Search Results

Search found 5306 results on 213 pages for 'trailing character'.

Page 15/213 | < Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >

  • XML/PHP : Content is not allowed in trailing section

    - by Tristan
    Hello, i have this message error and i don't know where does the problem comes from: <?php include "DBconnection.class.php"; $sql = DBConnection::getInstance(); $requete = "SELECT g.siteweb, g.offreDedie, g.coupon, g.only_dedi, g.transparence, g.abonnement , s.GSP_nom as nom , COUNT(s.GSP_nom) as nb_votes, TRUNCATE(AVG(vote), 2) as qualite, TRUNCATE(AVG(prix), 2) as rapport, TRUNCATE(AVG(serviceClient), 2) as serviceCli, TRUNCATE(AVG(interface), 2) as interface, TRUNCATE(AVG(services), 2) as services FROM votes_serveur AS v INNER JOIN serveur AS s ON v.idServ = s.idServ INNER JOIN gsp AS g ON s.GSP_nom = g.nom WHERE s.valide = 1 GROUP BY s.GSP_nom"; $sql->query($requete); $xml = '<?xml version="1.0" encoding="UTF-8" ?><GamerCertified>'; while($row = $sql->fetchArray()){ $moyenne_services = ($row['services'] + $row['serviceCli'] + $row['interface'] ) / 3 ; $moyenne_services = round( $moyenne_services, 2); $moyenne_ge = ($row['services'] + $row['serviceCli'] + $row['interface'] + $row['qualite'] + $row['rapport'] ) / 5 ; $moyenne_ge = round( $moyenne_ge, 2); $xml .= '<GSP>'; $xml .= '<nom>'.$row["nom"].'</nom>'; $xml .= '<nombre-votes>'.$row["nb_votes"].'</nombre-votes>'; $xml .= '<services>'.$moyenne_services.'</services>'; $xml .= '<qualite>'.$row["qualite"].'</qualite>'; $xml .= '<prix>'.$row["rapport"].'</prix>'; $xml .= '<label-transparence>'.$row["transparence"].'</label-transparence>'; $xml .= '<moyenne-generale>'.$moyenne_ge.'</moyenne-generale>'; $xml .= '<serveurs-dedies>'.$row["offreDedie"].'</serveurs-dedies>'; $xml .= '</GSP>'; } $xml .= '</GamerCertified>'; echo $xml; Thanks

    Read the article

  • How to get strptime to raise ArgumentError with garbage trailing characters

    - by Matt Briggs
    We have to handle user specified date formats in our application. We decided to go with Date.strptime for parsing and validation, which works great, except for how it just ignores any garbage data entered. Here is an irb session demonstrating the issue ree-1.8.7-2010.01 > require 'date' => true ree-1.8.7-2010.01 > d = Date.strptime '2001-01-01failfailfail', '%Y-%m-%d' => #<Date: 4903821/2,0,2299161> ree-1.8.7-2010.01 > d.to_s => "2001-01-01" what we would like, is behavior more like this ree-1.8.7-2010.01 > d = Date.strptime '2001failfailfail-01-01', '%Y-%m-%d' ArgumentError: invalid date Any suggestions would be appreciated

    Read the article

  • nginx trailing slash issues

    - by ry
    I'm googling a lot and found several workarounds, but you have to deinfe every single directory. On Apache: example.com/hi - example.com/hi/ On nginx: example.com/hi - Firefox can't establish a connection to the server at example.com:8888 where 8888 is what Apache is listening on (nginx's :80 - localhost:8888) Any ideas how to fix this and have it just forward normally like folder?

    Read the article

  • how can multiple trailing slashes can be removed from an url in Ruby

    - by splintercell
    Hello, What i'm trying to achieve here is lets say we have two example urls: url1 "http://emy.dod.com/kaskaa/dkaiad/amaa//////////" & url2 = "http://www.example.com/". How can I extract the striped down urls? url1 : "http://emy.dod.com/kaskaa/dkaiad/amaa" & url2 to "http://http://www.example.com"? URI.parse in ruby sanitizes certain type of malformed url but is ineffective in this case. If we use regex then /^(.*)\/$/ removes a single slash (/) from url1 & is ineffective for url2. Is anybody aware of how to handle this type of url parsing? The point here is I dont want my system to have "http://www.example.com/" & "http://www.example.com" being treated as two different urls. And same goes for "http://emy.dod.com/kaskaa/dkaiad/amaa////" & "http://emy.dod.com/kaskaa/dkaiad/amaa/" cheers, -dg

    Read the article

  • Python raw strings and trailing back slashes.

    - by dash-tom-bang
    I ran across something once upon a time and wondered if it was a Python "bug" or at least a misfeature. I'm curious if anyone knows of any justifications for this behavior. I thought of it just now reading "Code Like a Pythonista," which has been enjoyable so far. I'm only familiar with the 2.x line of Python. Raw strings are strings that are prefixed with an r. This is great because I can use backslashes in regular expressions and I don't need to double everything everywhere. It's also handy for writing throwaway scripts on Windows, so I can use backslashes there also. (I know I can also use forward slashes, but throwaway scripts often contain content cut&pasted from elsewhere in Windows.) So great! Unless, of course, you really want your string to end with a backslash. There's no way to do that in a 'raw' string. In [9]: r'\n' Out[9]: '\\n' In [10]: r'abc\n' Out[10]: 'abc\\n' In [11]: r'abc\' ------------------------------------------------ File "<ipython console>", line 1 r'abc\' ^ SyntaxError: EOL while scanning string literal In [12]: r'abc\\' Out[12]: 'abc\\\\' So one slash before the closing quote is an error, but two slashes gives you two slashes! Certainly I'm not the only one that is bothered by this? Thoughts on why 'raw' strings are 'raw, except for slash-quote'? I mean, if I wanted to embed a single quote in there I'd just use double quotes around the string, and vice versa. If I wanted both, I'd just triple quote. If I really wanted three quotes in a row in a raw string, well, I guess I'd have to deal, but is this considered "proper behavior"?

    Read the article

  • losing leading & trailing space when translated using Google Machine Translation

    - by Sourabh
    Hi , I am using google ajax based translation API like in the below example. google.load("language", "1"); function initialize() { var text = document.getElementById("text").innerHTML; google.language.detect(text, function(result) { if (!result.error && result.language) { google.language.translate(text, result.language, "en", function(result) { var translated = document.getElementById("translation"); if (result.translation) { translated.innerHTML = result.translation; } }); } }); } google.setOnLoadCallback(initialize); When I send string like " how are you? " The transaltion what I get is like "xxx xxx xxxxxxx" . the spaces in the original string are trimmed.How do I prevent it from happening ?

    Read the article

  • nginx improperly forwards to https, adds two trailing slashes when rewriting

    - by Kevin
    I'm using nginx as a proxy for a django project on mod_wsgi and to serve the static content. I have two domain names for it: asdf-example.com and asdfexample.com. I want to use rewrites to redirect everything to www.asdf-example.com They're not quite working the way they should: asdf-example.com forwards to https:// www.asdf-example.com, which fails because I'm not using SSL. Though asdf-example.com/search forwards to http://.... asdfexample.com and www.asdfexample.com both forward to www.asdf-example.com//, which looks weird. My config file: server { listen 80; server_name asdf-example.com asdfexample.com; if ($host ~* ^asdf-example\.com){ rewrite ^(.*)$ http://www.asdf-example.com/$1 permanent; } if ($host ~* ^asdfexample\.com){ rewrite ^(.*)$ http://www.asdf-example.com/$1 permanent; } if ($host ~* ^www\.asdfexample\.com){ rewrite ^(.*)$ http://www.asdf-example.com/$1 permanent; } ... Thanks

    Read the article

  • XSD string pattern independent of leading/trailing space

    - by AndiDog
    I have a XSD simple type that should match UUIDs: <simpleType name="UuidT"> <restriction base="string"> <pattern value="[a-f0-9]{8}-[a-f0-9]{4}-[a-f0-9]{4}-[a-f0-9]{4}-[a-f0-9]{12}" /> </restriction> </simpleType> It correctly matches the following content: <!-- valid --> <Uuid>12345678-1234-5678-9012-123456789012</Uuid> But it doesn't match content that contains excess whitespace: <!-- not valid --> <Uuid> 2de25a81-b117-4b2a-b910-50f0878884f7 </Uuid> Sure, I could add \s* to both sides of the regex, but isn't there a simpler solution in XSD?

    Read the article

  • Get rid of Trailing Numbers in C

    - by Tech163
    For example, #include <stdio.h> int main (int argc, const char * argv[]) { char out = printf("teststring"); printf("%d\n", out); return 0; } will return teststring10. Anyone has an idea how to get rid of the 10? Thanks in advance.

    Read the article

  • Javascript: parseInt() with trailing characters

    - by chris_l
    parseInt("7em", 10); returns 7 in all browsers I tested [*]. But can I rely on this? The reason I ask is, that I want to perform some calculations based on em, like /* elem1.style.top uses em units */ elem2.style.top = parseInt(elem1.style.top, 10) + 1 + "em"; I could do this with regular expressions, but parseInt is easier to use, and probably a bit faster. Or is there another solution (maybe using jQuery)? [*] Tested so far on: IE 6, IE 8, Safari 4, Firefox 3.6, Opera 10.5

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Regex - Trim character at the end of a string

    - by Torez
    I am trying to remove a trailing - (dash) at the end of the string. Here is my code: <?php $str = 'SAVE $45! - Wed. Beach Co-ed 6s (Jul-Aug)'; echo ereg_replace('([^a-z0-9]+)','-',strtolower($str)); ?> produces this: save-45-wed-beach-co-ed-6s-jul-aug- How can I remove a specific trailing character only if its there, in this case the dash? Thanks in advance.

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

  • 3D Character/Model Creator

    - by Click Ok
    I'm in a project to create a 3d game using XNA/C#, and the game will use a lot of 3d characters. Looking at the current 3d games, in some they create near to hundreds of characters, what lead me to think that there are some good 3d character/model creator. To narrow the sample, the game will have characters like the game "Grand Chase". There are some good (and easy) character model creator for to use in XNA development? Free is better, of course, but I will get payed versions too. EDIT: Another question is about the movements of the characters. The movements like walk, jump, sit, etc are "created" by the "character creator tool" or by the game?

    Read the article

  • how to use different oracle character sets in one application

    - by Peter Shower
    Hi Guys, i'm developing a 32bit Client-Application with Delphi. From this application I need to connect to databases on two different servers. First databse character set ist WE8MSWIN1252, the other server decodes with WE8PC850. Setting the client NLS_LANG parameter to the correct value solves correct sql-query results. Unfortunately this (the client character-set) seems only to be recognized on applications startup (first connect to oracle). I need to change the client-characterset at runtime. Oracle client seems to store the character set an application used to connect! beside: I#m using udl-files to setup the connections (Microsoft OLE DB - driver) what can I do?

    Read the article

  • smarter character replacement using ruby gsub and regexp

    - by agriciuc
    Hi guys! I'm trying to create permalink like behavior for some article titles and i don't want to add a new db field for permalink. So i decided to write a helper that will convert my article title from: "O "focoasa" a pornit cruciada, împotriva barbatilor zgârciti" to "o-focoasa-a-pornit-cruciada-impotriva-barbatilor-zgarciti". While i figured out how to replace spaces with hyphens and remove other special characters (other than -) using: title.gsub(/\s/, "-").gsub(/[^\w-]/, '').downcase I am wondering if there is any other way to replace a character with a specific other character from only one .gsub method call, so I won't have to chain title.gsub("a", "a") methods for all the UTF-8 special characters of my localization. I was thinking of building a hash with all the special characters and their counterparts but I haven't figured out yet how to use variables with regexps. What I was looking for is something like: title.gsub(/\s/, "-").gsub(*replace character goes here*).gsub(/[^\w-]/, '').downcase Thanks!

    Read the article

  • Perl TDS character sets

    - by skiphoppy
    I'm using the FreeTDS driver with DBD::Sybase, connecting to an MS SQL Server. When I query certain values of certain records, I get this error: DBD::Sybase::st fetchrow_arrayref failed: OpenClient message: LAYER = (0) ORIGIN = (0) SEVERITY = (9) NUMBER = (99) Server , database Message String: WARNING! Some character(s) could not be converted into client's character set. Unconverted bytes were changed to question marks ('?'). This seems to happen for records that contain special Windows character-set characters, such as curly quotes, copied and pasted from people's Outlook and Word messages. Unfortunately, I do not have any control of this database; sanitizing the input on the way in is obviously the way to go, but is not available to me. What FreeTDS settings do I need to change to be able to successfully query these records?

    Read the article

< Previous Page | 11 12 13 14 15 16 17 18 19 20 21 22  | Next Page >