Search Results

Search found 4587 results on 184 pages for 'wow 22'.

Page 148/184 | < Previous Page | 144 145 146 147 148 149 150 151 152 153 154 155  | Next Page >

  • Missing trailing / for admin page edits in django-cms

    - by 47
    I've managed to set up Django CMS for my website successfully...however, when editing a page in the admin, the trailing / isn't added automatically so my URL's look something like: http://localhost:8000/admin/cms/page/22 When I tried running the example project that comes bundled with the Django-CMS setup, this slash is added automatically....how can I have the same for my project?

    Read the article

  • get values from table as key value pairs with jquery

    - by liz
    I have a table: <table class="datatable" id="hosprates"> <caption> hospitalization rates test</caption> <thead> <tr> <th scope="col">Funding Source</th> <th scope="col">Alameda County</th> <th scope="col">California</th> </tr> </thead> <tbody> <tr> <th scope="row">Medi-Cal</th> <td>34.3</td> <td>32.3</td> </tr> <tr> <th scope="row">Private</th> <td>32.2</td> <td>34.2</td> </tr> <tr> <th scope="row">Other</th> <td>22.7</td> <td>21.7</td> </tr> </tbody> </table> i want to retrieve column 1 and column 2 values per row as pairs that end up looking like this [funding,number],[funding,number] i did this so far, but when i alert it, it only shows [object, object]... var myfunding = $('#hosprates tbody tr').each(function(){ var funding = new Object(); funding.name = $('#hosprates tbody tr td:nth-child(1)').map(function() { return $(this).text().match(/\S+/)[0]; }).get(); funding.value= $('#hosprates tbody tr td:nth-child(2)').map(function() { return $(this).text().match(/\S+/)[0]; }).get(); }); alert (myfunding);

    Read the article

  • C# Detect Localhost Port Usage

    - by ThaKidd
    In advance, thank you for your advice. I am currently working on a program which uses Putty to create a SSH connection with a server that uses local port forwarding to enable a client, running my software, to access the service behind the SSH server via localhost. IE: client:20100 - Internet - Remote SSH server exposed via router/firewall - Local Intranet - Intranet Web POP3 Server:110. Cmd Line: "putty -ssh -2 -P 22 -C -L 20100:intranteIP:110 -pw sshpassword sshusername@sshserver" Client would use putty to create a SSH connection with the SSH server specifying in the connection string that it would like to tie port 110 of the Intranet POP3 Server to port 20100 on the client system. Therefore the client would be able to open up a mail client to localhost:20100 and interact with the Internal POP3 server over the SSH tunnel. The above is a general description. I already know what I am trying to do will work without a problem so am not looking for debate on the above. The question is this...How can I ensure the local port (I cannot use dynamic ports, so it must be static) on localhost is not being used or listened to by any other application? I am currently executing this code in my C# app: private bool checkPort(int port) { try { //Create a socket on the current IPv4 address Socket TestSocket = new Socket(AddressFamily.InterNetwork, SocketType.Stream, ProtocolType.Tcp); // Create an IP end point IPEndPoint localIP = new IPEndPoint(IPAddress.Parse("127.0.0.1"), port); // Bind that port TestSocket.Bind(localIP); // Cleanup TestSocket.Close(); return false; } catch (Exception e) { // Exception occurred. Port is already bound. return true; } } I am currently calling this function starting with a specific port in a for loop to get the 'false' return at the first available port. The first port I try is actually being listened to by uTorrent. The above code does not catch this and my connection fails. What is the best method to ensure a port is truly free? I do understand some other program may grab the port during/after I have tested it. I just need to find something that will ensure it is not currently in use AT ALL when the test is executed. If there is a way to truly reserve the localhost port during the test, I would love to hear about it.

    Read the article

  • How to generate and encode (for use in GA), random, strict, binary rooted trees with N leaves?

    - by Peter Simon
    First, I am an engineer, not a computer scientist, so I apologize in advance for any misuse of nomenclature and general ignorance of CS background. Here is the motivational background for my question: I am contemplating writing a genetic algorithm optimizer to aid in designing a power divider network (also called a beam forming network, or BFN for short). The BFN is intended to distribute power to each of N radiating elements in an array of antennas. The fraction of the total input power to be delivered to each radiating element has been specified. Topologically speaking, a BFN is a strictly binary, rooted tree. Each of the (N-1) interior nodes of the tree represents the input port of an unequal, binary power splitter. The N leaves of the tree are the power divider outputs. Given a particular power divider topology, one is still free to map the power divider outputs to the array inputs in an arbitrary order. There are N! such permutations of the outputs. There are several considerations in choosing the desired ordering: 1) The power ratio for each binary coupler should be within a specified range of values. 2) The ordering should be chosen to simplify the mechanical routing of the transmission lines connecting the power divider. The number of ouputs N of the BFN may range from, say, 6 to 22. I have already written a genetic algorithm optimizer that, given a particular BFN topology and desired array input power distribution, will search through the N! permutations of the BFN outputs to generate a design with compliant power ratios and good mechanical routing. I would now like to generalize my program to automatically generate and search through the space of possible BFN topologies. As I understand it, for N outputs (leaves of the binary tree), there are $C_{N-1}$ different topologies that can be constructed, where $C_N$ is the Catalan number. I would like to know how to encode an arbitrary tree having N leaves in a way that is consistent with a chromosomal description for use in a genetic algorithm. Also associated with this is the need to generate random instances for filling the initial population, and to implement crossover and mutations operators for this type of chromosome. Any suggestions will be welcome. Please minimize the amount of CS lingo in your reply, since I am not likely to be acquainted with it. Thanks in advance, Peter

    Read the article

  • JSONArray does not work when I am getting the JSON string from the server

    - by Taehoon A Kim
    I've looked up some answers but am not sure why mine is failing exactly... The code looks something like this HttpResponse httpResponse = httpClient.execute(httpPost); HttpEntity httpEntity = httpResponse.getEntity(); String json = EntityUtils.toString(httpEntity); //Convert to JsonArray JSONArray jsonArray = new JSONArray(json); Log.i(DEBUG_TAG, Integer.toString(jsonArray.length())); for (int i = 0; i < jsonArray.length(); i++) { JSONObject jsonObject = jsonArray.getJSONObject(i); Log.i(DEBUG_TAG, jsonObject.getString(KEY_ID)); // creating new HashMap HashMap<String, String> map = new HashMap<String, String>(); // adding each child node to HashMap key => value map.put(KEY_ID, jsonObject.getString(KEY_ID)); map.put(KEY_TITLE, jsonObject.getString(KEY_TITLE)); map.put(KEY_ARTIST, jsonObject.getString(KEY_ARTIST)); map.put(KEY_DURATION, jsonObject.getString(KEY_DURATION)); map.put(KEY_VOTECOUNT, jsonObject.getString(KEY_VOTECOUNT)); map.put(KEY_THUMB_URL, jsonObject.getString(KEY_THUMB_URL)); map.put(KEY_GENRE, jsonObject.getString(KEY_GENRE)); //Adding map to ArrayList if (Integer.parseInt(jsonObject.getString(KEY_VOTECOUNT)) == -1){ //If VoteCount is -1 then add to header headerList.add(map); }else { songsList.add(map); } } } catch (UnsupportedEncodingException e) { e.printStackTrace(); } catch (ClientProtocolException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } When I run logcat on String json, it seems to show correct info which is kind of like this... { "userdata": [ { "id": "8", "title": "Baby One More Time", "artist": "Britney Spears", "duration": "03:24:00", "votes": "0", "thumb_url": "http://api.androidhive.info/music/images/dido.png", "genre": null }, { "id": "2", "title": "As Long As You Love Me", "artist": "Justin Bieber", "duration": "05:26:00", "votes": "0", "thumb_url": "http://api.androidhive.info/music/images/enrique.png", "genre": "Rock" } ] } and the logcat on JSONArray jsonArray = new JSONArray(json); tells me that jsonArray.length() 10-31 22:57:28.433: W/CustomizedListView(26945): error! Invalid index 0, size is 0 Please let me know Thank you,

    Read the article

  • Initialization of components with interdependencies - possible antipattern?

    - by Rosarch
    I'm writing a game that has many components. Many of these are dependent upon one another. When creating them, I often get into catch-22 situations like "WorldState's constructor requires a PathPlanner, but PathPlanner's constructor requires WorldState." Originally, this was less of a problem, because references to everything needed were kept around in GameEngine, and GameEngine was passed around to everything. But I didn't like the feel of that, because it felt like we were giving too much access to different components, making it harder to enforce boundaries. Here is the problematic code: /// <summary> /// Constructor to create a new instance of our game. /// </summary> public GameEngine() { graphics = new GraphicsDeviceManager(this); Components.Add(new GamerServicesComponent(this)); //Sets dimensions of the game window graphics.PreferredBackBufferWidth = 800; graphics.PreferredBackBufferHeight = 600; graphics.ApplyChanges(); IsMouseVisible = true; screenManager = new ScreenManager(this); //Adds ScreenManager as a component, making all of its calls done automatically Components.Add(screenManager); // Tell the program to load all files relative to the "Content" directory. Assets = new CachedContentLoader(this, "Content"); inputReader = new UserInputReader(Constants.DEFAULT_KEY_MAPPING); collisionRecorder = new CollisionRecorder(); WorldState = new WorldState(new ReadWriteXML(), Constants.CONFIG_URI, this, contactReporter); worldQueryUtils = new WorldQueryUtils(worldQuery, WorldState.PhysicsWorld); ContactReporter contactReporter = new ContactReporter(collisionRecorder, worldQuery, worldQueryUtils); gameObjectManager = new GameObjectManager(WorldState, assets, inputReader, pathPlanner); worldQuery = new DefaultWorldQueryEngine(collisionRecorder, gameObjectManager.Controllers); gameObjectManager.WorldQueryEngine = worldQuery; pathPlanner = new PathPlanner(this, worldQueryUtils, WorldQuery); gameObjectManager.PathPlanner = pathPlanner; combatEngine = new CombatEngine(worldQuery, new Random()); } Here is an excerpt of the above that's problematic: gameObjectManager = new GameObjectManager(WorldState, assets, inputReader, pathPlanner); worldQuery = new DefaultWorldQueryEngine(collisionRecorder, gameObjectManager.Controllers); gameObjectManager.WorldQueryEngine = worldQuery; I hope that no one ever forgets that setting of gameObjectManager.WorldQueryEngine, or else it will fail. Here is the problem: gameObjectManager needs a WorldQuery, and WorldQuery needs a property of gameObjectManager. What can I do about this? Have I found an anti-pattern?

    Read the article

  • Dojo and Ajax - rendering widgets

    - by Michael Merchant
    I'm trying to load content into a Dojo content pane in a specific html tag and not replace the entire content pane. The html I'm loading includes a markup defined widget that I'd like to have rendered when the new row is loaded. So, I have a table that is being dynamically filled via ajax,ie: <body> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/dojo/1.5/dojo/dojo.xd.js" djConfig="parseOnLoad: true, isDebug:true"></script> <div id="table-pane" dojoType="dijit.layout.ContentPane"> <table class="test"> <tbody> <tr><td>Name</td><td>Year</td><td>Age</td></tr> <tr> <td><span dojoType="dijit.InlineEditBox" editor="dijit.form.Textarea">Mike</span> </td> <td>2010</td> <td>12</td> </tr> </tbody> </table> </div> </body> <script> var html ='<tr><td><span dojoType="dijit.InlineEditBox" editor="dijit.form.Textarea">John</span></td><td>2011</td><td>22</td></tr>'; dojo.require("dijit.layout.ContentPane"); dojo.require("dijit.InlineEditBox"); dojo.require("dijit.form.Textarea"); dojo.addOnLoad(function(){ pane = dijit.byId("table-pane"); add_elem(); }); function add_elem(){ var node = $(".test tr:last"); node.after(html); dojo.addOnLoad(function(){ //Here I want to initiate any widgets that haven't been initiated pane.buildRendering(); }); }</script> How do I render the Dojo widget in the new table row?

    Read the article

  • SQL: GROUP BY after JOIN without overriding rows?

    - by krismeld
    I have a table of basketball leagues, a table af teams and a table of players like this: LEAGUES ID | NAME | ------------------ 1 | NBA | 2 | ABA | TEAMS: ID | NAME | LEAGUE_ID ------------------------------ 20 | BULLS | 1 21 | KNICKS | 2 PLAYERS: ID | TEAM_ID | FIRST_NAME | LAST_NAME | --------------------------------------------- 1 | 21 | John | Starks | 2 | 21 | Patrick | Ewing | Given a League ID, I would like to retrieve all the players' names and their team ID from all the teams in that league, so I do this: SELECT t.id AS team_id, p.id AS player_id, p.first_name, p.last_name FROM teams AS t JOIN players AS p ON p.team_id = t.id WHERE t.league_id = 1 which returns: [0] => stdClass Object ( [team_id] => 21 [player_id] => 1 [first_name] => John [last_name] => Starks ) [1] => stdClass Object ( [team_id] => 21 [player_id] => 2 [first_name] => Patrick [last_name] => Ewing ) + around 500 more objects... Since I will use this result to populate a dropdown menu for each team containing each team's list of players, I would like to group my result by team ID, so the loop to create these dropdowns will only have to cycle through each team ID instead of all 500+ players each time. But when I use the GROUP BY like this: SELECT t.id AS team_id, p.id AS player_id, p.first_name, p.last_name FROM teams AS t JOIN players AS p ON p.team_id = t.id WHERE t.league_id = 1 GROUP BY t.id it only returns one player from each team like this, overriding all the other players on the same team because of the use of the same column names. [0] => stdClass Object ( [team_id] => 21 [player_id] => 2 [first_name] => Patrick [last_name] => Ewing ) [1] => stdClass Object ( [team_id] => 22 [player_id] => 31 [first_name] => Shawn [last_name] => Kemp ) etc... I would like to return something like this: [0] => stdClass Object ( [team_id] => 2 [player_id1] => 1 [first_name1] => John [last_name1] => Starks [player_id2] => 2 [first_name2] => Patrick [last_name2] => Ewing +10 more players from this team... ) +25 more teams... Is it possible somehow?

    Read the article

  • dynamic Grid columns

    - by stck777
    Hi, I need help with dynamic columns in a DataGrid. I use GenericFrame front-end with PHP backend. If I use static columns like this: <? ... ?> <DataGrid id="DataGrid1" width="100%"> <columns> <DataGridColumn headerText="name" dataField="@username" width="150"/> <DataGridColumn headerText="Nahcname" dataField="@secondname" width="150"/> <DataGridColumn headerText="alter" dataField="@age" width="40"/> </columns> </DataGrid> <? ... ?> It is working fine. But I try to create the columns dynamic with PHP. <generic> <template target="gridbox"> <VBox id="dynamic" height="100%"> <!-- DataGrid --> <DataGrid id="DataGrid1" width="100%" > <columns> <?php $columns = array( //Spalte => (Breite, Datenfeld) "name" => array(150,"@username"), "Nahcname" => array(150,"@secondname"), "alter"=> array(40,"@age") ); foreach ($columns as $key => $value) { ?> <DataGridColumn headerText="<? echo $key; ?>" dataField="<? echo $value[0]; ?>" width="<? echo $value[0];?>"/> <?php } ?> </columns> </DataGrid> <Binding source="templatedata.data1.item" destination="DataGrid1.dataProvider" /> </VBox> </template> <templatedata> <data1> <!-- Daten --> <item username="User1" secondname="Nachname1" age="22"/> <item username="User2" secondname="Nachname2" age="25"/> <item username="User3" secondname="Nachname3" age="27"/> <item username="User4" secondname="Nachname4" age="32"/> </data1> </templatedata> The DataGrid is displayed correctly, but without data? any idea why?

    Read the article

  • iPhone Debugger Message -- Weird

    - by Bill Shiff
    Hello, I have an iPhone app that I've been working on and have recently upgraded my version of XCode. Since the upgrade, I can build and debug in the iPhone Simulator just fine, but when I try to debug on an attached device I get the following messages: From Xcode4: GNU gdb 6.3.50-20050815 (Apple version gdb-1510) (Fri Oct 22 04:12:10 UTC 2010) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "--host=i386-apple-darwin --target=arm-apple-darwin".tty /dev/ttys001 sharedlibrary apply-load-rules all warning: Unable to read symbols from "dyld" (prefix __dyld_) (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/MessageUI.framework/MessageUI (file not found). warning: Unable to read symbols from "MessageUI" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/MapKit.framework/MapKit (file not found). warning: Unable to read symbols from "MapKit" (not yet mapped into memory). warning: Unable to read symbols from "Foundation" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/UIKit.framework/UIKit (file not found). warning: Unable to read symbols from "UIKit" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/CoreGraphics.framework/CoreGraphics (file not found). warning: Unable to read symbols from "CoreGraphics" (not yet mapped into memory). warning: Unable to read symbols from "CoreData" (not yet mapped into memory). warning: Unable to read symbols from "QuartzCore" (not yet mapped into memory). warning: Unable to read symbols from "libgcc_s.1.dylib" (not yet mapped into memory). warning: Unable to read symbols from "libSystem.B.dylib" (not yet mapped into memory). warning: Unable to read symbols from "libobjc.A.dylib" (not yet mapped into memory). warning: Unable to read symbols from "CoreFoundation" (not yet mapped into memory). target remote-mobile /tmp/.XcodeGDBRemote-3836-28 Switching to remote-macosx protocol mem 0x1000 0x3fffffff cache mem 0x40000000 0xffffffff none mem 0x00000000 0x0fff none [Switching to thread 11523] [Switching to thread 11523] gdb stack crawl at point of internal error: 0 gdb-arm-apple-darwin 0x0013216e internal_vproblem + 316

    Read the article

  • Parsing XML data with Namespaces in PHP

    - by osbmedia
    I'm trying to work with this XML feed that uses namespaces and i'm not able to get past the colon in the tags. Here's how the XML feed looks like: <r25:events pubdate="2010-05-19T13:58:08-04:00"> <r25:event xl:href="event.xml?event_id=328" id="BRJDMzI4" crc="00000022" status="est"> <r25:event_id>328</r25:event_id> <r25:event_name>Testing 09/2005-08/2006</r25:event_name> <r25:alien_uid/> <r25:event_priority>0</r25:event_priority> <r25:event_type_id xl:href="evtype.xml?type_id=105">105</r25:event_type_id> <r25:event_type_name>CABINET</r25:event_type_name> <r25:node_type>C</r25:node_type> <r25:node_type_name>cabinet</r25:node_type_name> <r25:state>1</r25:state> <r25:state_name>Tentative</r25:state_name> <r25:event_locator>2005-AAAAMQ</r25:event_locator> <r25:event_title/> <r25:favorite>F</r25:favorite> <r25:organization_id/> <r25:organization_name/> <r25:parent_id/> <r25:cabinet_id xl:href="event.xml?event_id=328">328</r25:cabinet_id> <r25:cabinet_name>cabinet 09/2005-08/2006</r25:cabinet_name> <r25:start_date>2005-09-01</r25:start_date> <r25:end_date>2006-08-31</r25:end_date> <r25:registration_url/> <r25:last_mod_dt>2008-02-27T14:22:43-05:00</r25:last_mod_dt> <r25:last_mod_user>abc00296004</r25:last_mod_user> </r25:event> </r25:events> And here is what I'm using for code - I'll trying to throw these into a bunch of arrays where I can format the output however I want: <?php $ch = curl_init(); curl_setopt($ch, CURLOPT_URL, "http://somedomain.com/blah.xml"); curl_setopt ($ch, CURLOPT_HTTPHEADER, Array("Content-Type: text/xml")); curl_setopt($ch, CURLOPT_USERPWD, "username:password"); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); $output = curl_exec($ch); curl_close($ch); $xml = new SimpleXmlElement($output); foreach ($xml->events->event as $entry){ $dc = $entry->children('http://www.collegenet.com/r25'); echo $entry->event_name . "<br />"; echo $entry->event_id . "<br /><br />"; }

    Read the article

  • Restore previously serialized JFrame-object, how?

    - by elementz
    Hi all. I have managed to serialize my very basic GUI-object containing a JTextArea and a few buttons to a file 'test.ser'. Now, I would like to completely restore the previously saved state from 'test.ser', but seem to have a misconception of how to properly deserialize an objects state. The class MyFrame creates the JFrame and serializes it. public class MyFrame extends JFrame implements ActionListener { // Fields JTextArea textArea; String title; static MyFrame gui = new MyFrame(); private static final long serialVersionUID = 1125762532137824262L; /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub gui.run(); } // parameterless default contructor public MyFrame() { } // constructor with title public MyFrame(String title) { } // creates Frame and its Layout public void run() { JFrame frame = new JFrame(title); JPanel panel_01 = new JPanel(); JPanel panel_02 = new JPanel(); JTextArea textArea = new JTextArea(20, 22); textArea.setLineWrap(true); JScrollPane scrollPane = new JScrollPane(textArea); scrollPane.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_AS_NEEDED); panel_01.add(scrollPane); // Buttons JButton saveButton = new JButton("Save"); saveButton.addActionListener(this); JButton loadButton = new JButton("Load"); loadButton.addActionListener(this); panel_02.add(loadButton); panel_02.add(saveButton); // Layout frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.getContentPane().add(BorderLayout.CENTER, panel_01); frame.getContentPane().add(BorderLayout.SOUTH, panel_02); frame.setSize(300, 400); frame.setVisible(true); } /* * */ public void serialize() { try { ObjectOutputStream oos = new ObjectOutputStream(new FileOutputStream("test.ser")); oos.writeObject(gui); oos.close(); } catch (Exception e) { // TODO: handle exception e.printStackTrace(); } } public void actionPerformed(ActionEvent ev) { System.out.println("Action received!"); gui.serialize(); } } Here I try to do the deserialization: public class Deserialize { static Deserialize ds; static MyFrame frame; public static void main(String[] args) { try { ObjectInputStream ois = new ObjectInputStream(new FileInputStream("test.ser")); frame = (MyFrame) ois.readObject(); ois.close(); } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (ClassNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } } Maybe somebody could point me into the direction where my misconception is? Thx in advance!

    Read the article

  • C# Program gets stuck

    - by weirdcsharp
    The program never prints out "test" unless I set a breakpoint on it and step over myself. I don't understand what's happening. Appreciate any help. public partial class Form1 : Form { public Form1() { InitializeComponent(); string testKey = "lkirwf897+22#bbtrm8814z5qq=498j5"; string testIv = "741952hheeyy66#cs!9hjv887mxx7@8y"; string testValue = "random"; string encryptedText = EncryptRJ256(testKey, testIv, testValue); string decryptedText = DecryptRJ256(testKey, testIv, encryptedText); Console.WriteLine("encrypted: " + encryptedText); Console.WriteLine("decrypted: " + decryptedText); Console.WriteLine("test"); } public static string DecryptRJ256(string key, string iv, string text) { string sEncryptedString = text; RijndaelManaged myRijndael = new RijndaelManaged(); myRijndael.Padding = PaddingMode.Zeros; myRijndael.Mode = CipherMode.CBC; myRijndael.KeySize = 256; myRijndael.BlockSize = 256; byte[] keyByte = System.Text.Encoding.ASCII.GetBytes(key); byte[] IVByte = System.Text.Encoding.ASCII.GetBytes(iv); ICryptoTransform decryptor = myRijndael.CreateDecryptor(keyByte, IVByte); byte[] sEncrypted = Convert.FromBase64String(sEncryptedString); byte[] fromEncrypt = new byte[sEncrypted.Length + 1]; MemoryStream msDecrypt = new MemoryStream(sEncrypted); CryptoStream csDecrypt = new CryptoStream(msDecrypt, decryptor, CryptoStreamMode.Read); csDecrypt.Read(fromEncrypt, 0, fromEncrypt.Length); return Encoding.ASCII.GetString(fromEncrypt); } public static string EncryptRJ256(string key, string iv, string text) { string sToEncrypt = text; RijndaelManaged myRijndael = new RijndaelManaged(); myRijndael.Padding = PaddingMode.Zeros; myRijndael.Mode = CipherMode.CBC; myRijndael.KeySize = 256; myRijndael.BlockSize = 256; byte[] keyByte = Encoding.ASCII.GetBytes(key); byte[] IVByte = Encoding.ASCII.GetBytes(iv); ICryptoTransform encryptor = myRijndael.CreateEncryptor(keyByte, IVByte); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); byte[] toEncrypt = System.Text.Encoding.ASCII.GetBytes(sToEncrypt); csEncrypt.Write(toEncrypt, 0, toEncrypt.Length); csEncrypt.FlushFinalBlock(); byte[] encrypted = msEncrypt.ToArray(); return Convert.ToBase64String(encrypted); } } edit: Tried Debug.WriteLine Debug.WriteLine("encrypted: " + encryptedText); Debug.WriteLine("decrypted: " + decryptedText); Debug.WriteLine("test"); Output: encrypted: T4hdAcpP5MROmKLeziLvl7couD0o+6EuB/Kx29RPm9w= decrypted: randomtest Not sure why it's not printing the line terminator.

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • .NET AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is a correct AES implementation in .NET, so I need some advice from a .NET wizard to help with this.

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • MBR status confusion

    - by Ahmed Ghoneim
    EB 58 90 6D 6B 64 6F 73 66 73 00 00 02 08 20 00 02 00 00 00 00 F8 00 00 3E 00 83 00 00 00 00 00 94 88 7E 00 98 1F 00 00 00 00 00 00 02 00 00 00 01 00 06 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 29 A9 38 B1 34 57 61 76 65 20 20 20 20 20 20 20 46 41 54 33 32 20 20 20 0E 1F BE 77 7C AC 22 C0 74 0B 56 B4 0E BB 07 00 CD 10 5E EB F0 32 E4 CD 16 CD 19 EB FE 54 68 69 73 20 69 73 20 6E 6F 74 20 61 20 62 6F 6F 74 61 62 6C 65 20 64 69 73 6B 2E 20 20 50 6C 65 61 73 65 20 69 6E 73 65 72 74 20 61 20 62 6F 6F 74 61 62 6C 65 20 66 6C 6F 70 70 79 20 61 6E 64 0D 0A 70 72 65 73 73 20 61 6E 79 20 6B 65 79 20 74 6F 20 74 72 79 20 61 67 61 69 6E 20 2E 2E 2E 20 0D 0A 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 55 AA Learning disk records, this is my USB MBR record viewed by bless on ubuntu formatted with disk utility as MBR table and FAT partition, referring to this Wiki of first record status (0x80 = bootable (active), 0x00 = non-bootable, other = invalid ) but my MBR shows first offset as EB. What's this record stands for ? also, can you provide me with good tables/images tutorials for MBR and other disks' records :)

    Read the article

  • Add/delete row from a table

    - by yogsma
    I have this table with some dependents information and there is a add and delete button for each row to add/delete additional dependents. When I click "add" button, a new row gets added to the table, but when I click the "delete" button, it deletes the header row first and then on subsequent clicking, it deletes the corresponding row. Here is what I have: Javascript code function deleteRow(row){ var d = row.parentNode.parentNode.rowIndex; document.getElementById('dsTable').deleteRow(d); } HTML code <table id = 'dsTable' > <tr> <td> Relationship Type </td> <td> Date of Birth </td> <td> Gender </td> </tr> <tr> <td> Spouse </td> <td> 1980-22-03 </td> <td> female </td> <td> <input type="button" id ="addDep" value="Add" onclick = "add()" </td> <td> <input type="button" id ="deleteDep" value="Delete" onclick = "deleteRow(this)" </td> </tr> <tr> <td> Child </td> <td> 2008-23-06 </td> <td> female </td> <td> <input type="button" id ="addDep" value="Add" onclick = "add()"</td> <td> <input type="button" id ="deleteDep" value="Delete" onclick = "deleteRow(this)" </td> </tr> </table>

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Cell contents changing for rows present outside the height of tableview(to see this cells, we shud s

    - by wolverine
    I have set the size of the tableView that I show as the popoverController as 4*rowheight. And I am using 12cells in the tableView. Each cell contains an image and a label. I can see all the cells by scrolling. Upto 5th cell its ok. After th2 5th cell, the label and the image that I am using in the first four cells are being repeated for the remaining cells. And If I select the cell, the result is accurately shown. But when I again take the tableView, the image and labels are not accurate even for the first 5 cells. All are changed but the selection is giving the correct result. Can anyone help me?? - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [self tableviewCellWithReuseIdentifier:CellIdentifier rowNumber:indexPath.row]; } //tableView.backgroundColor = [UIColor clearColor]; return cell; } - (UITableViewCell *)tableviewCellWithReuseIdentifier:(NSString *)identifier rowNumber:(NSInteger)row { CGRect rect; rect = CGRectMake(0.0, 0.0, 360.0, ROW_HEIGHT); UITableViewCell *cell = [[[UITableViewCell alloc] initWithFrame:rect reuseIdentifier:identifier] autorelease]; UIImageView *myImageView = [[UIImageView alloc] initWithFrame:CGRectMake(10.00, 10.00, 150.00, 100.00)]; myImageView.tag = IMAGE_TAG; [cell.contentView addSubview:myImageView]; [myImageView release]; UILabel *label = [[UILabel alloc] initWithFrame:CGRectMake(170.00, -10.00, 170.00, 80.00)]; label.tag = LABEL_TAG; [label setBackgroundColor:[UIColor clearColor]]; [label setTextColor:[UIColor blackColor]]; [label setFont:[UIFont fontWithName:@"AmericanTypewriter" size:22]]; [label setTextAlignment:UITextAlignmentLeft]; [cell.contentView addSubview:label]; [label release]; if (row == 0) { UIImageView *imageView = (UIImageView *)[cell viewWithTag:IMAGE_TAG]; imageView.image = [UIImage imageNamed:[NSString stringWithFormat:@"cover_v.jpg"]]; UILabel *mylabel = (UILabel *)[cell viewWithTag:LABEL_TAG]; mylabel.text = [NSString stringWithFormat:@"COVER PAGE"]; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • How do I detect server status in a port scanner java implementation

    - by akz
    I am writing a port scanner in Java and I want to be able to distinct the following 4 use cases: port is open port is open and server banner was read port is closed server is not live I have the following code: InetAddress address = InetAddress.getByName("google.com"); int[] ports = new int[]{21, 22, 23, 80, 443}; for (int i = 0; i < ports.length; i++) { int port = ports[i]; Socket socket = null; try { socket = new Socket(address, port); socket.setSoTimeout(500); System.out.println("port " + port + " open"); BufferedReader reader = new BufferedReader( new InputStreamReader(socket.getInputStream())); String line = reader.readLine(); if (line != null) { System.out.println(line); } socket.close(); } catch (SocketTimeoutException ex) { // port was open but nothing was read from input stream ex.printStackTrace(); } catch (ConnectException ex) { // port is closed ex.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null && !socket.isClosed()) { try { socket.close(); } catch (Exception e) { e.printStackTrace(); } } } } The problem is that I get a ConnectionException both when the port is closed and the server cannot be reached but with a different exception message: java.net.ConnectException: Connection timed out: connect when the connection was never established and java.net.ConnectException: Connection refused: connect when the port was closed so I cannot make the distinction between the two use cases without digging into the actual exception message. Same thing happens when I try a different approach for the socket creation. If I use: socket = new Socket(); socket.setSoTimeout(500); socket.connect(new InetSocketAddress(address, port), 1000); I have the same problem but with the SocketTimeoutException instead. I get a java.net.SocketTimeoutException: Read timed out if port was open but there was no banner to be read and java.net.SocketTimeoutException: connect timed out if server is not live or port is closed. Any ideas? Thanks in advance!

    Read the article

< Previous Page | 144 145 146 147 148 149 150 151 152 153 154 155  | Next Page >