I'd output the values to a file and stdout, etc. cout << value; return log; } int main(int argc, char *argv[]) { logger L; L << "hello" << '\n' ; // This works L << "bye" << "alo" << endl; // This doesn't work return 0; } But I was getting an error when trying to compile, saying that there was no definition for operator<<: pruebaLog.cpp:31: error: no match for ‘operator<<’ in ‘operator<< [with T = char [4]](((logger&)((logger*)operator<< [with T = char [4]](((logger&)(& L)), ((const char (&)[4])"bye")))), ((const char (&)[4])"alo")) << std::endl’ So, I've been trying to overload operator<< to accept this kind of streams, but it's driving me mad. I don't know how to do it. I've been loking at, for instance, the definition of std::endl at the ostream header file and written a function with this header: logger& operator <<(logger& log, const basic_ostream<char,char_traits<char> >& (*s)(basic_ostream<char,char_traits<char> >&)) But no luck. I've tried the same using templates instead of directly using char, and also tried simply using "const ostream& os", and nothing. Another thing that bugs me is that, in the error output, the first argument for operator<< changes, sometimes it's a reference to a pointer, sometimes looks like a double reference...

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >