Search Results

Search found 5945 results on 238 pages for 'supply chain planning'.

Page 15/238 | < Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >

• When you’re on a high, start something big

  - by BuckWoody

  Most days are pretty average – we have some highs, some lows, and just regular old work to do. But some days the sun is shining, your co-workers are especially nice, and everything just falls into place. You really *enjoy* what you do. Don’t let that moment pass. All of us have “big” projects that we need to tackle. Things that are going to take a long time, and a lot of money. Those kinds of data projects take a LOT of planning, and many times we put that off just to get to the day’s work. I’ve found that the “high” moments are the perfect time to take on these big projects. I’m more focused, and more importantly, more positive. And as the quote goes, “whether you think you can or you think you can’t, you’re probably right.” You’ll find a way to make it happen if you’re in a positive mood. Now – having those “great days” is actually something you can influence, but I’ll save that topic for a future post. I have a project to work on. :) Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

  Read the article

• How can I justify a technology over another? (Java over .NET)

  - by user674887

  We are working in a Java/.NET company and my team and I are planning a project for a client. One of the requirements is that the project has to be done in .NET I've asked about this requirement, and the client said that it doesn't matter, and that if I have a good reason we can use other technology. But, I have to justify the decision. As a Project Manager / Analyst I'm interested in making the project in Java because: The team knows java much better, regarding the language and frameworks I don't know anything about .NET technology (and maybe we could make bad decisions thinking in a Java way to do things) There are other people in company that have more skills in .NET but they have other projects with more priority. For experience, I'm sure that if we use Java, the project will have much more quality. But this arguments could be weak from the client perspective. How can I justify making the project in Java? EDIT: I'm not asking if one technology is better than other. "It's not a technology war" question.

  Read the article

• Filter chain halted as [:login_required] rendered_or_redirected

  - by Magicked

  Hopefully I can explain this well enough, but please let me know if more information is needed! I'm building a form where a user can create an "incident". This incident has the following relationships: belongs_to: customer (customer has_many incidents) belongs_to: user (user has_many incidents) has_one: incident_status (incident_status belongs to incident) The form allows the user to assign the incident to a user (select form) and then select an incident status. The incident is nested in customer. However, I'm getting the following in the server logs: Processing IncidentsController#create (for 127.0.0.1 at 2010-04-26 10:41:33) [POST] Parameters: {"commit"=>"Create", "action"=>"create", "authenticity_token"=>"YhW++vd/dnLoNV/DSl1DULcaWq/RwP7jvLOVx9jQblA=", "customer_id"=>"4", "controller"=>"incidents", "incident"=>{"title"=>"Some Bad Incident", "incident_status_id"=>"1", "user_id"=>"2", "other_name"=>"SS01-042310-001"}} User Load (0.3ms) SELECT * FROM "users" WHERE ("users"."id" = 2) LIMIT 1 Redirected to http://localhost:3000/session/new Filter chain halted as [:login_required] rendered_or_redirected. Completed in 55ms (DB: 0) | 302 Found [http://localhost/customers/4/incidents] It looks to me like it's trying to gather information about the user, even though it already has the id (which is all it needs to create the incident), and the user may not have permission to do a select statement like that? I'm rather confused. Here is the relevant (I think) information in the Incident controller. before_filter :login_required, :get_customer def new @incident = @customer.incidents.build @users = @customer.users @statuses = IncidentStatus.find(:all) respond_to do |format| format.html # new.html.erb format.xml { render :xml => @incident } end end def create @incident = @customer.incidents.build(params[:incident]) respond_to do |format| if @incident.save flash[:notice] = 'Incident was successfully created.' format.html { redirect_to(@incident) } format.xml { render :xml => @incident, :status => :created, :location => @incident } else format.html { render :action => "new" } format.xml { render :xml => @incident.errors, :status => :unprocessable_entity } end end end Just as an FYI, I am using the restful_authentication plugin. So in summary, when I submit the incident creation form, it does not save the incident because it halts. I'm still very new to rails, so my skill at diagnosing problems like this is still very bad. I'm going in circles. :) Thanks in advance for any help. Please let me know if more information is needed and I'll edit it in!

  Read the article

• COMPAQ Tower No Signal to monitor

  - by Lancelot

  Hi there, I have had some troubles with this: I received a compaq tower: Compaq Presario SR1224NX Onboard VGA Windows XP SP2 from a friend. It was given to me on condition i give her the files back. My plan was to turn this into an Ubuntu Server. It booted up no problems even with the ubuntu live disc. After a normal shutdown(not unpluggin the power cord and not doing a hard shutdown with the power button), it would not restart even after SEVERAL attempts. I realized the light next to the power supply would flash very rapidly. I researched and found out it was one of two things: a dead power supply or the cables to the motherboard and to the disks etc. Thus i checked to ensure the cables were fine(and they were). I purchased a Power Supply (this one has 400 watts, the initial had 250) and installed it. The tower now boots. It booted into the live disk and everything. After a normal shutdown, it now restarts but is not sending signal to my monitor. I have tried several monitors in which i assure work perfectly but not with this tower(i recall it did show display after replacing the power supply). The monitors are ACER. This is different than most "no Signal" problems since i am not using an external Video Card, this is onboard VGA. Thanks!

  Read the article

• COMPAQ Tower No Signal to monitor

  - by Lancelot

  I received a Compaq tower: Compaq Presario SR1224NX Onboard VGA Windows XP SP2 from a friend. My plan was to turn this into an Ubuntu Server. It booted up with no problems even with the Ubuntu live disc. After a normal shutdown (not unplugging the power cord and not doing a hard shutdown with the power button), it would not restart even after SEVERAL attempts. I realized the light next to the power supply would flash very rapidly. I researched and found out it was one of two things: a dead power supply or the cables to the motherboard and to the disks might be faulty, etc. Thus, I checked to ensure the cables were fine(and they were). I purchased a Power Supply (this one has 400 watts, the initial had 250) and installed it. The tower was able to boot into the live disk and everything. After a normal shutdown, it now restarts but is not sending signal to my monitor. I have tried several monitors in which I know work perfectly but not with this tower (I recall that it did show display after replacing the power supply). The monitors are ACER. This is different than most "no Signal" problems since I am not using an external Video Card, this is onboard VGA.

  Read the article

• How do I use constructor dependency injection to supply Models from a collection to their ViewModels

  - by GraemeF

  I'm using constructor dependency injection in my WPF application and I keep running into the following pattern, so would like to get other people's opinion on it and hear about alternative solutions. The goal is to wire up a hierarchy of ViewModels to a similar hierarchy of Models, so that the responsibility for presenting the information in each model lies with its own ViewModel implementation. (The pattern also crops up under other circumstances but MVVM should make for a good example.) Here's a simplified example. Given that I have a model that has a collection of further models: public interface IPerson { IEnumerable<IAddress> Addresses { get; } } public interface IAddress { } I would like to mirror this hierarchy in the ViewModels so that I can bind a ListBox (or whatever) to a collection in the Person ViewModel: public interface IPersonViewModel { ObservableCollection<IAddressViewModel> Addresses { get; } void Initialize(); } public interface IAddressViewModel { } The child ViewModel needs to present the information from the child Model, so it's injected via the constructor: public class AddressViewModel : IAddressViewModel { private readonly IAddress _address; public AddressViewModel(IAddress address) { _address = address; } } The question is, what is the best way to supply the child Model to the corresponding child ViewModel? The example is trivial, but in a typical real case the ViewModels have more dependencies - each of which has its own dependencies (and so on). I'm using Unity 1.2 (although I think the question is relevant across the other IoC containers), and I am using Caliburn's view strategies to automatically find and wire up the appropriate View to a ViewModel. Here is my current solution: The parent ViewModel needs to create a child ViewModel for each child Model, so it has a factory method added to its constructor which it uses during initialization: public class PersonViewModel : IPersonViewModel { private readonly Func<IAddress, IAddressViewModel> _addressViewModelFactory; private readonly IPerson _person; public PersonViewModel(IPerson person, Func<IAddress, IAddressViewModel> addressViewModelFactory) { _addressViewModelFactory = addressViewModelFactory; _person = person; Addresses = new ObservableCollection<IAddressViewModel>(); } public ObservableCollection<IAddressViewModel> Addresses { get; private set; } public void Initialize() { foreach (IAddress address in _person.Addresses) Addresses.Add(_addressViewModelFactory(address)); } } A factory method that satisfies the Func<IAddress, IAddressViewModel> interface is registered with the main UnityContainer. The factory method uses a child container to register the IAddress dependency that is required by the ViewModel and then resolves the child ViewModel: public class Factory { private readonly IUnityContainer _container; public Factory(IUnityContainer container) { _container = container; } public void RegisterStuff() { _container.RegisterInstance<Func<IAddress, IAddressViewModel>>(CreateAddressViewModel); } private IAddressViewModel CreateAddressViewModel(IAddress model) { IUnityContainer childContainer = _container.CreateChildContainer(); childContainer.RegisterInstance(model); return childContainer.Resolve<IAddressViewModel>(); } } Now, when the PersonViewModel is initialized, it loops through each Address in the Model and calls CreateAddressViewModel() (which was injected via the Func<IAddress, IAddressViewModel> argument). CreateAddressViewModel() creates a temporary child container and registers the IAddress model so that when it resolves the IAddressViewModel from the child container the AddressViewModel gets the correct instance injected via its constructor. This seems to be a good solution to me as the dependencies of the ViewModels are very clear and they are easily testable and unaware of the IoC container. On the other hand, performance is OK but not great as a lot of temporary child containers can be created. Also I end up with a lot of very similar factory methods. Is this the best way to inject the child Models into the child ViewModels with Unity? Is there a better (or faster) way to do it in other IoC containers, e.g. Autofac? How would this problem be tackled with MEF, given that it is not a traditional IoC container but is still used to compose objects?

  Read the article

• Planning to create PDF files in Ruby on Rails

  - by deau

  Hi there, A Ruby on Rails app will have access to a number of images and fonts. The images are components of a visual layout which will be stored separately as a set of rules. The rules specify document dimensions along with which images are used and where. The app needs to take these rules, fetch the images, and generate a PDF that is ready for local printing or emailing. The fonts will also be important. The user needs to customize the layout by inputting text which will be included in the PDF. The PDF must therefore also contain the desired font so that the document renders identically across different machines. Each PDF may have many pages. Each page may have different dimensions but this is not essential. Either way, the ability to manipulate the dimensions and margins given by the PDF is essential. The only thing that needs to be regularly changed is the text. If this is takes too much development then the app can store the layouts in 3rd party PDFs and edit the textual content directly. Eventually though, this will prove too restrictive on the apps intended functionality so I would prefer the app to generate the PDF's itself. I have never worked with PDFs before and, for the most part, I've never had to output anything to the user outside their monitor. A printed medium could require a very different approach to get the best results. If anyone has any advice on how to model the PDF format this it would be really appreciated. The technical aspects of printing such as bleed, resolution and colour have already been factored in to the layouts and images. I am aware that PDF is a proprietary file format and I want to use free or open source software. I have seen a number of Ruby libraries for generating PDF files but because I am new on this scene I have no way to reliably compare them and too little time to implement and test them all. I also have the option of using C to handle this feature and if this is process intensive then that might be preferred. What should I be thinking about and how should I be planning to implement this?

  Read the article

• Where do SATA drives get their power when using a PCI SATA controller on oler PCs?

  - by Sukima

  I've been looking into PCI SATA controller cards online for an older PC and noticed that the ports only have the SATA cable connector and the Power supply does not have the SATA power connectors. I also had a few external eSATA drives which don't power up unless I also plugin the USB cable. Therefore I realize that SATA and eSATA do not carry power and need power else where. When converting older PCs to use a PCI SATA controller how do you provide power to the SATA drives? Anticipating the answer to be some kind of converter cable (which I was unable to search for) then can older power supplies handle added drives? (Assuming a 4 port SATA controller means 4 more drives the power supply has to endure). Or do you have to get a second poer supply and kinda jerry-rig it into an old case?

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Oracle at Logicon 2010

  - by [email protected]

  Oracle will be a premiere sponsor of this year's Logicon event, May 4th and 5th in Atlanta. Attendees of the event will hear a keynote address from Oracle's Vice President of Supply Chain, Maha Muzumdar, as he, along with Eaton Corporation's Vice President of IT, John Gercak, explore what market trends are causing the most significant impact on today's businesses and what organizations are doing to address and take advantage of those trends.   In addition, Oracle is sponsoring a customer and prospect dinner at the Atlanta Grill, rated by Zagat as Atlanta's #1 downtown and southern cuisine restaurant.   Additional event details can be found on WBR's website;http://www.wbresearch.com/logiconusa/

  Read the article

• Ti sei perso l'Oracle EPM Live Webcast sul Project Planning? Ora puoi rivederlo

  - by antonella.buonagurio

  Se non hai potuto seguire l'ultimo webcast EPM dedicato al Project Planning puoi rivederlo a questo link. Il webcast, che fa parte di una serie di live webseminar  dedicati ai professionisti dell'area amministrazione finanza e controllo, è focalizzato sul processo di budgeting, forecasting e controllo di gestione per commessa e delle attività a progetto in ambito economico-finanziario. Durante il webseminar viene presentata  l'integrazione funzionale di Oracle Hyperion EPM System con le altre soluzioni Oracle per il project planning & management. Non perdere l'ultimo appuntamento prima delle vacanze! 13 luglio Oracle EPM Live webcast:  Predictive Planning clicca qui per saperne di più!

  Read the article

• New Procurement Report for Transportation Sourcing

  - by John Murphy

  Welcome to our fourth annual transportation procurement benchmark report. American Shipper, in partnership with the Council of Supply Chain Management Professionals (CSCMP) and the Retail Industry Leaders Association (RILA), surveyed roughly 275 transportation buyers and sellers on procurement practices, processes, technologies and results. Some key findings: • Manual, spreadsheet-based procurement processes remain the most prevalent among transportation buyers, with 42 percent of the total • Another 25 percent of respondents use a hybrid platform, which presumably means these buyers are using spreadsheets for at least one mode and/or geography • Only 23 percent of buyers are using a completely systems-based approach of some kind • Shippers were in a holding pattern with regards to investment in procurement systems the past year • Roughly three-quarters of survey respondents report that transportation spend has increased in 2012, although the pace has declined slightly from last year’s increases • Nearly every survey respondent purchases multiple modes of transportation • The number of respondents with plans to address technology to support the procurement process has increased in 2012. About one quarter of respondents who do not have a system report they have a budget for this investment in the next two years.

  Read the article

• Webinar: Riding the Fence or Planning the Upgrade to 11gR2?

  - by Greg Jensen

   Is your organization riding the Identity and Access fence where you can't decide if you are ready to upgrade?  Are you unsure what the technical and business value gains are, in upgrading to Oracle's 11gR2?  Or are you planning for the upgrade and just unsure of what to expect? In this webinar, experts from Oracle and AmerIndia will discuss the new features of 11gR2, latest market trends, and how IAM transforms organizations. In addition, planning and implementation strategy of the upgrade process will be discussed. The presenters will also share success stories and highlight challenges faced by organizations belonging to different verticals and how Oracle’s solutions and AmerIndia’s services addressed those challenges. Topics include: Market trends and 11gR2 Planning an upgrade Approach and Implementation Strategy Success stories Registration is now open for this Webinar for December 5th from 2pm - 3pm EST. https://blogs.oracle.com/OracleIDM/resource/amerindia-logo.png

  Read the article

• It is worth planning before jumping in the code?

  - by Rushino

  I always thought that planning is important for a game. But i don't know at which point. Some are telling me to code instead of planning but i feel like its still important because when you will be in the code you will know what to do next more easily. I am currently working on a game that will have lots of content so i decided to start a design document introducing thoses content and at a side-level i am doing proofs of concept to check if it can be done. Parts of each proofs of concept then could be used later in the real game. EDIT: I am working alone on this project. So my question is : It is worth planning before jumping in the code ? Im still interested to know what others have to say about this. Cause i still get some poeple saying i should code instead of thinking.. so what your opinion on this ?

  Read the article

• ClassFactory cannot supply requested class 0x80040111 Error: -2147221231

  - by Bjartr

  Using Visual Studio 2008 I first encountered this when trying to open a standard save file dialog box in visual basic. So far I've worked around it after fruitless searching. Now I find that any action which would cause a save/open dialog (eg. ctrl-O) also fails. I've searched more and still don't know how to fix it. Stuff I do know: It's not a Visual Studio error, it apparently can occur in any number of other applications (which is why searching for it is annoying) It's either .NET or COM related, I tried reinstalling all of .NET with no luck, and I've never mucked around with COM ever, I don't really even know what it is. Something is missing, misplaced, or it could be DLL version issues. I really don't want to deal with uninstalling VS2008, or MS Office (as one result I found suggested) or any other big application.

  Read the article

• 2d trajectory planning of a spaceship with physics.

  - by egarcia

  I'm implementing a 2D game with ships in space. In order to do it, I'm using LÖVE, which wraps Box2D with Lua. But I believe that my question can be answered by anyone with a greater understanding of physics than myself - so pseudo code is accepted as a response. My problem is that I don't know how to move my spaceships properly on a 2D physics-enabled world. More concretely: A ship of mass m is located at an initial position {x, y}. It has an initial velocity vector of {vx, vy} (can be {0,0}). The objective is a point in {xo,yo}. The ship has to reach the objective having a velocity of {vxo, vyo} (or near it), following the shortest trajectory. There's a function called update(dt) that is called frequently (i.e. 30 times per second). On this function, the ship can modify its position and trajectory, by applying "impulses" to itself. The magnitude of the impulses is binary: you can either apply it in a given direction, or not to apply it at all). In code, it looks like this: def Ship:update(dt) m = self:getMass() x,y = self:getPosition() vx,vy = self.getLinearVelocity() xo,yo = self:getTargetPosition() vxo,vyo = self:getTargetVelocity() thrust = self:getThrust() if(???) angle = ??? self:applyImpulse(math.sin(angle)*thrust, math.cos(angle)*thrust)) end end The first ??? is there to indicate that in some occasions (I guess) it would be better to "not to impulse" and leave the ship "drift". The second ??? part consists on how to calculate the impulse angle on a given dt. We are in space, so we can ignore things like air friction. Although it would be very nice, I'm not looking for someone to code this for me; I put the code there so my problem is clearly understood. What I need is an strategy - a way of attacking this. I know some basic physics, but I'm no expert. For example, does this problem have a name? That sort of thing. Thanks a lot.

  Read the article

• Recommendation for a redundant 60V DC Powersupply

  - by Lairsdragon

  We have some Telco-Equipment in our data space center which we had been given by our Telco. What they didn't provide is a redundant power supply and therefore we are struggling with outages of this equipment. What I am searching for is a redundant Power-Supply for 60V and 600W 60 Volt DC output 600 Watts rated power 2 220V Input with galvanic separation Rack mountable Any suggestions?

  Read the article

• python3: removing several chars from a string with a long chain of .replace().replace().replace()

  - by MadSc13ntist

  I found this example on stack overflow. I understand it, but seems like a bit much for such a simple method concept... removing several chars from a string. import string exclude = set(string.punctuation) s = ''.join(ch for ch in s if ch not in exclude) is there a builtin string method in python 3.1 to do something to the tune of: s = "a,b,c,d,e,f,g,h,i" s = s.strip([",", "d", "h"]) instead of: s = s.replace(",", "").replace("d", "").replace("h", "")

  Read the article

• How to "chain" modal dialogs in YUI 2 ?

  - by giulio

  I have a modal dialog box presented in Yahoo UI. The user selects a value from dialog "A", and then I want to present another modal dialog box to collect some more data in dialog "B". I have been using the YAHOO.widget.Dialog successfully. The problem seems to be that you can't initiate dialog window "B" from the handler function of dialog "A". So, how can you programmatically launch a second dialog window after the user hits the "OK" button on the first ? (I had tried to create an additional Listener for a field that is updated in dialog "A" to trigger dialog "B" but this doesn't work either.) Thanks..

  Read the article

• Chain of DataBinding

  - by Neir0

  Hello I am trying to do follow DataBinding Property -> DependencyProperty -> Property But i have trouble. For example, We have simple class with two properties implements INotifyPropertyChanged: public class MyClass : INotifyPropertyChanged { private string _num1; public string Num1 { get { return _num1; } set { _num1 = value; OnPropertyChanged("Num1"); } } private string _num2; public string Num2 { get { return _num2; } set { _num2 = value; OnPropertyChanged("Num2"); } } public event PropertyChangedEventHandler PropertyChanged; public void OnPropertyChanged(string e) { PropertyChangedEventHandler handler = PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs(e)); } } And TextBlock declared in xaml: <TextBlock Name="tb" FontSize="20" Foreground="Red" Text="qwerqwerwqer" /> Now lets trying to bind Num1 to tb.Text: private MyClass _myClass = new MyClass(); public MainWindow() { InitializeComponent(); Binding binding1 = new Binding("Num1") { Source = _myClass, Mode = BindingMode.OneWay }; Binding binding2 = new Binding("Num2") { Source = _myClass, Mode = BindingMode.TwoWay }; tb.SetBinding(TextBlock.TextProperty, binding1); //tb.SetBinding(TextBlock.TextProperty, binding2); var timer = new Timer(500) {Enabled = true,}; timer.Elapsed += (sender, args) => _myClass.Num1 += "a"; timer.Start(); } It works well. But if we uncomment this string tb.SetBinding(TextBlock.TextProperty, binding2); then TextBlock display nothing. DataBinding doesn't work! How can i to do what i want?

  Read the article

• Random Page Cost and Planning

  - by Dave Jarvis

  A query (see below) that extracts climate data from weather stations within a given radius of a city using the dates for which those weather stations actually have data. The query uses the table's only index, rather effectively: CREATE UNIQUE INDEX measurement_001_stc_idx ON climate.measurement_001 USING btree (station_id, taken, category_id); Reducing the server's configuration value for random_page_cost from 2.0 to 1.1 had a massive performance improvement for the given range (nearly an order of magnitude) because it suggested to PostgreSQL that it should use the index. While the results now return in 5 seconds (down from ~85 seconds), problematic lines remain. Bumping the query's end date by a single year causes a full table scan: sc.taken_start >= '1900-01-01'::date AND sc.taken_end <= '1997-12-31'::date AND How do I persuade PostgreSQL to use the indexes regardless of years between the two dates? (A full table scan against 43 million rows is probably not the best plan.) Find the EXPLAIN ANALYSE results below the query. Thank you! Query SELECT extract(YEAR FROM m.taken) AS year, avg(m.amount) AS amount FROM climate.city c, climate.station s, climate.station_category sc, climate.measurement m WHERE c.id = 5182 AND earth_distance( ll_to_earth(c.latitude_decimal,c.longitude_decimal), ll_to_earth(s.latitude_decimal,s.longitude_decimal)) / 1000 <= 30 AND s.elevation BETWEEN 0 AND 3000 AND s.applicable = TRUE AND sc.station_id = s.id AND sc.category_id = 1 AND sc.taken_start >= '1900-01-01'::date AND sc.taken_end <= '1996-12-31'::date AND m.station_id = s.id AND m.taken BETWEEN sc.taken_start AND sc.taken_end AND m.category_id = sc.category_id GROUP BY extract(YEAR FROM m.taken) ORDER BY extract(YEAR FROM m.taken) 1900 to 1996: Index "Sort (cost=1348597.71..1348598.21 rows=200 width=12) (actual time=2268.929..2268.935 rows=92 loops=1)" " Sort Key: (date_part('year'::text, (m.taken)::timestamp without time zone))" " Sort Method: quicksort Memory: 32kB" " -> HashAggregate (cost=1348586.56..1348590.06 rows=200 width=12) (actual time=2268.829..2268.886 rows=92 loops=1)" " -> Nested Loop (cost=0.00..1344864.01 rows=744510 width=12) (actual time=0.807..2084.206 rows=134893 loops=1)" " Join Filter: ((m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (sc.station_id = m.station_id))" " -> Nested Loop (cost=0.00..12755.07 rows=1220 width=18) (actual time=0.502..521.937 rows=23 loops=1)" " Join Filter: ((sec_to_gc(cube_distance((ll_to_earth((c.latitude_decimal)::double precision, (c.longitude_decimal)::double precision))::cube, (ll_to_earth((s.latitude_decimal)::double precision, (s.longitude_decimal)::double precision))::cube)) / 1000::double precision) <= 30::double precision)" " -> Index Scan using city_pkey1 on city c (cost=0.00..2.47 rows=1 width=16) (actual time=0.014..0.015 rows=1 loops=1)" " Index Cond: (id = 5182)" " -> Nested Loop (cost=0.00..9907.73 rows=3659 width=34) (actual time=0.014..28.937 rows=3458 loops=1)" " -> Seq Scan on station_category sc (cost=0.00..970.20 rows=3659 width=14) (actual time=0.008..10.947 rows=3458 loops=1)" " Filter: ((taken_start >= '1900-01-01'::date) AND (taken_end <= '1996-12-31'::date) AND (category_id = 1))" " -> Index Scan using station_pkey1 on station s (cost=0.00..2.43 rows=1 width=20) (actual time=0.004..0.004 rows=1 loops=3458)" " Index Cond: (s.id = sc.station_id)" " Filter: (s.applicable AND (s.elevation >= 0) AND (s.elevation <= 3000))" " -> Append (cost=0.00..1072.27 rows=947 width=18) (actual time=6.996..63.199 rows=5865 loops=23)" " -> Seq Scan on measurement m (cost=0.00..25.00 rows=6 width=22) (actual time=0.000..0.000 rows=0 loops=23)" " Filter: (m.category_id = 1)" " -> Bitmap Heap Scan on measurement_001 m (cost=20.79..1047.27 rows=941 width=18) (actual time=6.995..62.390 rows=5865 loops=23)" " Recheck Cond: ((m.station_id = sc.station_id) AND (m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (m.category_id = 1))" " -> Bitmap Index Scan on measurement_001_stc_idx (cost=0.00..20.55 rows=941 width=0) (actual time=5.775..5.775 rows=5865 loops=23)" " Index Cond: ((m.station_id = sc.station_id) AND (m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (m.category_id = 1))" "Total runtime: 2269.264 ms" 1900 to 1997: Full Table Scan "Sort (cost=1370192.26..1370192.76 rows=200 width=12) (actual time=86165.797..86165.809 rows=94 loops=1)" " Sort Key: (date_part('year'::text, (m.taken)::timestamp without time zone))" " Sort Method: quicksort Memory: 32kB" " -> HashAggregate (cost=1370181.12..1370184.62 rows=200 width=12) (actual time=86165.654..86165.736 rows=94 loops=1)" " -> Hash Join (cost=4293.60..1366355.81 rows=765061 width=12) (actual time=534.786..85920.007 rows=139721 loops=1)" " Hash Cond: (m.station_id = sc.station_id)" " Join Filter: ((m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end))" " -> Append (cost=0.00..867005.80 rows=43670150 width=18) (actual time=0.009..79202.329 rows=43670079 loops=1)" " -> Seq Scan on measurement m (cost=0.00..25.00 rows=6 width=22) (actual time=0.001..0.001 rows=0 loops=1)" " Filter: (category_id = 1)" " -> Seq Scan on measurement_001 m (cost=0.00..866980.80 rows=43670144 width=18) (actual time=0.008..73312.008 rows=43670079 loops=1)" " Filter: (category_id = 1)" " -> Hash (cost=4277.93..4277.93 rows=1253 width=18) (actual time=534.704..534.704 rows=25 loops=1)" " -> Nested Loop (cost=847.87..4277.93 rows=1253 width=18) (actual time=415.837..534.682 rows=25 loops=1)" " Join Filter: ((sec_to_gc(cube_distance((ll_to_earth((c.latitude_decimal)::double precision, (c.longitude_decimal)::double precision))::cube, (ll_to_earth((s.latitude_decimal)::double precision, (s.longitude_decimal)::double precision))::cube)) / 1000::double precision) <= 30::double precision)" " -> Index Scan using city_pkey1 on city c (cost=0.00..2.47 rows=1 width=16) (actual time=0.012..0.014 rows=1 loops=1)" " Index Cond: (id = 5182)" " -> Hash Join (cost=847.87..1352.07 rows=3760 width=34) (actual time=6.427..35.107 rows=3552 loops=1)" " Hash Cond: (s.id = sc.station_id)" " -> Seq Scan on station s (cost=0.00..367.25 rows=7948 width=20) (actual time=0.004..23.529 rows=7949 loops=1)" " Filter: (applicable AND (elevation >= 0) AND (elevation <= 3000))" " -> Hash (cost=800.87..800.87 rows=3760 width=14) (actual time=6.416..6.416 rows=3552 loops=1)" " -> Bitmap Heap Scan on station_category sc (cost=430.29..800.87 rows=3760 width=14) (actual time=2.316..5.353 rows=3552 loops=1)" " Recheck Cond: (category_id = 1)" " Filter: ((taken_start >= '1900-01-01'::date) AND (taken_end <= '1997-12-31'::date))" " -> Bitmap Index Scan on station_category_station_category_idx (cost=0.00..429.35 rows=6376 width=0) (actual time=2.268..2.268 rows=6339 loops=1)" " Index Cond: (category_id = 1)" "Total runtime: 86165.936 ms"

  Read the article

• Git repo planning questions

  - by masonk

  At work, development uses perforce to handle code sharing. I won't say "revision control", because we aren't allowed to check in changes until they are ready for regression testing. In order to get my personal change sets under revision control, I've been given the go-ahead to build my own git and initialize the client view of the perforce depot as a git repo. There are some difficulties in doing this, however. The client view lives in a subfolder of ~, (~/p4), and I want to put ~ under revision control as well, with its own separate history. I can't figure out how to keep the history for ~ separate from ~/p4 without using a submodule. The problem with a submodule is that it looks like I have to go make a repository that will become the submodule and then git submodule add <repo> <path>. But there is nowhere to make the submodule's repository except in ~. There seems to be no safe place to create the initial client view of the depot with git p4 clone. (I'm working off of the assumption that initing or cloning a repo into a subdirectory of a git repo is not supported. At least, I can find nothing authoritative on nested git repos.) edit: Is merely ignoring ~/p4 in the repo rooted at ~ enough to allow me to init a nested repo in ~/p4? My __git_ps1 function still thinks I'm in a git repository when I visit an ignored subdirectory of a git repo, so I'm inclined to think not. I need the "remote" repository created by git p4 sync to be a branch in ~/p4. We are required to keep all of our code in ~/p4 so that it doesn't get backed up. Can I pull from a "remote" branch that is really a local branch? This one is just for convenience, but I thought I could learn something by asking it. For 99% of the project, I just want to start the with the p4 head revision as the inital commit object. For the other 1%, I would like to suck down the entire p4 history so that I can browse it in git. IOW, after I'm done initalizing it, the initial commit of remotes/p4/master branch will contain: revision 1 of //depot/prod/Foo/Bar/* revision X of other files in //depot/prod/*, where X is the head revision and the remotes/p4/master branch contains Y commits, where Y is the number of changelists that had a file in //depot/prod/Foo/Bar/*, with each commit in the history corresponding to one of those p4 changelists, and HEAD looking like p4's head.

  Read the article

• STM32 Compiler/Debugger Chain?

  - by Nate

  I'm starting a project with a STMicro STM32. I've done the Google searches, looking for solid compiler/debugger chains but would prefer answers with success stories. Open Source Compilers/Linkers would be ideal, I just don't know if their STM32 toolchains are stable yet. (Both C, C++ compilers are acceptable). -- So commercial options are acceptable as well. Do any of you have useful suggestions?

  Read the article

• Chain LINQ IQueryable, and end with Stored Procedure

  - by Alex

  I'm chaining search criteria in my application through IQueryable extension methods, e.g.: public static IQueryable<Fish> AtAge (this IQueryable<Fish> fish, Int32 age) { return fish.Where(f => f.Age == age); } However, I also have a full text search stored procedure: CREATE PROCEDURE [dbo].[Fishes_FullTextSearch] @searchtext nvarchar(4000), @limitcount int AS SELECT Fishes.* FROM Fishes INNER JOIN CONTAINSTABLE(Fishes, *, @searchtext, @limitcount) AS KEY_TBL ON Fishes.Id = KEY_TBL.[KEY] ORDER BY KEY_TBL.[Rank] The stored procedure obviously doesn't return IQueryable, however, is it possible to somehow limit the result set for the stored procedure using IQueryable's? I'm envisioning something like .AtAge(5).AboveWeight(100).Fishes_FulltextSearch("abc"). In this case, the fulltext search should execute on a smaller subset of my Fishes table (narrowed by Age and Weight). Is something like this possible? Sample code?

  Read the article

• outer join for parent child chain

  - by dotnetcoder

  Considering below tables and relationships: parent --1:Many-- children --1:Many-- shubchildren Parent may or many not have children records. children always have subchildren records. I wan to write a qiery to select parent names where any if matched parent.name,children.name or subchildren.name Here i understand I have to do a left outer join between parent and children. But what kind of join should I put between children and subchildren ?

  Read the article

< Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >