Search Results

Search found 82718 results on 3309 pages for 'large file download'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 147/3309 | < Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >

  • How to validate presence of an uploaded file in rails?

    - by brad
    I'm playing around creating a rails file uploader and have struck a problem that should have an obvious solution. How do I check that a file has been selected in my form and uploaded? Here is my new.html.erb view <h2>Upload File</h2> <% form_for(@upload_file, :url => {:action => 'save'}, :html => {:multipart => true}) do |f| %> <%= f.error_messages %> <p> <%= f.label :file -%> <%= f.file_field :upload -%> </p> <p> <%= f.label :description %> <%= f.text_field :description %> </p> <p> <%= f.label :file_type %> <%= f.select :file_type, ["XML Data"] %> </p> <p><%= f.submit 'Upload File' %></p> <% end %> and here is my upload_file.rb model class UploadFile < ActiveRecord::Base validates_presence_of :description validates_presence_of :file_type validates_presence_of :upload def upload=(upload_file_field) self.name = "#{Time.now.strftime("%Y%m%d%H%M%S")}_#{upload_file_field.original_filename}" File.open("#{RAILS_ROOT}/public/upload/#{self.name}", "wb") { |f| f.write(upload_file_field.read) } end end If I use this as shown here, the validation validates_presence_of :upload always fails and I am returned to my form with an error message. I'd be very grateful if someone could explain how to do this validation correctly, and I'd be even more grateful if they could explain why it works. Thanks.

    Read the article

  • Accessing objects on one nib file from another nib file

    - by ASN
    I have two nib files Main.nib and Preferernces.nib I have a class CalendarView.m that inherits from NSView .It has a method for drawing calendar - (void)drawCalendar; In Main.nib window I have NSWindow(My Main window) which has an NSView item on it for displaying calendar.Main window has an NSPopUp button that shows a menu when application runs. Menu has a 'Preferences' menu item which on clicking show a preferences panel(NSPanel) that panel is in Preferences.nib file.Panel has a colorwell item .When application is executed clcking on colorwell show a color panel to choose color .But I am unable to apply that color to my calendar. I have another class PreferencesWindowController.m that shows preferences panel . It has a method changeColor that takes selected color from colors panel and make changes to user defaults . I have IBOutlet CalendarView *calView as a member in PreferencesWindowController.h class. In changeColor mehod I am writing - calView = [[CalendarView alloc] init]; [calView drawCalendar]; On debugging call goes to drawCalendar method of CalendarView but skips some part of it and goes to end of function without redrawing. On restarting the application color is applied but I want it to happen while application is executing, so that there is no need to rerun the application to view changes.

    Read the article

  • When downloading a file using FileStream, why does page error message refers to aspx page name, not

    - by StuperUser
    After building a filepath (path, below) in a string (I am aware of Path in System.IO, but am using someone else's code and do not have the opportunity to refactor it to use Path). I am using a FileStream to deliver the file to the user (see below): FileStream myStream = new FileStream(path, FileMode.Open, FileAccess.Read); long fileSize = myStream.Length; byte[] Buffer = new byte[(int)fileSize + 1]; myStream.Read(Buffer, 0, (int)myStream.Length); myStream.Close(); Response.ContentType = "application/csv"; Response.AddHeader("content-disposition", "attachment; filename=" + filename); Response.BinaryWrite(Buffer); Response.Flush(); Response.End(); I have seen from: http://stackoverflow.com/questions/736301/asp-net-how-to-stream-file-to-user reasons to avoid use of Response.End() and Response.Close(). I have also seen several articles about different ways to transmit files and have diagnosed and found a solution to the problem (https and http headers) with a colleague. However, the error message that was being displayed was not about access to the file at path, but the aspx file. Edit: Error message is: Internet Explorer cannot download MyPage.aspx from server.domain.tld Internet Explorer was not able to open this Internet site. The requested site is either unavailable or cannot be found. Please try again later. (page name and address anonymised) Why is this? Is it due to the contents of the file coming from the HTTP response .Flush() method rather than a file being accessed at its address?

    Read the article

  • Tomcat does not pick up the class file - the JSP file is not displayed

    - by blueSky
    I have a Java code which is a controller for a jsp page, called: HomeController.java. Code is as follows: @Controller public class HomeController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/mypage") public String home() { System.out.println("HomeController: Passing through..."); return "home"; } } There is nothing especial in the jsp page: home.jsp. If I go to this url: http://localhost:8080/adcopyqueue/mypage I can view mypage and everything works fine. Also in the tomcat Dos page I can see the comment: HomeController: Passing through... As expected. Now under the same directory that I have HomeController.java, I've created another file called: LoginController.java. Following is the code: @Controller public class LoginController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/loginpage") public String login() { System.out.println("LoginController: Passing through..."); return "login"; } } And under the same place which I have home.jsp, I've created login.jsp. Also under tomcat folders, LoginController.class exists under the same folder that HomeController.class exists and login.jsp exists under the same folder which home.jsp exists. But when I go to this url: http://localhost:8080/adcopyqueue/loginpage Nothing is displayed! I think tomcat does not pick up LoginController.class b/c on the tomcat Dos window, I do NOT see this comment: LoginController: Passing through... Instead I see following which I do not know what do they mean? [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:34) got manifest [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:36) manifest entrie s 8 The structure and the code for HomeController.java and LoginController.java plus the jsp files match. I have no idea why tomcat sees one of the files and not the other? Clean build did not help. Does anybody have any idea? Any help is greatly appraciated.

    Read the article

  • Emacs: Often switching between Emacs and my IDE's editor, how can I 'synch' the file?

    - by WizardOfOdds
    I very often need to do some Emacs magic on some files and I need to go back and forth my IDE (IntelliJ IDEA) and Emacs. When a change is made under Emacs (and after I've saved the file) and I go back to IntelliJ the change appears immediately (if I recall correctly I configured IntelliJ to "always reload file when a modification is detected on disk" or something like that). I don't even need to reload: as soon as IntelliJ IDEA gains focus, it instantly reloads the file (and I hence have immediately access to the modifications I made from Emacs). So far, so very good. However "the other way round", it doesn't work yet. Can I configure Emacs so that everytime a file is changed on disk it reloads it? Or make Emacs, everytime it "gains focus", verify if any file currently opened has been modified on disk? I know I can start modifying the buffer under Emacs and it shall instantly warn that it has been modified, but I'd rather have it do it immediately (for example if I used my IDE to do some big change, when I come back to Emacs what I see may not be at all anymore what the file contains and it's a bit weird).

    Read the article

  • Java installation problem

    - by Zxy
    I cannot install java on my ubuntu 12.04: zero@ghostrider:~$ sudo apt-get purge openjdk* [sudo] password for zero: Reading package lists... Done Building dependency tree Reading state information... Done Note, selecting 'openjdk-6-demo' for regex 'openjdk*' Note, selecting 'openjdk-7-jre-headless' for regex 'openjdk*' Note, selecting 'uwsgi-plugin-jwsgi-openjdk-6' for regex 'openjdk*' Note, selecting 'openjdk-jre' for regex 'openjdk*' Note, selecting 'openjdk-7-source' for regex 'openjdk*' Note, selecting 'openjdk-6-dbg' for regex 'openjdk*' Note, selecting 'openjdk7-jdk' for regex 'openjdk*' Note, selecting 'openjdk-6-doc' for regex 'openjdk*' Note, selecting 'openjdk-7-jre-zero' for regex 'openjdk*' Note, selecting 'openjdk-7-demo' for regex 'openjdk*' Note, selecting 'openjdk-6-jre-headless' for regex 'openjdk*' Note, selecting 'openjdk-6-jdk' for regex 'openjdk*' Note, selecting 'openjdk-6-jre' for regex 'openjdk*' Note, selecting 'openjdk-6-jre-lib' for regex 'openjdk*' Note, selecting 'openjdk-6-jre-zero' for regex 'openjdk*' Note, selecting 'openjdk-7-dbg' for regex 'openjdk*' Note, selecting 'openjdk-7-doc' for regex 'openjdk*' Note, selecting 'openjdk-7-jdk' for regex 'openjdk*' Note, selecting 'openjdk-7-jre' for regex 'openjdk*' Note, selecting 'openjdk-6-source' for regex 'openjdk*' Note, selecting 'openjdk-7-jre-lib' for regex 'openjdk*' Note, selecting 'uwsgi-plugin-jvm-openjdk-6' for regex 'openjdk*' Package uwsgi-plugin-jvm-openjdk-6 is not installed, so not removed Package uwsgi-plugin-jwsgi-openjdk-6 is not installed, so not removed Package openjdk-6-dbg is not installed, so not removed Package openjdk-6-demo is not installed, so not removed Package openjdk-6-doc is not installed, so not removed Package openjdk-6-jdk is not installed, so not removed Package openjdk-6-jre is not installed, so not removed Package openjdk-6-jre-headless is not installed, so not removed Package openjdk-6-jre-lib is not installed, so not removed Package openjdk-6-source is not installed, so not removed Package openjdk-6-jre-zero is not installed, so not removed Package openjdk-7-dbg is not installed, so not removed Package openjdk-7-demo is not installed, so not removed Package openjdk-7-doc is not installed, so not removed Package openjdk-7-jdk is not installed, so not removed Package openjdk-7-jre is not installed, so not removed Package openjdk-7-jre-headless is not installed, so not removed Package openjdk-7-jre-lib is not installed, so not removed Package openjdk-7-jre-zero is not installed, so not removed Package openjdk-7-source is not installed, so not removed 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 1 not fully installed or removed. After this operation, 0 B of additional disk space will be used. Setting up oracle-java7-installer (7u3-0~eugenesan~precise4) ... Downloading... --2012-06-11 23:56:42-- http://download.oracle.com/otn-pub/java/jdk/7u3-b04/jdk- 7u3-linux-i586.tar.gz Resolving download.oracle.com (download.oracle.com)... 64.209.77.18 Connecting to download.oracle.com (download.oracle.com)|64.209.77.18|:80... connected. HTTP request sent, awaiting response... 302 Moved Temporarily Location: https://edelivery.oracle.com/otn-pub/java/jdk/7u3-b04/jdk-7u3-linux-i586.tar.gz [following] --2012-06-11 23:56:42-- https://edelivery.oracle.com/otn-pub/java/jdk/7u3-b04/jdk-7u3-linux-i586.tar.gz Resolving edelivery.oracle.com (edelivery.oracle.com)... 95.101.122.174 Connecting to edelivery.oracle.com (edelivery.oracle.com)|95.101.122.174|:443... connected. HTTP request sent, awaiting response... 302 Moved Temporarily Location: http://download.oracle.com/errors/download-fail-1505220.html [following] --2012-06-11 23:56:44-- http://download.oracle.com/errors/download-fail-1505220.html Connecting to download.oracle.com (download.oracle.com)|64.209.77.18|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 5307 (5.2K) [text/html] Saving to: `./jdk-7u3-linux-i586.tar.gz' 0K ..... 100% 1007K=0.005s 2012-06-11 23:56:44 (1007 KB/s) - `./jdk-7u3-linux-i586.tar.gz' saved [5307/5307] Download done. sha256sum mismatch jdk-7u3-linux-i586.tar.gz Oracle JDK 7 is NOT installed. dpkg: error processing oracle-java7-installer (--configure): subprocess installed post-installation script returned error exit status 1 No apport report written because MaxReports is reached already Errors were encountered while processing: oracle-java7-installer E: Sub-process /usr/bin/dpkg returned an error code (1) zero@ghostrider:~$ sudo add-apt-repository ppa:eugenesan/java You are about to add the following PPA to your system: More info: https://launchpad.net/~eugenesan/+archive/java Press [ENTER] to continue or ctrl-c to cancel adding it Executing: gpg --ignore-time-conflict --no-options --no-default-keyring --secret- keyring /tmp/tmp.uGcZHfsoNF --trustdb-name /etc/apt/trustdb.gpg --keyring /etc/apt/trusted.gpg --primary-keyring /etc/apt/trusted.gpg --keyserver hkp://keyserver.ubuntu.com:80/ --recv 4346FBB158F4022C896164EEE61380B28313A596 gpg: requesting key 8313A596 from hkp server keyserver.ubuntu.com gpg: key 8313A596: "Launchpad synergy+" not changed gpg: Total number processed: 1 gpg: unchanged: 1 zero@ghostrider:~$ sudo apt-get update Ign http://tr.archive.ubuntu.com precise InRelease Ign http://tr.archive.ubuntu.com precise-updates InRelease Ign http://tr.archive.ubuntu.com precise-backports InRelease Hit http://tr.archive.ubuntu.com precise Release.gpg Hit http://tr.archive.ubuntu.com precise-updates Release.gpg Hit http://tr.archive.ubuntu.com precise-backports Release.gpg Hit http://tr.archive.ubuntu.com precise Release Ign http://extras.ubuntu.com precise InRelease Ign http://security.ubuntu.com precise-security InRelease Hit http://tr.archive.ubuntu.com precise-updates Release Ign http://ppa.launchpad.net precise InRelease Hit http://tr.archive.ubuntu.com precise-backports Release Hit http://tr.archive.ubuntu.com precise/main Sources Hit http://tr.archive.ubuntu.com precise/restricted Sources Hit http://tr.archive.ubuntu.com precise/universe Sources Hit http://tr.archive.ubuntu.com precise/multiverse Sources Hit http://tr.archive.ubuntu.com precise/main i386 Packages Hit http://tr.archive.ubuntu.com precise/restricted i386 Packages Hit http://tr.archive.ubuntu.com precise/universe i386 Packages Hit http://extras.ubuntu.com precise Release.gpg Hit http://ppa.launchpad.net precise Release.gpg Hit http://security.ubuntu.com precise-security Release.gpg Hit http://tr.archive.ubuntu.com precise/multiverse i386 Packages Hit http://tr.archive.ubuntu.com precise/main TranslationIndex Hit http://tr.archive.ubuntu.com precise/multiverse TranslationIndex Hit http://tr.archive.ubuntu.com precise/restricted TranslationIndex Hit http://tr.archive.ubuntu.com precise/universe TranslationIndex Hit http://tr.archive.ubuntu.com precise-updates/main Sources Hit http://tr.archive.ubuntu.com precise-updates/restricted Sources Hit http://tr.archive.ubuntu.com precise-updates/universe Sources Hit http://tr.archive.ubuntu.com precise-updates/multiverse Sources Hit http://tr.archive.ubuntu.com precise-updates/main i386 Packages Hit http://extras.ubuntu.com precise Release Hit http://ppa.launchpad.net precise Release Hit http://security.ubuntu.com precise-security Release Hit http://tr.archive.ubuntu.com precise-updates/restricted i386 Packages Hit http://tr.archive.ubuntu.com precise-updates/universe i386 Packages Hit http://tr.archive.ubuntu.com precise-updates/multiverse i386 Packages Hit http://tr.archive.ubuntu.com precise-updates/main TranslationIndex Hit http://tr.archive.ubuntu.com precise-updates/multiverse TranslationIndex Hit http://tr.archive.ubuntu.com precise-updates/restricted TranslationIndex Hit http://tr.archive.ubuntu.com precise-updates/universe TranslationIndex Hit http://tr.archive.ubuntu.com precise-backports/main Sources Hit http://tr.archive.ubuntu.com precise-backports/restricted Sources Hit http://tr.archive.ubuntu.com precise-backports/universe Sources Hit http://tr.archive.ubuntu.com precise-backports/multiverse Sources Hit http://tr.archive.ubuntu.com precise-backports/main i386 Packages Hit http://tr.archive.ubuntu.com precise-backports/restricted i386 Packages Hit http://tr.archive.ubuntu.com precise-backports/universe i386 Packages Hit http://tr.archive.ubuntu.com precise-backports/multiverse i386 Packages Hit http://tr.archive.ubuntu.com precise-backports/main TranslationIndex Hit http://extras.ubuntu.com precise/main Sources Hit http://ppa.launchpad.net precise/main Sources Hit http://security.ubuntu.com precise-security/main Sources Hit http://tr.archive.ubuntu.com precise-backports/multiverse TranslationIndex Hit http://tr.archive.ubuntu.com precise-backports/restricted TranslationIndex Hit http://tr.archive.ubuntu.com precise-backports/universe TranslationIndex Hit http://tr.archive.ubuntu.com precise/main Translation-en Hit http://tr.archive.ubuntu.com precise/multiverse Translation-en Hit http://extras.ubuntu.com precise/main i386 Packages Ign http://extras.ubuntu.com precise/main TranslationIndex Hit http://tr.archive.ubuntu.com precise/restricted Translation-en Hit http://tr.archive.ubuntu.com precise/universe Translation-en Hit http://tr.archive.ubuntu.com precise-updates/main Translation-en Hit http://tr.archive.ubuntu.com precise-updates/multiverse Translation-en Hit http://tr.archive.ubuntu.com precise-updates/restricted Translation-en Hit http://ppa.launchpad.net precise/main i386 Packages Ign http://ppa.launchpad.net precise/main TranslationIndex Hit http://security.ubuntu.com precise-security/restricted Sources Hit http://security.ubuntu.com precise-security/universe Sources Hit http://security.ubuntu.com precise-security/multiverse Sources Hit http://security.ubuntu.com precise-security/main i386 Packages Hit http://security.ubuntu.com precise-security/restricted i386 Packages Hit http://tr.archive.ubuntu.com precise-updates/universe Translation-en Hit http://tr.archive.ubuntu.com precise-backports/main Translation-en Hit http://tr.archive.ubuntu.com precise-backports/multiverse Translation-en Hit http://tr.archive.ubuntu.com precise-backports/restricted Translation-en Hit http://tr.archive.ubuntu.com precise-backports/universe Translation-en Hit http://security.ubuntu.com precise-security/universe i386 Packages Hit http://security.ubuntu.com precise-security/multiverse i386 Packages Hit http://security.ubuntu.com precise-security/main TranslationIndex Hit http://security.ubuntu.com precise-security/multiverse TranslationIndex Hit http://security.ubuntu.com precise-security/restricted TranslationIndex Hit http://security.ubuntu.com precise-security/universe TranslationIndex Hit http://security.ubuntu.com precise-security/main Translation-en Hit http://security.ubuntu.com precise-security/multiverse Translation-en Hit http://security.ubuntu.com precise-security/restricted Translation-en Hit http://security.ubuntu.com precise-security/universe Translation-en Ign http://ppa.launchpad.net precise/main Translation-en_US Ign http://extras.ubuntu.com precise/main Translation-en_US Ign http://ppa.launchpad.net precise/main Translation-en Ign http://extras.ubuntu.com precise/main Translation-en Reading package lists... Done zero@ghostrider:~$ sudo apt-get install oracle-java7-installer Reading package lists... Done Building dependency tree Reading state information... Done oracle-java7-installer is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 1 not fully installed or removed. After this operation, 0 B of additional disk space will be used. Do you want to continue [Y/n]? Y Setting up oracle-java7-installer (7u3-0~eugenesan~precise4) ... Downloading... --2012-06-11 23:57:11-- http://download.oracle.com/otn-pub/java/jdk/7u3-b04/jdk- 7u3-linux-i586.tar.gz Resolving download.oracle.com (download.oracle.com)... 64.209.77.18 Connecting to download.oracle.com (download.oracle.com)|64.209.77.18|:80... connected. HTTP request sent, awaiting response... 302 Moved Temporarily Location: https://edelivery.oracle.com/otn-pub/java/jdk/7u3-b04/jdk-7u3-linux-i586.tar.gz [following] --2012-06-11 23:57:11-- https://edelivery.oracle.com/otn-pub/java/jdk/7u3-b04/jdk-7u3-linux-i586.tar.gz Resolving edelivery.oracle.com (edelivery.oracle.com)... 95.101.122.174 Connecting to edelivery.oracle.com (edelivery.oracle.com)|95.101.122.174|:443... connected. HTTP request sent, awaiting response... 302 Moved Temporarily Location: http://download.oracle.com/errors/download-fail-1505220.html [following] --2012-06-11 23:57:12-- http://download.oracle.com/errors/download-fail-1505220.html Connecting to download.oracle.com (download.oracle.com)|64.209.77.18|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 5307 (5.2K) [text/html] Saving to: `./jdk-7u3-linux-i586.tar.gz' 0K ..... 100% 976K=0.005s 2012-06-11 23:57:12 (976 KB/s) - `./jdk-7u3-linux-i586.tar.gz' saved [5307/5307] Download done. sha256sum mismatch jdk-7u3-linux-i586.tar.gz Oracle JDK 7 is NOT installed. dpkg: error processing oracle-java7-installer (--configure): subprocess installed post-installation script returned error exit status 1 No apport report written because MaxReports is reached already Errors were encountered while processing: oracle-java7-installer E: Sub-process /usr/bin/dpkg returned an error code (1) zero@ghostrider:~$

    Read the article

  • Set umask, set permissions, and set ACL, but SAMBA isn't using those?

    - by Kris Anderson
    I'm running on Ubuntu Server 12.04. I have a folder called Music and I want the default folder permissions to be 775 and the default file to then be 664. I set the default permissions on the Music folder to be 775. I configured ACL to use these default permissions as well: file: Music owner: kris group: kris flags: ss- user::rwx group::rwx other::r-x default:user::rwx default:group::rwx default:other::r-x I also changed the default umask for my user account, kris, to 002 in .profile. Shouldn't and new file/folder now use those permissions when writing to the Samba share? ACL should work with Samba from what I can gather. Currently, if I write to that folder using my mac, folders are getting 755 and files 644. I have another app on my mac called GoodSync which which is able to sync a local directory on my mac to a network samba share, but those permissions are even worse. files are being written as 700 using that program. So it looks like Samba is allowing the host/program to determine the folder/file permissions. What changes do I need to make to force the permissions I want regardless of what the host tries to write on the server?

    Read the article

  • Drag2Up Brings Multi-Source Drag and Drop Uploading to Firefox

    - by ETC
    Last fall we shared Drag2Up with you, a handy little Chrome extension that make it a snap to drag, drop, and upload files to a variety of file sharing sites. Now that same easy sharing is available for Firefox. Just like the Chrome version the Firefox version adds in super simple drag and drop file sharing to your web browsing experience. Drag images, text, and other file types onto any text box and Drag2Up uploads them to the file sharing service you’ve specified in the settings menu such as Imgur, Imageshack, Pastebin, Hotfile, Droplr, and more. Hit up the link below to read more and grab a copy for your Firefox install. Drag2Up [Mozilla Add-ons] Latest Features How-To Geek ETC How To Make Hundreds of Complex Photo Edits in Seconds With Photoshop Actions How to Enable User-Specific Wireless Networks in Windows 7 How to Use Google Chrome as Your Default PDF Reader (the Easy Way) How To Remove People and Objects From Photographs In Photoshop Ask How-To Geek: How Can I Monitor My Bandwidth Usage? Internet Explorer 9 RC Now Available: Here’s the Most Interesting New Stuff Never Call Me at Work [Humorous Star Wars Video] Add an Image Properties Listing to the Context Menu in Chrome and Iron Add an Easy to View Notification Badge to Tabs in Firefox SpellBook Parks Bookmarklets in Chrome’s Context Menu Drag2Up Brings Multi-Source Drag and Drop Uploading to Firefox Enchanted Swing in the Forest Wallpaper

    Read the article

  • Unleash AutoVue on Your Unmanaged Data

    - by [email protected]
    Over the years, I've spoken to hundreds of customers who use AutoVue to collaborate on their "managed" data stored in content management systems, product lifecycle management systems, etc. via our many integrations. Through these conversations I've also learned a harsh reality - we will never fully move away from unmanaged data (desktops, file servers, emails, etc). If you use AutoVue today you already know that even if your primary use is viewing content stored in a content management system, you can still open files stored locally on your computer. But did you know that AutoVue actually has - built-in - a great solution for viewing, printing and redlining your data stored on file servers? Using the 'Server protocol' you can point AutoVue directly to a top-level location on any networked file server and provide your users with a link or shortcut to access an interface similar to the sample page shown below. Many customers link to pages just like this one from their internal company intranets. Through this webpage, users can easily search and browse through file server data with a 'click-and-view' interface to find the specific image, document, drawing or model they're looking for. Any markups created on a document will be accessible to everyone else viewing that document and of course real-time collaboration is supported as well. Customers on maintenance can consult the AutoVue Admin guide or My Oracle Support Doc ID 753018.1 for an introduction to the server protocol. Contact your local AutoVue Solutions Consultant for help setting up the sample shown above.

    Read the article

  • Setting different default applications for different Desktop Environment

    - by Anwar
    I am using Ubuntu 12.04 with default Unity interface. I installed later the KDE desktop, XFCE, LXDE, gnome-shell and Cinnamon. The KDE comes with different default applications than Unity, such as kwrite for text editing, konsole as virtual terminal, kfontview for font viewing and installing, dolphin as File browser etc. Other DE come with some other default applications. The problem arises when you want to open a file such as a text file, with which can both be opened by gedit and kwrite, I want to use kwrite on KDE and gedit on Unity or Gnome. But, there is no way to set like this. I can set default application for text file by changing respective settings in both KDE and Unity, but It become default for both DE. For example, If I set kfontviewer as default font viewing application in KDE, it also opens fonts when I am in Unity or Gnome and vice versa. This is a problem because, loading other DE's program takes long time than the default one for the used DE. My question is: Can I use different default applications for different DE? How?

    Read the article

  • Web browser downloads only open target folders - cannot open files

    - by Pavlos G.
    After installing xubuntu packages in order to check xfce, I reverted back to gnome2. During the first login, I noticed that thunar was now selected as the default file manager. Preferred applications menu is also missing now, so I could not set nautilus as the default. I removed all the xubuntu packages (including thunar) and then when I tried to open a folder, I was asked to select the default file manager - that's how I got nautilus back. The next problem I'm now facing has to do with the downloaded files from web browsers: Open and Open containing folder options produce exactly the same result. If I double-click on a file, it'll just open the containing folder, instead of opening the file with it's associated application (e.g. libreoffice writer for .doc,.odt, smplayer for .avi,.wmv, etc). The problem happens both in Firefox and Chrome. Through nautilus, all files open correctly. Up until now I've tried the following: Delete/recreate mimeTypes.rdf in my FF profile Create a new profile in FF Delete/recreate ~/.local/share/applications/mimeapps.list Already checked this similar article None of them worked. Any ideas on the issue would be appreciated.

    Read the article

  • Any good reason open files in text mode?

    - by Tinctorius
    (Almost-)POSIX-compliant operating systems and Windows are known to distinguish between 'binary mode' and 'text mode' file I/O. While the former mode doesn't transform any data between the actual file or stream and the application, the latter 'translates' the contents to some standard format in a platform-specific manner: line endings are transparently translated to '\n' in C, and some platforms (CP/M, DOS and Windows) cut off a file when a byte with value 0x1A is found. These transformations seem a little useless to me. People share files between computers with different operating systems. Text mode would cause some data to be handled differently across some platforms, so when this matters, one would probably use binary mode instead. As an example: while Windows uses the sequence CR LF to end a line in text mode, UNIX text mode will not treat CR as part of the line ending sequence. Applications would have to filter that noise themselves. Older Mac versions only use CR in text mode as line endings, so neither UNIX nor Windows would understand its files. If this matters, a portable application would probably implement the parsing by itself instead of using text mode. Implementing newline interpretation in the parser might also remove some overhead of using text mode, as buffers would need to be rewritten (and possibly resized) before returning to the application, while this may be less efficient than when it would happen in the application instead. So, my question is: is there any good reason to still rely on the host OS to translate line endings and file truncation?

    Read the article

  • Packing up files on my machine, sending it to a server, and unpacking it

    - by MxyL
    I am implementing a feature in my application that sends all files in a specified folder to a server. I have the basic FTP transaction set up using Apache Commons FTPClient: it sets up a connection and transfers a file from one place to another. So I can simply loop over the directory and use this connection to transfer all the files. However, this could be better. Rather than transferring each file one by one, it makes more sense to pack it up in a compressed archive and then send the whole file at once. Saves time and bandwidth, since these are just text files so they compress nicely. So I would like to add automatic archive packing and unpacking. This is the workflow I have planned out, using zip compression: Zip all files in the folder Send the file over Unzip the files at its destination 1 and 2 are easy since the files are on the local machine, but I'm not sure how to accomplish the last step, when the files are now on a remote server. What are my options? I have control over what I can put and run on the server. Perhaps it is not necessary to do the packing/unpacking myself?

    Read the article

  • Any good reason to open files in text mode?

    - by Tinctorius
    (Almost-)POSIX-compliant operating systems and Windows are known to distinguish between 'binary mode' and 'text mode' file I/O. While the former mode doesn't transform any data between the actual file or stream and the application, the latter 'translates' the contents to some standard format in a platform-specific manner: line endings are transparently translated to '\n' in C, and some platforms (CP/M, DOS and Windows) cut off a file when a byte with value 0x1A is found. These transformations seem a little useless to me. People share files between computers with different operating systems. Text mode would cause some data to be handled differently across some platforms, so when this matters, one would probably use binary mode instead. As an example: while Windows uses the sequence CR LF to end a line in text mode, UNIX text mode will not treat CR as part of the line ending sequence. Applications would have to filter that noise themselves. Older Mac versions only use CR in text mode as line endings, so neither UNIX nor Windows would understand its files. If this matters, a portable application would probably implement the parsing by itself instead of using text mode. Implementing newline interpretation in the parser might also remove some overhead of using text mode, as buffers would need to be rewritten (and possibly resized) before returning to the application, while this may be less efficient than when it would happen in the application instead. So, my question is: is there any good reason to still rely on the host OS to translate line endings and file truncation?

    Read the article

  • Unable to rename file with c# ftp methods when current user directory is different from root

    - by Agata
    Hello everyone, Remark: due to spam prevention mechanizm I was forced to replace the beginning of the Uris from ftp:// to ftp. I've got following problem. I have to upload file with C# ftp method and afterwards rename it. Easy, right? :) Ok, let's say my ftp host is like this: ftp.contoso.com and after logging in, current directory is set to: users/name So, what I'm trying to achieve is to log in, upload file to current directory as file.ext.tmp and after upload is successful, rename the file to file.ext The whole difficulty is, as I guess, to properly set the request Uri for FtpWebRequest. MSDN states: The URI may be relative or absolute. If the URI is of the form "ftp://contoso.com/%2fpath" (%2f is an escaped '/'), then the URI is absolute, and the current directory is /path. If, however, the URI is of the form "ftp://contoso.com/path", first the .NET Framework logs into the FTP server (using the user name and password set by the Credentials property), then the current directory is set to UserLoginDirectory/path. Ok, so I upload file with the following URI: ftp.contoso.com/file.ext.tmp Great, the file lands where I wanted it to be: in directory "users/name" Now, I want to rename the file, so I create web request with following Uri: ftp.contoso.com/file.ext.tmp and specify rename to parameter as: file.ext and this gives me 550 error: file not found, no permissions, etc. I traced this in Microsoft Network Monitor and it gave me: Command: RNFR, Rename from CommandParameter: /file.ext.tmp Ftp: Response to Port 53724, '550 File /file.ext.tmp not found' as if it was looking for the file in the root directory - not in the current directory. I renamed the file manually using Total Commander and the only difference was that CommandParameter was without the first slash: CommandParameter: file.ext.tmp I'm able to successfully rename the file by supplying following absolute URI: ftp.contoso.com/%2fusers/%2fname/file.ext.tmp but I don't like this approach, since I would have to know the name of current user's directory. It can probably be done by using WebRequestMethods.Ftp.PrintWorkingDirectory, but it adds extra complexity (calling this method to retrieve directory name, then combining the paths to form proper URI). What I don't understand is why the URI ftp.contoso.com/file.ext.tmp is good for upload and not for rename? Am I missing something here? The project is set to .NET 4.0, coded in Visual Studio 2010.

    Read the article

  • How to count differences between two files on linux?

    - by Zsolt Botykai
    Hi all, I need to work with large files and must find differences between two. And I don't need the different bits, but the number of differences. For the differ rows I come up with diff --suppress-common-lines --speed-large-files -y File1 File2 | wc -l And it works, but is there a better way to do it? And how to count the exact number of differences (with standard tools like bash, diff, awk, sed some old version of perl)? Thanks in advance

    Read the article

  • Download And Install apk from a link.

    - by rayman
    Hi, I`am trying to download and install an apk from some link, but for some reason i get an exception. I have one method downloadfile() which downloading the file and a call to and installFile() method, which supposed to install it in the device. some code: public void downloadFile() { String fileName = "someApplication.apk"; MsgProxyLogger.debug(TAG, "TAG:Starting to download"); try { URL u = new URL( "http://10.122.233.22/test/someApplication.apk"); try { HttpURLConnection c = (HttpURLConnection) u.openConnection(); try { c.setRequestMethod("GET"); c.setDoOutput(true); try { c.connect(); FileOutputStream f = context.openFileOutput(fileName, context.MODE_WORLD_READABLE); try { InputStream in = c.getInputStream(); byte[] buffer = new byte[1024]; int len1 = 0; int totsize = 0; try { while ((len1 = in.read(buffer)) > 0) { totsize += len1; f.write(buffer, 0, len1);// .write(buffer); } } catch (IOException e) { e.printStackTrace(); } f.close(); MsgProxyLogger.debug(TAG, TAG + ":Saved file with name: " + fileName); InstallFile(fileName); } catch (IOException e) { e.printStackTrace(); } } catch (IOException e) { e.printStackTrace(); } } catch (ProtocolException e) { e.printStackTrace(); } } catch (IOException e) { e.printStackTrace(); } } catch (MalformedURLException e) { e.printStackTrace(); } } and this is the install file method: private void InstallFile(String fileName) { MsgProxyLogger.debug(TAG, TAG + ":Installing file " + fileName); String src = String.format( "file:///data/data/com.test/files/", fileName); Uri mPackageURI = Uri.parse(src); PackageManager pm = context.getPackageManager(); int installFlags = 0; try { PackageInfo pi = pm.getPackageInfo("com.mirs.agentcore.msgproxy", PackageManager.GET_UNINSTALLED_PACKAGES); if (pi != null) { MsgProxyLogger.debug(TAG, TAG + ":replacing " + fileName); installFlags |= PackageManager.REPLACE_EXISTING_PACKAGE; } } catch (NameNotFoundException e) { } try { // PackageInstallObserver observer = new PackageInstallObserver(); pm.installPackage(mPackageURI); } catch (SecurityException e) { //!!!!!!!!!!!!!here i get an security exception!!!!!!!!!!! MsgProxyLogger.debug(TAG, TAG + ":not permission? " + fileName); } this is the exception details: "Neither user 10057 nor current process has android.permission.INSTALL_PACKAGES". and i have set in my main app that permission in the manifest. anyone has any idea? thanks, ray.

    Read the article

  • python getelementbyid from string

    - by matthewgall
    Hey, I have the following program, that is trying to upload a file (or files) to an image upload site, however I am struggling to find out how to parse the returned HTML to grab the direct link (contained in a ). I have the code below: #!/usr/bin/python # -*- coding: utf-8 -*- import pycurl import urllib import urlparse import xml.dom.minidom import StringIO import sys import gtk import os import imghdr import locale import gettext try: import pynotify except: print "Please install pynotify." APP="Uploadir Uploader" DIR="locale" locale.setlocale(locale.LC_ALL, '') gettext.bindtextdomain(APP, DIR) gettext.textdomain(APP) _ = gettext.gettext ##STRINGS uploading = _("Uploading image to Uploadir.") oneimage = _("1 image has been successfully uploaded.") multimages = _("images have been successfully uploaded.") uploadfailed = _("Unable to upload to Uploadir.") class Uploadir: def __init__(self, args): self.images = [] self.urls = [] self.broadcasts = [] self.username="" self.password="" if len(args) == 1: return else: for file in args: if file == args[0] or file == "": continue if file.startswith("-u"): self.username = file.split("-u")[1] #print self.username continue if file.startswith("-p"): self.password = file.split("-p")[1] #print self.password continue self.type = imghdr.what(file) self.images.append(file) for file in self.images: self.upload(file) self.setClipBoard() self.broadcast(self.broadcasts) def broadcast(self, l): try: str = '\n'.join(l) n = pynotify.Notification(str) n.set_urgency(pynotify.URGENCY_LOW) n.show() except: for line in l: print line def upload(self, file): #Try to login cookie_file_name = "/tmp/uploadircookie" if ( self.username!="" and self.password!=""): print "Uploadir authentication in progress" l=pycurl.Curl() loginData = [ ("username",self.username),("password", self.password), ("login", "Login") ] l.setopt(l.URL, "http://uploadir.com/user/login") l.setopt(l.HTTPPOST, loginData) l.setopt(l.USERAGENT,"User-Agent: Uploadir (Python Image Uploader)") l.setopt(l.FOLLOWLOCATION,1) l.setopt(l.COOKIEFILE,cookie_file_name) l.setopt(l.COOKIEJAR,cookie_file_name) l.setopt(l.HEADER,1) loginDataReturnedBuffer = StringIO.StringIO() l.setopt( l.WRITEFUNCTION, loginDataReturnedBuffer.write ) if l.perform(): self.broadcasts.append("Login failed. Please check connection.") l.close() return loginDataReturned = loginDataReturnedBuffer.getvalue() l.close() #print loginDataReturned if loginDataReturned.find("<li>Your supplied username or password is invalid.</li>")!=-1: self.broadcasts.append("Uploadir authentication failed. Username/password invalid.") return else: self.broadcasts.append("Uploadir authentication successful.") #cookie = loginDataReturned.split("Set-Cookie: ")[1] #cookie = cookie.split(";",0) #print cookie c = pycurl.Curl() values = [ ("file", (c.FORM_FILE, file)) ] buf = StringIO.StringIO() c.setopt(c.URL, "http://uploadir.com/file/upload") c.setopt(c.HTTPPOST, values) c.setopt(c.COOKIEFILE, cookie_file_name) c.setopt(c.COOKIEJAR, cookie_file_name) c.setopt(c.WRITEFUNCTION, buf.write) if c.perform(): self.broadcasts.append(uploadfailed+" "+file+".") c.close() return self.result = buf.getvalue() #print self.result c.close() doc = urlparse.urlparse(self.result) self.urls.append(doc.getElementsByTagName("download")[0].childNodes[0].nodeValue) def setClipBoard(self): c = gtk.Clipboard() c.set_text('\n'.join(self.urls)) c.store() if len(self.urls) == 1: self.broadcasts.append(oneimage) elif len(self.urls) != 0: self.broadcasts.append(str(len(self.urls))+" "+multimages) if __name__ == '__main__': uploadir = Uploadir(sys.argv) Any help would be gratefully appreciated. Warm regards,

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to upload a file into database by using Servlet?

    - by user1765496
    Hi all iam working on servlets, so i need to upload a file by using servlet as follows my code. package com.limrasoft.image.servlets; import java.io.*; import javax.servlet.*; import javax.servlet.http.*; import javax.servlet.annotation.*; import java.sql.*; @WebServlet(name="serv1",value="/s1") public class Account extends HttpServlet{ public void doPost(HttpServletRequest req,HttpServletResponse res)throws ServletException,IOException{ try{ Class.forName("oracle.jdbc.driver.OracleDriver"); Connecection con=null; try{ con=DriverManager.getConnection("jdbc:oracle:thin:@localhost:1521:xe","system","sajid"); PrintWriter pw=res.getWriter(); res.setContentType("text/html"); String s1=req.getParameter("un"); string s2=req.getParameter("pwd"); String s3=req.getParameter("g"); String s4=req.getParameter("uf"); PreparedStatement ps=con.prepareStatement("insert into account(?,?,?,?)"); ps.setString(1,s1); ps.setString(2,s2); ps.setString(3,s3); File file=new File("+s4+"); FileInputStream fis=new FileInputStream(fis); int len=(int)file.length(); ps.setBinaryStream(4,fis,len); int c=ps.executeUpdate(); if(c==0){pw.println("<h1>Registratin fail");} else{pw.println("<h1>Registration fail");} } finally{if(con!=null)con.close();} } catch(ClassNotFoundException ce){pw.println("<h1>Registration Fail");} catch(SQLException se){pw.println("<h1>Registration Fail");} pw.flush(); pw.close(); } } I have written the above code for file upload into database, but it giving error as "HTTP Status 500 - Servlet3.java (The system cannot find the file specified)" Could you plz help me to do this code,thanks in advanse.

    Read the article

  • WiX 3 Tutorial: Generating file/directory fragments with Heat.exe

    - by Mladen Prajdic
    In previous posts I’ve shown you our SuperForm test application solution structure and how the main wxs and wxi include file look like. In this post I’ll show you how to automate inclusion of files to install into your build process. For our SuperForm application we have a single exe to install. But in the real world we have 10s or 100s of different files from dll’s to resource files like pictures. It all depends on what kind of application you’re building. Writing a directory structure for so many files by hand is out of the question. What we need is an automated way to create this structure. Enter Heat.exe. Heat is a command line utility to harvest a file, directory, Visual Studio project, IIS website or performance counters. You might ask what harvesting means? Harvesting is converting a source (file, directory, …) into a component structure saved in a WiX fragment (a wxs) file. There are 2 options you can use: Create a static wxs fragment with Heat and include it in your project. The pro of this is that you can add or remove components by hand. The con is that you have to do the pro part by hand. Automation always beats manual labor. Run heat command line utility in a pre-build event of your WiX project. I prefer this way. By always recreating the whole fragment you don’t have to worry about missing any new files you add. The con of this is that you’ll include files that you otherwise might not want to. There is no perfect solution so pick one and deal with it. I prefer using the second way. A neat way of overcoming the con of the second option is to have a post-build event on your main application project (SuperForm.MainApp in our case) to copy the files needed to be installed in a special location and have the Heat.exe read them from there. I haven’t set this up for this tutorial and I’m simply including all files from the default SuperForm.MainApp \bin directory. Remember how we created a System Environment variable called SuperFormFilesDir? This is where we’ll use it for the first time. The command line text that you have to put into the pre-build event of your WiX project looks like this: "$(WIX)bin\heat.exe" dir "$(SuperFormFilesDir)" -cg SuperFormFiles -gg -scom -sreg -sfrag -srd -dr INSTALLLOCATION -var env.SuperFormFilesDir -out "$(ProjectDir)Fragments\FilesFragment.wxs" After you install WiX you’ll get the WIX environment variable. In the pre/post-build events environment variables are referenced like this: $(WIX). By using this you don’t have to think about the installation path of the WiX. Remember: for 32 bit applications Program files folder is named differently between 32 and 64 bit systems. $(ProjectDir) is obviously the path to your project and is a Visual Studio built in variable. You can view all Heat.exe options by running it without parameters but I’ll explain some that stick out the most. dir "$(SuperFormFilesDir)": tell Heat to harvest the whole directory at the set location. That is the location we’ve set in our System Environment variable. –cg SuperFormFiles: the name of the Component group that will be created. This name is included in out Feature tag as is seen in the previous post. -dr INSTALLLOCATION: the directory reference this fragment will fall under. You can see the top level directory structure in the previous post. -var env.SuperFormFilesDir: the name of the variable that will replace the SourceDir text that would otherwise appear in the fragment file. -out "$(ProjectDir)Fragments\FilesFragment.wxs": the full path and name under which the fragment file will be saved. If you have source control you have to include the FilesFragment.wxs into your project but remove its source control binding. The auto generated FilesFragment.wxs for our test app looks like this: <?xml version="1.0" encoding="utf-8"?><Wix xmlns="http://schemas.microsoft.com/wix/2006/wi"> <Fragment> <ComponentGroup Id="SuperFormFiles"> <ComponentRef Id="cmp5BB40DB822CAA7C5295227894A07502E" /> <ComponentRef Id="cmpCFD331F5E0E471FC42A1334A1098E144" /> <ComponentRef Id="cmp4614DD03D8974B7C1FC39E7B82F19574" /> <ComponentRef Id="cmpDF166522884E2454382277128BD866EC" /> </ComponentGroup> </Fragment> <Fragment> <DirectoryRef Id="INSTALLLOCATION"> <Component Id="cmp5BB40DB822CAA7C5295227894A07502E" Guid="{117E3352-2F0C-4E19-AD96-03D354751B8D}"> <File Id="filDCA561ABF8964292B6BC0D0726E8EFAD" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.exe" /> </Component> <Component Id="cmpCFD331F5E0E471FC42A1334A1098E144" Guid="{369A2347-97DD-45CA-A4D1-62BB706EA329}"> <File Id="filA9BE65B2AB60F3CE41105364EDE33D27" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.pdb" /> </Component> <Component Id="cmp4614DD03D8974B7C1FC39E7B82F19574" Guid="{3443EBE2-168F-4380-BC41-26D71A0DB1C7}"> <File Id="fil5102E75B91F3DAFA6F70DA57F4C126ED" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.vshost.exe" /> </Component> <Component Id="cmpDF166522884E2454382277128BD866EC" Guid="{0C0F3D18-56EB-41FE-B0BD-FD2C131572DB}"> <File Id="filF7CA5083B4997E1DEC435554423E675C" KeyPath="yes" Source="$(env.SuperFormFilesDir)\SuperForm.MainApp.vshost.exe.manifest" /> </Component> </DirectoryRef> </Fragment></Wix> The $(env.SuperFormFilesDir) will be replaced at build time with the directory where the files to be installed are located. There is nothing too complicated about this. In the end it turns out that this sort of automation is great! There are a few other ways that Heat.exe can compose the wxs file but this is the one I prefer. It just seems the clearest. Play with its options to see what can it do. It’s one awesome little tool.   WiX 3 tutorial by Mladen Prajdic navigation WiX 3 Tutorial: Solution/Project structure and Dev resources WiX 3 Tutorial: Understanding main wxs and wxi file WiX 3 Tutorial: Generating file/directory fragments with Heat.exe

    Read the article

  • Send large JSON data to WCF Rest Service

    - by Christo Fur
    Hi I have a client web page that is sending a large json object to a proxy service on the same domain as the web page. The proxy (an ashx handler) then forwards the request to a WCF Rest Service. Using a WebClient object (standard .net object for making a http request) The JSON successfully arrives at the proxy via a jQuery POST on the client webpage. However, when the proxy forwards this to the WCF service I get a Bad Request - Error 400 This doesn't happen when the size of the json data is small The WCF service contract looks like this [WebInvoke(Method = "POST", BodyStyle = WebMessageBodyStyle.Wrapped, RequestFormat = WebMessageFormat.Json, ResponseFormat = WebMessageFormat.Json)] [OperationContract] CarConfiguration CreateConfiguration(CarConfiguration configuration); And the DataContract like this [DataContract(Namespace = "")] public class CarConfiguration { [DataMember(Order = 1)] public int CarConfigurationId { get; set; } [DataMember(Order = 2)] public int UserId { get; set; } [DataMember(Order = 3)] public string Model { get; set; } [DataMember(Order = 4)] public string Colour { get; set; } [DataMember(Order = 5)] public string Trim { get; set; } [DataMember(Order = 6)] public string ThumbnailByteData { get; set; } [DataMember(Order = 6)] public string Wheel { get; set; } [DataMember(Order = 7)] public DateTime Date { get; set; } [DataMember(Order = 8)] public List<string> Accessories { get; set; } [DataMember(Order = 9)] public string Vehicle { get; set; } [DataMember(Order = 10)] public Decimal Price { get; set; } } When the ThumbnailByteData field is small, all is OK. When it is large I get the 400 error What are my options here? I've tried increasing the MaxBytesRecived config setting but that is not enough Any ideas?

    Read the article

  • Silverlight: Download local files with WebClient

    - by David
    The directory structure of my Silverlight project is like the following: \Bin - MainModule.xap - \Images --- Image1.png --- Image2.png - \Modules --- SubModule.xap I want to be able to run it through either a web server or through Visual Studio directly (for debugging purposes I want to bypass content downloading). In my media loading code I do something like the following: if (runningLocally) { var bitmapImage = new BitmapImage(); bitmapImage.UriSource = new Uri("Images/Image1.png", UriKind.Relative); var image = new Image(); image.Source = bitmapImage; } else { WebClient wc = new WebClient(); wc.OpenReadCompleted += (s, e) => { var bitmapImage = new BitmapImage(); bitmapImage.SetSource(e.Result); var image = new Image(); image.Source = bitmapImage; }; wc.OpenReadAsync(new Uri("Images/Image1.png", UriKind.Relative)); } This works for images but I also have sub-modules which are just assemblies housing UserControls. Since Silverlight has no ability to read disk I've resigned myself to the fact that I'm going to have to "download" the XAPs I need whether I'm running locally or not. Problem is if I run the project locally and try to use a WebClient to download a XAP I get an exception: System.Net.WebException: An exception occurred during a WebClient request. ---> System.NotSupportedException: The URI prefix is not recognized. Is there any way (WebClient or otherwise) I can get to my sub-module XAPs when running the Silverlight project directly rather than hitting a web server?

    Read the article

  • Text mining on large database (data mining)

    - by yox
    Hello, I have a large database of resumes (CV), and a certain table skills grouping all users skills. inside that table there's a field skill_text that describes the skill in full text. I'm looking for an algorithm/software/method to extract significant terms/phrases from that table in order to build a new table with standarized skills.. Here are some examples skills extracted from the DB : Sectoral and competitive analysis Business Development (incl. in international settings) Specific structure and road design software - Microstation, Macao, AutoCAD (basic knowledge) Creative work (Photoshop, In-Design, Illustrator) checking and reporting back on campaign progress organising and attending events and exhibitions Development : Aptana Studio, PHP, HTML, CSS, JavaScript, SQL, AJAX Discipline: One to one marketing, E-marketing (SEO & SEA, display, emailing, affiliate program) Mix marketing, Viral Marketing, Social network marketing. The output shoud be something like : Sectoral and competitive analysis Business Development Specific structure and road design software - Macao AutoCAD Photoshop In-Design Illustrator organising events Development Aptana Studio PHP HTML CSS JavaScript SQL AJAX Mix marketing Viral Marketing Social network marketing emailing SEO One to one marketing As you see only skills remains no other representation text. I know this is possible using text mining technics but how to do it ? the database is realy large.. it's a good thing because we can calculate text frequency and decide if it's a real skill or just meaningless text... The big problem is .. how to determin that "blablabla" is a skill ? thanks

    Read the article

  • Make user download pdf instead of saving to a location

    - by chupinette
    Hello!I was trying out the following code which actually saves the pdf file to C:/xampp/ I want to create a link so that when the user clicks on it. It prompts it to save the pdf file. <?php // create handle for new PDF document $pdf = pdf_new(); // open a file pdf_open_file($pdf, "try1.pdf"); // start a new page (A4) pdf_begin_page($pdf, 595, 842); pdf_set_parameter($pdf, 'FontOutline', 'Arial=c:\windows\fonts\arial.ttf'); // get and use a font object $font = pdf_findfont($pdf, "Arial", "host", 1); pdf_setfont($pdf, $font, 10); // print text pdf_show_xy($pdf, "There are more things in heaven and earth, Horatio,", 50, 750); pdf_show_xy($pdf, "than are dreamt of in your philosophy", 50, 730); // add an image under the text //$image = pdf_open_image_file($pdf, "jpeg", "shakespeare.jpg"); pdf_place_image($pdf, $image, 50, 650, 0.25); // end page pdf_end_page($pdf); // close and save file pdf_close($pdf); ?>

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >