Search Results

Search found 49404 results on 1977 pages for 'string search'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 15/1977 | < Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • No date/time shown before my page in Google search results

    - by Ruut
    I know that by changing the meta description of my webpage, I can control the texts shown by Google in the search results. However I do not know how I can control the text shown just before the search results, for example the date when the page was last updated. Which meta tag to use to accomplish this? UPDATE: My webpage is automatically updated on a weekly basis on irregular intervals by a cronjob which makes changes to the MySQL database which holds the content of my webpages. So the question is what (meta) info to add to my page.

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Interview question: How would you implement Google Search?

    - by ripper234
    Supposed you were asked in an interview "How would you implement Google Search?" How would you answer such a question? There might be resources out there that explain how some pieces in Google are implemented (BigTable, MapReduce, PageRank, ...), but that doesn't exactly fit in an interview. What overall architecture would you use, and how would you explain this in a 15-30 minute time span? I would start with explaining how to build a search engine that handles ~ 100k documents, then expand this via sharding to around 50M docs, then perhaps another architectural/technical leap. This is the 20,000 feet view. What I'd like is the details - how you would actually answer that in an interview. Which data structures would you use. What services/machines is your architecture composed of. What would a typical query latency be? What about failover / split brain issues? Etc...

    Read the article

  • Unity Search Not Working

    - by greggory.hz
    When I attempt a search after hitting Super, the spinner spins, but no results come up once the spinning stops. I'm not sure what changed that caused this. I had a newer kernel installed, but I have since reverted back to the default kernel. I also followed this guide: http://www.webupd8.org/2011/04/how-to-reset-unity-launcher-icons-or.html Alt+F2 does not work. The packages unity-place-applications and unity-place-files are installed. But search still doesn't function correctly.

    Read the article

  • I'm trying to build a query to search against a fulltext index in mysql

    - by Rockinelle
    The table's schema is pretty simple. I have a child table that stores a customer's information like address and phone number. The columns are user_id, fieldname, fieldvalue and fieldname. So each row will hold one item like phone number, address or email. This is to allow an unlimited number of each type of information for each customer. The people on the phones need to look up these customers quickly as they call into our call center. I have experimented with using LIKE% and I'm working with a FULLTEXT index now. My queries work, but I want to make them more useful because if someone searches for a telephone area code like 805 that will bring up many people, and then they add the name Bill to narrow it down, '805 Bill'. It will show EVERY customer that has 805 OR Bill. I want it to do AND searches across multiple rows within each customer. Currently I'm using the query below to grab the user_ids and later I do another query to fetch all the details for each user to build their complete record. SELECT DISTINCT `user_id` FROM `user_details` WHERE MATCH (`fieldvalue`) AGAINST ('805 Bill') Again, I want to do the above query against groups of rows that belong to a single user, but those users have to match the search keywords. What should I do?

    Read the article

  • Revamped Joomla site to Google search engine

    - by user3127632
    I am about to upload a revamped site of Joomla (update from 1.5 to 2.5 + changes). I currently have a test bed subdomain that I am currently working on. In few days I am about to do the swap and replace the old site with the new one. I am worrying about Search Engines and specifically Google. The site currently has a very good rank (appears 2nd in the search), what actions do I have to take in order to be updated and preserve the rank? (except submitting the new sitemap I guess). It's not a difficult task but because I don't have the option to be wrong or mistakes to be done I an asking for a more "expert" advice.

    Read the article

  • best/simplest way to inform search engine of sitemap location

    - by Don
    AFAIK, there are 2 ways to make search engines aware of a sitemap's location: Include an absolute link to it in robots.txt Submit it to them directly. The relevant URLs are: http://www.google.com/webmasters/tools/ping?sitemap=SITEMAP_URL http://www.bing.com/webmaster/ping.aspx?sitemap=SITEMAP_URL Where SITEMAP_URL is the absolute URL of the sitemap. Currently, I do both. Regarding (2), I have a job that runs automatically every day which submits the sitemap to Bing and Google. I don't think there's any reason to do (1) and (2), but I'm paranoid, so I do. I imagine you can avoid both (1) and (2) if you just make your sitemap accessible at a conventional URL (like robots.txt). What's the simplest and most reliable way to ensure that search engines can find your sitemap?

    Read the article

  • Google web search shows dateCreated instead of dateModified metadata

    - by LonelyPixel
    So today I discovered that the pages from my website are listed with an unexpected date value. I specify the schema.org properties dateCreated and dateModified for most of my content pages. I'd expect that search results show me when a page was last updated, to get a sense of the currency of the page. But it's showing the date of first publishing which may be years ago. That's a bit unsatisfying but I don't want to misuse the metadata because Google probably reads it wrong. Some search terms for you to try it out: "gitrevisiontool"; "easyxml"; "multiselecttreeview" (look for the results on dev.unclassified.de; the human- and machine-readable dates come at the end of the page) Does anybody know more about what's wrong here? Or does it work as designed? (What a stupid design that would be.)

    Read the article

  • Web Search for a Hard Drive

    - by zecougar
    Here is the situation. Our organization has a fair amount of data in the form of documents, images, videos stored on a intranet server. We need to be able to expose these documents via some sort of search functionality on the intranet. Provide some mechanism to organize and tag the documents on hard disk. Ideally we'd also like to provide a unified search across documents on the google apps for business instance that we have. Any ideas on how to approach this problem ?

    Read the article

  • Search Result Organization

    - by Vecta
    I'm creating an AJAX live search on a website I'm working on. Users will select values from a few dropdowns and a list of products will be returned based on what they select. Some possible fields would be: color, model, make, etc. What type of organization of search results do users tend to find most useful? Is it better to lump them all together (alphabatized) or is it more useful to lump them together by make? In the past I've tended to group them by "make" but I'm not concerned that this will continually force some items with a make toward the end of the alphabet always to the bottom of the list. Any tips are greatly appreciated.

    Read the article

  • Search for odt files without indexing

    - by josinalvo
    I am looking for: a way to search inside odt files (i.e. search for contents, not name) that does not require any kind of indexing that is graphical and very user-friendly (for a relatively old person, who does not like computers much) I know that it is possible to have 1) and 2): for x in `find . -iname '*odt'`; do odt2txt $x | grep Query; done works well enough, and it's pretty fast. But I wonder if there is already a good solution that does this with a GUI (or can be adapted to do this easily)

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Search Engine Optimization For Great Search Engine Placement!

    Do you do enough search engine optimization to get the search engine placement that you want for the keywords that you want to rank for? If not then read on and I will give you information that you need to know to start getting those rankings that you want, and start receiving traffic! There are a few things I will be going over in this article.

    Read the article

  • Search Engine Optimization For Beginners - How to Write Search Engine Friendly Articles

    If you're planning to implement Search Engine Optimization as an Internet Marketing strategy to boost your site's online coverage then you need to focus one of the most important steps to produce quality results -- writing content. There is more to writing articles or Web content than just stuffing it full of keywords just to make it easy for search engine to find your page and put you on top. There are certain rules to be followed in order for this to be an effective strategy for your SEO.

    Read the article

  • How to recover my inclusion in google results after being penalized for receiving comment spam?

    - by UXdesigner
    My website had very high search engine results, especially in Google. But I left the website for a couple of months and didn't notice the comments were full of SPAM, about 20k comments of SPAM. Then i checked my google results and I'm out of google ! After years of having good results, no spam, how can I now recover from that? The spam problem has been solved completely. No more spam, and the website is very legit and very nice. Well, at least I think I was penalized, I don't see any other reason.

    Read the article

  • Search selected text in Firefox

    - by Jeremy Rudd
    What are the different Firefox extensions that can start a search with the selected text? Firefox has an inbuilt feature to search using the currently selected engine. Select any text Right click the selection Search Google for ... I'm looking for something that will let me choose which search engine I want to search with, from my current list of installed search engines.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >