Search Results

Search found 10595 results on 424 pages for 'job definition'.

Page 146/424 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • Get a list/tuple/dict of the arguments passed to a function?

    - by digitala
    Given the following function: def foo(a, b, c): pass How would one obtain a list/tuple/dict/etc of the arguments passed in, without having to build the structure myself? Specifically, I'm looking for Python's version of JavaScript's arguments keyword or PHP's func_get_args() method. What I'm not looking for is a solution using *args or **kwargs; I need to specify the argument names in the function definition (to ensure they're being passed in) but within the function I want to work with them in a list- or dict-style structure.

    Read the article

  • Overload operator in F#

    - by forki23
    Hi, I would like to overload the (/) operator in F# for strings and preserve the meaning for numbers. /// Combines to path strings let (/) path1 path2 = Path.Combine(path1,path2) let x = 3 / 4 // doesn't compile If I try the following I get "Warning 29 Extension members cannot provide operator overloads. Consider defining the operator as part of the type definition instead." /// Combines to path strings type System.String with static member (/) (path1,path2) = Path.Combine(path1,path2) Any ideas? Regards, forki

    Read the article

  • xsd and wsdl incorrect file

    - by Gandalf StormCrow
    How to fix corrupted xsd and wsdl files, is there any IDE which can suggest what is wrong? such as eclipse for java code when pressing CTRL + 1 , or where can I find books tutorials to understand formatting of these file types better? thank you Here is concrete message error I have [ERROR] 'item' is already defined line 223 of file:/C:/project/src/main/resources/schema.xsd [ERROR] (related to above error) the first definition appears here line 22 of file:/C:/project/src/main/resources/schema.xsd

    Read the article

  • Can I somehow know which replacement is taking place from within a callback of preg_replace_callback

    - by jayarjo
    I'm using preg_replace_callback to substitute particular tokens within the string. But apart from actual token I need to know as well whether that token was first, second or third in a subject string. Is there any way to access that info? I found an argument $count in preg_replace_callback definition (http://php.net/manual/en/function.preg-replace-callback.php), which counts replacements, but I'm not sure if it is accessible from within callback. Any example of the usage in described context?

    Read the article

  • Problem with include guard

    - by isurulucky
    When I add an include guard to my header file for a Visual C++ project, it gives me the following warning and error: warning C4603: '_MAPTEST_H' : macro is not defined or definition is different after precompiled header use Add macro to precompiled header instead of defining here .\MapTest.cpp(6) : use of precompiled header** // the precompiled header stdafx.h is included in this line .\MapTest.cpp(186) : fatal error C1020: unexpected #endif but when I add the precompiled header before the include guard, no warning or error is emitted. What is the reason for this?

    Read the article

  • MVCContrib Testing Route with Areas

    - by xkevin
    Hi, I am using MVC 2 with Area. To test routing, I am using MvcContrib. This is the testing code: [Test] public void Home() { MvcApplication.RegisterRoutes(RouteTable.Routes); "~/".ShouldMapTo(x = x.Login("Nps")); } I am not sure how to call routing definition that are stored in Areas. Calling AreaRegistration.RegisterAllAreas() is not an option as it gives an exception. Thanks Revin

    Read the article

  • Make Visual Studios "Add Service Reference" Feature use an existing Class

    - by gencha
    When I add a service reference to my Visual Studio 2010 C# project, a new class for one of the types defined in the WSDL will be generated. A de-facto equivalent definition of that type already exists in our solution in a different assembly. When adding the SoapTypeAttribute to the existing class and replacing the references to the generated class in the generated code, everything runs perfectly and as expected. How would I tell Visual Studio to use the existing class in the generated code?

    Read the article

  • Finding unused classes in C# app.

    - by duder
    I'm a C#/.net/Visual Studio noob. I inherited a half-completed C# application for a mobile phone. In the course of debugging, I came across several half-finished classes that don't seem to be used anywhere else in the code. Is there a way to get determine if a class definition is instantiated anywhere?

    Read the article

  • what is middleware exactly?

    - by michel
    I hear a lot of people talking last days about middleware, but what is the exact definition of middleware. If I look in information about middleware I found a lot of information and some definitions, but while reading this information and defintions it seems that mostly all 'wares' are in the middle of something. So from my opinion all things are middleware? or do you have an example of a ware that doesn't is middleware?

    Read the article

  • typeInteger undeclared in EyeTunes framework

    - by Chris
    I copied the EyeTunes framework into my project and it says that is not declared. In the original project I go to definition and it takes me to AEDataModel.h where it is defined. However in my project it doesn't do that and it's not found. How do I add AEDataModel to my project? Thanks

    Read the article

  • Selecting one row when working with typed datasets.

    - by Wodzu
    I have a typed dataset in my project. I would like to populate a datatable with only one row instead of all rows. The selected row must be based on the primary key column. I know I could modify the designer code to achive this functionality however if I change the code in the designer I risk that this code will be deleted when I update my datased via designer in the future. So I wanted to alter the SelectCommand not in the designer but just before firing up MyTypedTableAdapter.Fill method. The strange thing is that the designer does not create a SelectCommand! It creates all other commands but not this one. If it would create SelectCommand I could alter it in this way: this.operatorzyTableAdapter.Adapter.SelectCommand.CommandText += " WHERE MyColumn = 1"; It is far from perfection but atleast I would not have to modify the designer's work. unfortunately as I said earlier the SelectCommand is not created. Instead designer creates something like this: [global::System.Diagnostics.DebuggerNonUserCodeAttribute()] private void InitCommandCollection() { this._commandCollection = new global::System.Data.SqlClient.SqlCommand[1]; this._commandCollection[0] = new global::System.Data.SqlClient.SqlCommand(); this._commandCollection[0].Connection = this.Connection; this._commandCollection[0].CommandText = "SELECT Ope_OpeID, Ope_Kod, Ope_Haslo, Ope_Imie, Ope_Nazwisko FROM dbo.Operatorzy"; this._commandCollection[0].CommandType = global::System.Data.CommandType.Text; } It doesn't make sense in my opinion. Why to create UpdateCommand, InsertCommand and DeleteCommand but do not create SelectCommand? I could bear with this but this._commandCollection is private so I cannot acces it outside of the class code. I don't know how to get into this collection without changing the designer's code. The idea which I have is to expose the collection via partial class definition. However I want to introduce many typed datasets and I really don't want to create partial class definition for each of them. Please note that I am using .NET 3.5. I've found this article about accessing private properties but it concerns .NET 4.0 Thanks for your time.

    Read the article

  • Ignore order of elements using xs:extension

    - by Peter Lang
    How can I design my xsd to ignore the sequence of elements? <root> <a/> <b/> </root> <root> <b/> <a/> </root> I need to use extension for code generation reasons, so I tried the following using all: <?xml version="1.0" encoding="UTF-8"?> <xs:schema targetNamespace="http://www.example.com/test" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:t="http://www.example.com/test" > <xs:complexType name="BaseType"> <xs:all> <xs:element name="a" type="xs:string" /> </xs:all> </xs:complexType> <xs:complexType name="ExtendedType"> <xs:complexContent> <xs:extension base="t:BaseType"> <xs:all> <!-- ERROR --> <xs:element name="b" type="xs:string" /> </xs:all> </xs:extension> </xs:complexContent> </xs:complexType> <xs:element name="root" type="t:ExtendedType"></xs:element> </xs:schema> This xsd is not valid though, the following error is reported at <!-- ERROR -->: cos-all-limited.1.2: An all model group must appear in a particle with {min occurs} = {max occurs} = 1, and that particle must be part of a pair which constitutes the {content type} of a complex type definition. Documentation of cos-all-limited.1.2 says: 1.2 the {term} property of a particle with {max occurs}=1 which is part of a pair which constitutes the {content type} of a complex type definition. I don't really understand this (neither xsd nor English native speaker :) ). Am I doing the wrong thing, am I doing the right thing wrong, or is there no way to achieve this? Thanks!

    Read the article

  • JavaCC: How can one exclude a string from a token? (A.k.a. understanding token ambiguity.)

    - by java.is.for.desktop
    Hello, everyone! I had already many problems with understanding, how ambiguous tokens can be handled elegantly (or somehow at all) in JavaCC. Let's take this example: I want to parse XML processing instruction. The format is: "<?" <target> <data> "?>": target is an XML name, data can be anything except ?>, because it's the closing tag. So, lets define this in JavaCC: (I use lexical states, in this case DEFAULT and PROC_INST) TOKEN : <#NAME : (very-long-definition-from-xml-1.1-goes-here) > TOKEN : <WSS : (" " | "\t")+ > // WSS = whitespaces <DEFAULT> TOKEN : {<PI_START : "<?" > : PROC_INST} <PROC_INST> TOKEN : {<PI_TARGET : <NAME> >} <PROC_INST> TOKEN : {<PI_DATA : ~[] >} // accept everything <PROC_INST> TOKEN : {<PI_END : "?>" > : DEFAULT} Now the part which recognizes processing instructions: void PROC_INSTR() : {} { ( <PI_START> (t=<PI_TARGET>){System.out.println("target: " + t.image);} <WSS> (t=<PI_DATA>){System.out.println("data: " + t.image);} <PI_END> ) {} } Let's test it with <?mytarget here-goes-some-data?>: The target is recognized: "target: mytarget". But now I get my favorite JavaCC parsing error: !! procinstparser.ParseException: Encountered "" at line 1, column 15. !! Was expecting one of: !! Encountered nothing? Was expecting nothing? Or what? Thank you, JavaCC! I know, that I could use the MORE keyword of JavaCC, but this would give me the whole processing instruction as one token, so I'd had to parse/tokenize it further by myself. Why should I do that? Am I writing a parser that does not parse? The problem is (i guess): hence <PI_DATA> recognizes "everything", my definition is wrong. I should tell JavaCC to recognize "everything except ?>" as processing instruction data. But how can it be done? NOTE: I can only exclude single characters using ~["a"|"b"|"c"], I can't exclude strings such as ~["abc"] or ~["?>"]. Another great anti-feature of JavaCC. Thank you.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Doubts in ada language involving procedures

    - by maddy
    Hi All, I am a beginner in ada and i had come across a piece of code which is shown below: procedure Null_Proc is begin null; end; Now as per my knowledge the procedure in ada doesn't return anything.My doubt is what does this procedure Null_proc do?I mean i am not clear with the definition of the procedure. Thanks and regards Maddy

    Read the article

  • linq join query

    - by SamB09
    Hi, im trying to do a join in linq , however for some reason i cant access the primary key of a table. It's the 'h.ProjectId' that doesn't seem to be accepted. The following error is given CW1.SearchWebService.Bid does not contain a definition for 'ProjectId' and no extention method 'ProjectId' accepting a first argument of type 'CW1SearchWebService.Bid' var allProjects = ctxt.Project.ToList() ; var allBids = ctxt.Bid.ToArray();// return all bids var projects = (from project in allProjects join h in allBids on project.ProjectId equals h.ProjectId

    Read the article

  • Power function in prolog

    - by NHans
    Exactly what's the prolog definition for power function. I wrote this code and it give some errors I wanna know exact code for the power function. pow(X,0,1). pow(X,Y,Z):-Y1=Y-1,pow(X,Y1,Z1),Z1=Z*X. Anything wrong with this code?

    Read the article

  • Smart pointer class predeclaration

    - by tommyk
    I have a header file: class A { public: DeviceProxyPtr GetDeviceProxy(); }; DeviceProxyPtr is defined in a different header file like this: typedef SmartPtrC<DeviceProxyC> DeviceProxyPtr; I don't want to include DeviceProxyPtr definition header. If a return type was DeviceProxy* I could simply use predeclaration class DeviceProxy. Is there any way to do the same with my smart pointer class?

    Read the article

  • Spring - singleton problem - No bean named '....' found

    - by lisak
    Hey, I can't figure out what is wrong with this beans definition. I'm getting this error http://pastebin.com/ecn5SWLa . Especially the 14th log message is interesting. This is my app-context file http://pastebin.com/dreubpRY httpParams is a singleton which is set up in httpParamBean and then used by tsccManager and httpClient. The various depends-on settings is a result of my effort to figure it out.

    Read the article

  • Understanding Haskell's filter

    - by dmindreader
    I understand that Haskell's filter is a high order function (meaning a function that takes another function as a parameter) that goes through a list checking which element fulfills certain boolean condition. I don't quite understand its definition: filter:: (a->Bool)->[a]->[a] filter p [] = [] filter p (x:y) | p x = x:filter p y | otherwise = filter p y I understand that if I pass an empty list to the function, it would just return an empty list, but how do I read the last two lines?

    Read the article

  • ASP.NET MVC AcceptVerbs and registering routes

    - by Pure.Krome
    Hi Folks, do I have to register the HttpVerb constraint in my route definition (when i'm registering routes) if i have decorated my action method with the [AcceptVerbs(..)] attribute already? eg. i have this. [AcceptVerbs(HttpVerbs.Post)] public ActionResult Create(FormCollection formCollection) { .. } do i need to add this to the route that refers to this action, as a constraint?

    Read the article

  • How to simulate a dial-up connection for testing purposes?

    - by mawg
    I have to code a server app where clients open a TCP/IP socket, send some data and close the connection. The data packets are small < 100 bytes, however there is talk of having them batch their transactions and send multiple packets. How can I best simulate a dial-up ut connection (using Delphy & Indy components, just FYI)? Is it as simple as open connection wait a while (what is the definition of "a while"?) close connection

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >