Search Results

Search found 14282 results on 572 pages for 'performance counter'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 149/572 | < Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How large is the performance loss for a 64-bit VirtualBox guest running on a 32-bit host?

    - by IllvilJa
    I have a 64-bit Virtualbox guest running Gentoo Linux (amd64) and it is currently hosted on a 32-bit Gentoo laptop. I've noticed that the performance of the VM is very slow compared to the performance of the 32-bit host itself. Also when I compare with another 32-bit Linux VM running on the same host, performance is significantly less on the 64-bit VM. I know that running a 64-bit VM on a 32-bit host does incur some performance penalties for the VM, but does anyone have any deeper knowledge of how large a penalty one might expect in this scenario, roughly speaking? Is a 10% slowdown something to expect, or should it be a slowdown in the 90% range (running at 1/10 the normal speed)? Or to phrase it in another way: would it be reasonable to expect that the performance improvement for the 64-bit VM increases so much that it is worth reinstalling the host machine to run 64-bit Gentoo instead? I'm currently seriously considering that upgrade, but am curious about other peoples experience of the current scenario. I am aware that the host OS will require more RAM when running in 64-bit, but that's OK for me. Also, I do know that one usually don't run a 64-bit VM on a 32-bit server (I'm surprised I even got the VM started in the first place) but things turned out that way when I tried to future proof the VM I was setting up and decided to make it 64-bit anyway.

    Read the article

  • Oracle performance report

    - by John
    Hi, Is there any way of running the $ORACLE_HOME/rdbms/admin/awrrpt.sql so that it doesn't require any input parameters, as in automatically collects a report for the previous hour? /j

    Read the article

  • UITableView performance degrading after adding subviews on cell iphone sdk

    - by neha
    Hi all, In my application, I'm adding a label and two buttons on cell of UItableView [I have not created a separate cell class]. I'm adding these to cell and not cell.contentview. After I run my application on IPhone, the tableview cell rendering after I move the cells up-down, is very jerky. Is it because I'm not adding the views on cell.contentView or because I've not created a custom class for cell? Can anybody please help? Thanks in advance.

    Read the article

  • glibc regexp performance

    - by Jack
    Anyone has experience measuring glibc regexp functions? Are there any generic tests I need to run to make such a measurements (in addition to testing the exact patterns I intend to search)? Thanks.

    Read the article

  • Dynamically generating high performance functions in clojure

    - by mikera
    I'm trying to use Clojure to dynamically generate functions that can be applied to large volumes of data - i.e. a requirement is that the functions be compiled to bytecode in order to execute fast, but their specification is not known until run time. e.g. suppose I specify functions with a simple DSL like: (def my-spec [:add [:multiply 2 :param0] 3]) I would like to create a function compile-spec such that: (compile-spec my-spec) Would return a compiled function of one parameter x that returns 2x+3. What is the best way to do this in Clojure?

    Read the article

  • Sql Server performance

    - by Jose
    I know that I can't get a specific answer to my question, but I would like to know if I can find the tools to get to my answer. Ok we have a Sql Server 2008 database that for the last 4 days has had moments where for 5-20 minutes becomes unresponsive for specific queries. e.g. The following queries run in different query windows simultaneously have the following results SELECT * FROM Assignment --hangs indefinitely SELECT * FROM Invoice -- works fine Many of the tables have non-clustered indexes to help speed up SELECTs Here's what I know: 1) The same query will either hang indefinitely or run normally. 2) In Activity Monitor in the processes tab there are normally around 80-100 processes running I think that what's happening is 1) A user updates a table 2) This causes one or more indexes to get updated 3) Another user issues a select while the index is updating Is there a way I can figure out why at a specific moment in time SQL Server is being unresponsive for a specific query?

    Read the article

  • .NET IsValidXml Extension Method Performance

    - by tyndall
    I have a legacy application that I inherited that passes a lot of XML around as Strings. I often need the ability to check if a String will be valid XML. What is the fastest and least expensive way to check if a string is valid XML in .NET? I'm working in .NET 3.5 and would most likely use this as an extension method (off of string) in this one project within the solution.

    Read the article

  • I need to simplify a MySQL sub query for performance - please help

    - by Richard
    I have the following query which is takin 3 seconds on a table of 1500 rows, does someone know how to simplify it? SELECT dealers.name, dealers.companyName, dealer_accounts.balance FROM dealers INNER JOIN dealer_accounts ON dealers.id = dealer_accounts.dealer_id WHERE dealer_accounts.id = ( SELECT id FROM dealer_accounts WHERE dealer_accounts.dealer_id = dealers.id AND dealer_accounts.date < '2010-03-30' ORDER BY dealer_accounts.date DESC, dealer_accounts.id DESC LIMIT 1 ) ORDER BY dealers.name I need the latest dealer_accounts record for each dealer by a certain date with the join on the dealer_id field on the dealer_accounts table. This really should be simple, I don't know why I am struggling to find something.

    Read the article

  • why arrayfun does NOT improve my struct array operation performance

    - by HaveF
    here is the input data: % @param Landmarks: % Landmarks should be 1*m struct. % m is the number of training set. % Landmark(i).data is a n*2 matrix old function: function Landmarks=CenterOfGravity(Landmarks) % align center of gravity for i=1 : length(Landmarks) Landmarks(i).data=Landmarks(i).data - ones(size(Landmarks(i).data,1),1)... *mean(Landmarks(i).data); end end new function which use arrayfun: function [Landmarks] = center_to_gravity(Landmarks) Landmarks = arrayfun(@(struct_data)... struct('data', struct_data.data - repmat(mean(struct_data.data), [size(struct_data.data, 1), 1]))... ,Landmarks); end %function center_to_gravity when using profiler, I find the usage of time is NOT what I expected: Function Total Time Self Time* CenterOfGravity 0.011s 0.004 s center_to_gravity 0.029s 0.001 s Can someone tell me why? BTW...I can't add "arrayfun" as a new tag for my reputation.

    Read the article

  • Performance problems when loading local JSON via <script> elements in IE8

    - by Jens Bannmann
    I have a web page with some JS scripts that needs to work locally, e.g. from hard disk or a CD-ROM. The scripts load JSON data from files by inserting <script> tags. This worked fine in IE6, but now in IE8 it takes an enormous amount of time: it went from "instantly" to 3-10 seconds. The main data file is 45KB large. How can I solve this? I would switch from <script> tags to another method of loading JSON (ideally involving the new native JSON parser), but it seems locally loaded content cannot access the XMLHttpRequest object. Any ideas?

    Read the article

  • Java curious Loop Performance

    - by user1680583
    I have a big problem while evaluate my java code. To simplify the problem I wrote the following code which produce the same curious behavior. Important is the method run() and given double value rate. For my runtime test (in the main method) I set the rate to 0.5 one times and 1.0 the other time. With the value 1.0 the if-statement will be executed in each loop iteration and with the value 0.5 the if-statement will be executed half as much. For this reason I expected longer runtime by the first case but opposite is true. Can anybody explain me this phenomenon?? The result of main: Test mit rate = 0.5 Length: 50000000, IF executions: 25000856 Execution time was 4329 ms. Length: 50000000, IF executions: 24999141 Execution time was 4307 ms. Length: 50000000, IF executions: 25001582 Execution time was 4223 ms. Length: 50000000, IF executions: 25000694 Execution time was 4328 ms. Length: 50000000, IF executions: 25004766 Execution time was 4346 ms. ================================= Test mit rate = 1.0 Length: 50000000, IF executions: 50000000 Execution time was 3482 ms. Length: 50000000, IF executions: 50000000 Execution time was 3572 ms. Length: 50000000, IF executions: 50000000 Execution time was 3529 ms. Length: 50000000, IF executions: 50000000 Execution time was 3479 ms. Length: 50000000, IF executions: 50000000 Execution time was 3473 ms. The Code public ArrayList<Byte> list = new ArrayList<Byte>(); public final int LENGTH = 50000000; public PerformanceTest(){ byte[]arr = new byte[LENGTH]; Random random = new Random(); random.nextBytes(arr); for(byte b : arr) list.add(b); } public void run(double rate){ byte b = 0; int count = 0; for (int i = 0; i < LENGTH; i++) { if(getRate(rate)){ list.set(i, b); count++; } } System.out.println("Length: " + LENGTH + ", IF executions: " + count); } public boolean getRate(double rate){ return Math.random() < rate; } public static void main(String[] args) throws InterruptedException { PerformanceTest test = new PerformanceTest(); long start, end; System.out.println("Test mit rate = 0.5"); for (int i = 0; i < 5; i++) { start=System.currentTimeMillis(); test.run(0.5); end = System.currentTimeMillis(); System.out.println("Execution time was "+(end-start)+" ms."); Thread.sleep(500); } System.out.println("================================="); System.out.println("Test mit rate = 1.0"); for (int i = 0; i < 5; i++) { start=System.currentTimeMillis(); test.run(1.0); end = System.currentTimeMillis(); System.out.println("Execution time was "+(end-start)+" ms."); Thread.sleep(500); } }

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Python: Time a code segment for testing performance (with timeit)

    - by Mestika
    Hi, I've a python script which works just as it should but I need to write the time for the execution. I've gooled that I should use timeit but I can't seem to get it to work. My Python script looks like this: import sys import getopt import timeit import random import os import re import ibm_db import time from string import maketrans myfile = open("results_update.txt", "a") for r in range(100): rannumber = random.randint(0, 100) update = "update TABLE set val = %i where MyCount >= '2010' and MyCount < '2012' and number = '250'" % rannumber #print rannumber conn = ibm_db.pconnect("dsn=myDB","usrname","secretPWD") for r in range(5): print "Run %s\n" % r ibm_db.execute(query_stmt) query_stmt = ibm_db.prepare(conn, update) myfile.close() ibm_db.close(conn) What I need it the time it takes the execution of the query and written to the file "results_update.txt". The purpose is to test an update statement for my database with different indexes and tuning mechanisms. Sincerely Mestika

    Read the article

  • Javascript memory leak/ performance issue?

    - by Tom
    I just cannot for the life of me figure out this memory leak in Internet Explorer. insertTags simple takes string str and places each word within start and end tags for HTML (usually anchor tags). transliterate is for arabic numbers, and replaces normal numbers 0-9 with a &#..n; XML identity for their arabic counterparts. fragment = document.createDocumentFragment(); for (i = 0, e = response.verses.length; i < e; i++) { fragment.appendChild((function(){ p = document.createElement('p'); p.setAttribute('lang', (response.unicode) ? 'ar' : 'en'); p.innerHTML = ((response.unicode) ? (response.surah + ':' + (i+1)).transliterate() : response.surah + ':' + (i+1)) + ' ' + insertTags(response.verses[i], '<a href="#" onclick="window.popup(this);return false;" class="match">', '</a>'); try { return p } finally { p = null; } })()); } params[0].appendChild( fragment ); fragment = null; I would love some links other than MSDN and about.com, because neither of them have sufficiently explained to me why my script leaks memory. I am sure this is the problem, because without it everything runs fast (but nothing displays). I've read that doing a lot of DOM manipulations can be dangerous, but the for loops a max of 286 times (# of verses in surah 2, the longest surah in the Qur'an).

    Read the article

  • Image creation performance / image caching

    - by Kilnr
    Hello, I'm writing an application that has a scrollable image (used to display a map). The map background consists of several tiles (premade from a big JPG file), that I draw on a Graphics object. I also use a cache (Hashtable), to prevent from having to create every image when I need it. I don't keep everything in memory, because that would be too much. The problem is that when I'm scrolling through the map, and I need an image that wasn't cached, it takes about 60-80 ms to create it. Depending on screen resolution, tile size and scroll direction, this can occur multiple times in one scroll operation (for different tiles). In my case, it often happens that this needs to be done 4 times, which introduces a delay of more than 300 ms, which is extremely noticeable. The easiest thing for me would be that there's some way to speed up the creation of Images, but I guess that's just wishful thinking... Besides that, I suppose the most obvious thing to do is to load the tiles predictively (e.g. when scrolling to the right, precache the tiles to the right), but then I'm faced with the rather difficult task of thinking up a halfway decent algorithm for this. My actual question then is: how can I best do this predictive loading? Maybe I could offload the creation of images to a separate thread? Other things to consider? Thanks in advance.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 145 146 147 148 149 150 151 152 153 154 155 156  | Next Page >