Search Results

Search found 4074 results on 163 pages for 'titanium modules'.

Page 151/163 | < Previous Page | 147 148 149 150 151 152 153 154 155 156 157 158  | Next Page >

  • How do I delete a [sub]hash based off of the keys/values of another hash?

    - by Zack
    Lets assume I have two hashes. One of them contains a set of data that only needs to keep things that show up in the other hash. e.g. my %hash1 = ( test1 => { inner1 => { more => "alpha", evenmore => "beta" } }, test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, test3 => { inner9999 => { ohlookmore => "golf", somethingelse => "foxtrot" } } ); my %hash2 = ( major=> { test2 => "inner2", test3 => "inner3" } ); What I would like to do, is to delete the whole subhash in hash1 if it does not exist as a key/value in hash2{major}, preferably without modules. The information contained in "innerX" does not matter, it merely must be left alone (unless the subhash is to be deleted then it can go away). In the example above after this operation is preformed hash1 would look like: my %hash1 = ( test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, ); It deletes hash1{test1} and hash1{test3} because they don't match anything in hash2. Here's what I've currently tried, but it doesn't work. Nor is it probably the safest thing to do since I'm looping over the hash while trying to delete from it. However I'm deleting at the each which should be okay? This was my attempt at doing this, however perl complains about: Can't use string ("inner1") as a HASH ref while "strict refs" in use at while(my ($test, $inner) = each %hash1) { if(exists $hash2{major}{$test}{$inner}) { print "$test($inner) is in exists.\n"; } else { print "Looks like $test($inner) does not exist, REMOVING.\n"; #not to sure if $inner is needed to remove the whole entry delete ($hash1{$test}{$inner}); } }

    Read the article

  • Using PHP session_id() to Make Sure iframe is Generated by Our Server Dynamically

    - by Michael Robinson
    We use iframes to show ads on our site. Iframes are used to allow us to keep the ad generation code and other site modules separate. As we track ad views on our site, and need to be able to keep an accurate count of which pagetype gets what views, I must ensure that users can't simply copy-paste the iframe in which the ad is loaded onto another site. This would cause ad count to become inflated for this page, and the count would not match the view count of the page the iframe "should" be displayed in. Before anyone says so: no I can't simply compare the page view count with the ad view count, or use the page view count * number of ads per page, as # of ads per page will not necessarily be static. I need to come up with a solution that will allow ads to be shown only for iframes that are generated dynamically and are shown on our pages. I am not familiar with PHP sessions, but from what little reading I have had time to do, the following seems to be to be an acceptable solution: Add "s = session_id()" to the src of the ad's iframe. In the code that receives and processes ad requests, only return (and count) and ad if s == session_id(). Please correct me if I'm wrong, but this would ensure: Ads would only be returned to iframes whose src was generated alongside the rest of the page's content, as is the case during normal use. We can return our logo to ad calls with an invalid session_id. So a simple example would be: One of our pages: <?php session_start(); ?> <div id="someElement"> <!-- EVERYONE LOVES ADS --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=<?php echo session_id(); ?>></iframe> </div> ad/can_has_ad.php: <?php session_start(); ?> if($_GET['s'] == session_id()){ echo 'can has ad'; } else{ echo '<img src="http://awesomesite.com/images/canhaslogo.jpg"/>'; } And finally, copied code with static 's' parameter: <!-- HAHA LULZ I WILL SCREW WITH YOUR AD VIEW COUNTS LULZ HAHA --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=77f2b5fcdab52f52607888746969b0ad></iframe> Which would give them an iframe showing our awesome site's logo, and not screw with our view counts. I made some basic test cases: two files, one that generates the iframe and echos it, and one that the iframe's src is pointed to, that checks the 's' parameter and shows an appropriate message depending on the result. I copied the iframe into a file and hosted it on a different server, and the correct message was displayed (cannot has ad). So, my question is: Would this work or am I being a PHP session noob, with the above test being a total fluke? Thanks for your time! Edit: I'm trying to solve this without touching the SQL server

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • mod_rewrite not working for a specific directory

    - by punkish
    This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

    Read the article

  • Do you use an exception class in your Perl programs? Why or why not?

    - by daotoad
    I've got a bunch of questions about how people use exceptions in Perl. I've included some background notes on exceptions, skip this if you want, but please take a moment to read the questions and respond to them. Thanks. Background on Perl Exceptions Perl has a very basic built-in exception system that provides a spring-board for more sophisticated usage. For example die "I ate a bug.\n"; throws an exception with a string assigned to $@. You can also throw an object, instead of a string: die BadBug->new('I ate a bug.'); You can even install a signal handler to catch the SIGDIE psuedo-signal. Here's a handler that rethrows exceptions as objects if they aren't already. $SIG{__DIE__} = sub { my $e = shift; $e = ExceptionObject->new( $e ) unless blessed $e; die $e; } This pattern is used in a number of CPAN modules. but perlvar says: Due to an implementation glitch, the $SIG{DIE} hook is called even inside an eval(). Do not use this to rewrite a pending exception in $@ , or as a bizarre substitute for overriding CORE::GLOBAL::die() . This strange action at a distance may be fixed in a future release so that $SIG{DIE} is only called if your program is about to exit, as was the original intent. Any other use is deprecated. So now I wonder if objectifying exceptions in sigdie is evil. The Questions Do you use exception objects? If so, which one and why? If not, why not? If you don't use exception objects, what would entice you to use them? If you do use exception objects, what do you hate about them, and what could be better? Is objectifying exceptions in the DIE handler a bad idea? Where should I objectify my exceptions? In my eval{} wrapper? In a sigdie handler? Are there any papers, articles or other resources on exceptions in general and in Perl that you find useful or enlightening.

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

  • Passing custom info to mongrel_rails start

    - by whaka
    One thing I really don't understand is how I can pass custom start-up options to a mongrel instance. I see that a common approach is the use environment variables, but in my environment this is not going to work because my rails application serves many different clients. Much code is shared between clients, but there are also many differences which I implement by subclassing controllers and views to overload or extend existing features or introduce new ones. To make this all work, I simply add the paths to client specific modules the module load path ($:). In order to start the application for a particular client, I could now use an environment variable like say, TARGET=AMAZONE. Unfortunately, on some systems I'm running multiple mongrel clusters, each cluster serving a different client. Some of these systems run under Windows and to start mongrel I installed mongrel_services. Clearly, this makes my environment variable unsuitable. Passing this extra bit of data to the application is proving to be a real challenge. For a start, mongrel_rails service_install will reject any [custom] command line parameters that aren't documented. I'm not too concerned as installing the services using the install program is trivial. However, even if I manage to install mongrel_services such that when run it passes the custom command line option --target to mongrel_rails start, I get an error because mongrel_rails doesn't recognize the switch. So here were the things I looked at: Pass an extra parameter: mongrel_rails start --target XYZ ... use a config file and add target:XYZ, then do: mongrel_rails start -C x:\myapp\myconfig.yml modify the file: Ruby\lib\ruby\gems\1.8\gems\mongrel-1.1.5-x86-mswin32-60\lib\mongrel\command.rb Perhaps I can use the --script option, but all docs that I found on it were for Unix 1 and 2 simply don't work. I played with 4 but never managed it to do anything. So I had no choice but to go with 3. While it is relatively simple, I hate changing ruby library code. Particularly disappointing is that 2 doesn't work. I mean what is so unreasonable about adding other [custom] options in the config file? Actually I think this is a fundamental piece that is missing in rails. Somehow, the application should be able to register and access command line arguments it expects. If anybody has a good idea how to do this more elegantly using the current infrastructure, I have a chocolate fish to give away!!!

    Read the article

  • Send invitation to any user of google chats (is it possible?)

    - by Gizzo
    Hi I try to realize simple code on perl which should just get/send messages from/to gtalk accounts. I use Net::XMPP::* modules. All works just fine for users, who are my friends (in my "buddy" list). But i can't send message to unknown user. I know, that for this case i must send an invitation first, but Net::XMPP::* don't provide this possibility. There is only one way to invite person - construct my own xml according to "XEP-0155 Stanza Session Negotiation" protocol. But this doesn't work correct. When i send xml to server, it returns error "service-unavailable". I send: <message to='[email protected]'> <sxde xmlns='http://jabber.org/protocol/sxde' xmlns:sxde='http://jabber.org/protocol/sxde#metadata' session='0AEF4278DC4B6577' id='b'> <negotiation> <invitation> <feature var='http://jabber.org/protocol/whiteboard' /> </invitation> </negotiation> </sxde> </message> before my message. ANSWER: <message from='' to='[email protected]/TALKCDDCCE63' type='error'> <sxde id='b' session='0AEF4278DC4B6577' xmlns='http://jabber.org/protocol/sxde' xmlns:sxde='http://jabber.org/protocol/sxde#metadata'> <negotiation> <invitation> <feature var='http://jabber.org/protocol/whiteboard'/> </invitation> </negotiation> </sxde> <nos:x value='disabled' xmlns:nos='google:nosave'/> <arc:record otr='false' xmlns:arc='http://jabber.org/protocol/archive'/> <error code='503' type='cancel'> <service-unavailable xmlns='urn:ietf:params:xml:ns:xmpp-stanzas'/> </error> </message> Maybe i lost smth or should send another info before (or after..) ? Or maybe there are another way to send message without any invitation? Thanks in advance

    Read the article

  • Archive tar files to a different location inperl

    - by user314261
    Hi, I am a newbee in Perl. I am reading a directory having some archive files and uncompressing the archive files one by one. Everything seems well however the files are getting uncompressed in the folder which has the main perl code module which is running the sub modules. I want the archive to be generated in the folder I specify. This is my code: sub ExtractFile { #Read the folder which was copied in the output path recursively and extract if any file is compressed my $dirpath = $_[0]; opendir(D, "$dirpath") || die "Can't open dir $dirpath: $!\n"; my @list = readdir(D); closedir(D); foreach my $f (@list) { print " \$f = $f"; if(-f $dirpath."/$f") { #print " File in directory $dirpath \n ";#is \$f = $f\n"; my($file_name, $file_dirname,$filetype)= fileparse($f,qr{\..*}); #print " \nThe file extension is $filetype"; #print " \nThe file name is is $file_name"; # If compressed file then extract the file if($filetype eq ".tar" or $filetype eq ".tzr.gz") { my $arch_file = $dirpath."/$f"; print "\n file to be extracted is $arch_file"; my $tar = Archive::Tar->new($arch_file); #$tar->extract() or die ("Cannot extract file $arch_file"); #mkdir($dirpath."/$file_name"); $tar->extract_file($arch_file,$dirpath."/$file_name" ) or die ("Cannot extract file $arch_file"); } } if(-d $dirpath."/$f") { if($f eq "." or $f eq "..") { next; } print " Directory\n";# is $f"; ExtractFile($dirpath."/$f"); } } } The method ExtractFile is called recursively to loop all the archives. When using $tar-extract() it uncompresses in the folder which calls this metohd. when I use $tar-extract_file($arch_file,$dirpath."/$file_name" ) I get an error : No such file in archive: '/home/fsang/dante/workspace/output/s.tar' at /home/fsang/dante/lib/Extraction.pm line 80 Please help I have checked that path and input output there is no issue with it. Seems some usage problem I am not aware of for $tar-extract_file(). Many thanks for anyone resolving this issue. Regards, Sakshi

    Read the article

  • sys.path() and PYTHONPATH issues

    - by Justin
    I've been learning Python, I'm working in 2.7.3, and I'm trying to understand import statements. The documentation says that when you attempt to import a module, the interpreter will first search for one of the built-in modules. What is meant by a built-in module? Then, the documentation says that the interpreter searches in the directories listed by sys.path, and that sys.path is initialized from these sources: the directory containing the input script (or the current directory). PYTHONPATH (a list of directory names, with the same syntax as the shell variable PATH). the installation-dependent default. Here is a sample output of a sys.path command from my computer using python in command-line mode: (I deleted a few so that it wouldn't be huge) ['', '/usr/lib/python2.7', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol'] Now, I'm assuming that the '' path refers to the directory containing the 'script', and so I figured the rest of them would be coming from my PYTHONPATH environmental variable. However, when I go to the terminal and type env, PYTHONPATH doesn't exist as an environmental variable. I also tried import os then os.environ, but I get the same output. Do I really not have a PYTHONPATH environmental variable? I don't believe I ever specifically defined a PYTHONPATH environmental variable, but I assumed that when I installed new packages they automatically altered that environment variable. If I don't have a PYTHONPATH, how is my sys.path getting populated? If I download new packages, how does Python know where to look for them if I don't have this PYTHONPATH variable? How do environment variables work? From what I understand, environment variables are specific to the process for which they are set, however, if I open multiple terminal windows and run env, they all display a number of identical variables, for example, PATH. I know there file locations for persistent environment variables, for example /etc/environment, which contains my PATH variable. Is it possible to tell where a persistent environment variable is stored? What is the recommended location for storing new persistent environment variables? How do environment variables actually work with say, the Python interpreter? The Python interpreter looks for PYTHONPATH, but how does it work at the nitty-gritty level?

    Read the article

  • Lighttpd + fastcgi + python (for django) slow on first request

    - by EagleOne
    I'm having a problem with a django website I host with lighttpd + fastcgi. It works great but it seems that the first request always takes up to 3seconds. Subsequent requests are much faster (<1s). I activated access logs in lighttpd in order to track the issue. But I'm kind of stuck. Here are logs where I 'lose' 4s (from 10:04:17 to 10:04:21): 2012-12-01 10:04:17: (mod_fastcgi.c.3636) handling it in mod_fastcgi 2012-12-01 10:04:17: (response.c.470) -- before doc_root 2012-12-01 10:04:17: (response.c.471) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.472) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.473) Path : 2012-12-01 10:04:17: (response.c.521) -- after doc_root 2012-12-01 10:04:17: (response.c.522) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.523) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.524) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:17: (response.c.541) -- logical -> physical 2012-12-01 10:04:17: (response.c.542) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.543) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.544) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:21: (response.c.128) Response-Header: HTTP/1.1 200 OK Last-Modified: Sat, 01 Dec 2012 09:04:21 GMT Expires: Sat, 01 Dec 2012 09:14:21 GMT Content-Type: text/html; charset=utf-8 Cache-Control: max-age=600 Transfer-Encoding: chunked Date: Sat, 01 Dec 2012 09:04:21 GMT Server: lighttpd/1.4.28 I guess that if there is a problem, it's whith my configuration. So here is the way I launch my django app: python manage.py runfcgi method=threaded host=127.0.0.1 port=3033 And here is my lighttpd conf: server.modules = ( "mod_access", "mod_alias", "mod_compress", "mod_redirect", "mod_rewrite", "mod_fastcgi", "mod_accesslog", ) server.document-root = "/var/www" server.upload-dirs = ( "/var/cache/lighttpd/uploads" ) server.errorlog = "/var/log/lighttpd/error.log" server.pid-file = "/var/run/lighttpd.pid" server.username = "www-data" server.groupname = "www-data" accesslog.filename = "/var/log/lighttpd/access.log" debug.log-request-header = "enable" debug.log-response-header = "enable" debug.log-file-not-found = "enable" debug.log-request-handling = "enable" debug.log-timeouts = "enable" debug.log-ssl-noise = "enable" debug.log-condition-cache-handling = "enable" debug.log-condition-handling = "enable" fastcgi.server = ( "/finderauto.fcgi" => ( "main" => ( # Use host / port instead of socket for TCP fastcgi "host" => "127.0.0.1", "port" => 3033, #"socket" => "/home/finderadmin/finderauto.sock", "check-local" => "disable", "fix-root-scriptname" => "enable", ) ), ) alias.url = ( "/media" => "/home/user/django/contrib/admin/media/", ) url.rewrite-once = ( "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/finderauto.fcgi$1", ) index-file.names = ( "index.php", "index.html", "index.htm", "default.htm", " index.lighttpd.html" ) url.access-deny = ( "~", ".inc" ) static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ## Use ipv6 if available #include_shell "/usr/share/lighttpd/use-ipv6.pl" dir-listing.encoding = "utf-8" server.dir-listing = "enable" compress.cache-dir = "/var/cache/lighttpd/compress/" compress.filetype = ( "application/x-javascript", "text/css", "text/html", "text/plain" ) include_shell "/usr/share/lighttpd/create-mime.assign.pl" include_shell "/usr/share/lighttpd/include-conf-enabled.pl" If any of you could help me finding out where I lose these 3 or 4 s. I would much appreciate. Thanks in advance!

    Read the article

  • unmet dependencies in Ubuntu 12.04

    - by lee.O
    I tried today to install a dvb-card on my Ubuntu 12.04 (Linux blauhai-linux 3.2.0-25-generic #40-Ubuntu SMP Wed May 23 20:30:51 UTC 2012 x86_64 x86_64 x86_64 GNU/Linux ). The installation failed with an error. After that, i tried to install python (it was already installed but i got this error): linux:~$ sudo apt-get install git Reading package lists... Done Building dependency tree Reading state information... Done git is already the newest version. You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies: python-glade2:i386 : Depends: python:i386 (< 2.5) but it is not going to be installed Depends: python-support:i386 (= 0.3.4) but it is not installable Depends: python:i386 (= 2.4) but it is not going to be installed Depends: libglade2-0:i386 (= 1:2.5.1) but it is not going to be installed Depends: python-gtk2:i386 (= 2.8.6-8) but it is not going to be installed python-numeric:i386 : Depends: python:i386 (< 2.5) but it is not going to be installed Depends: python:i386 (= 2.3) but it is not going to be installed Depends: python-central:i386 (= 0.5.7) but it is not installable E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution). well, i can read and tried the proposed command, but then i get this: linux:~$ sudo apt-get -f install Reading package lists... Done Building dependency tree Reading state information... Done Correcting dependencies... Done The following packages were automatically installed and are no longer required: libopenal1:i386 libsdl-ttf2.0-0:i386 libkrb5-3:i386 libgconf-2-4:i386 libsm-dev libatk1.0-0:i386 libk5crypto3:i386 libstdc++5:i386 libqt4-declarative:i386 libxcomposite1:i386 libice-dev libgail18:i386 libldap-2.4-2:i386 libao-common libv4l-0:i386 liblcms1:i386 libqt4-qt3support:i386 libroken18-heimdal:i386 libunistring0:i386 libcupsimage2:i386 libgphoto2-port0:i386 libidn11:i386 libnss3:i386 libcaca0:i386 gtk2-engines:i386 libgudev-1.0-0:i386 libjpeg-turbo8:i386 libpthread-stubs0 libcairo-gobject2:i386 libavc1394-0:i386 libjpeg8:i386 libotr2 libaio1:i386 libsane:i386 odbcinst1debian2 odbcinst1debian2:i386 libqt4-test:i386 libqt4-script:i386 libqt4-designer:i386 libsdl-mixer1.2:i386 libqt4-network:i386 libqt4-dbus:i386 libcap2:i386 libproxy1:i386 ibus-gtk:i386 libdbus-glib-1-2:i386 libtdb1:i386 libasn1-8-heimdal:i386 libspeex1:i386 libxslt1.1:i386 libgomp1:i386 libcapi20-3:i386 libibus-1.0-0:i386 libcairo2:i386 libgnutls26:i386 libopenal-data odbcinst libgssapi3-heimdal:i386 libcanberra0:i386 libtasn1-3:i386 libfreetype6:i386 x11proto-kb-dev gtk2-engines-murrine:i386 libwavpack1:i386 libqt4-opengl:i386 libsoup-gnome2.4-1:i386 libv4lconvert0:i386 gstreamer0.10-plugins-good:i386 libc6-i386 lib32gcc1 libqt4-xmlpatterns:i386 librsvg2-common:i386 libdatrie1:i386 xtrans-dev libavahi-common-data:i386 libiec61883-0:i386 lib32asound2 libgdk-pixbuf2.0-0:i386 libsdl-image1.2:i386 libp11-kit0:i386 x11proto-input-dev libwind0-heimdal:i386 libpixman-1-0:i386 libsdl1.2debian:i386 libxaw7:i386 libgdbm3:i386 libcups2:i386 libcurl3:i386 libqtcore4:i386 libxinerama1:i386 libesd0:i386 libmikmod2:i386 libkrb5support0:i386 libxft2:i386 libxt-dev libcroco3:i386 libpulse-mainloop-glib0:i386 libice6:i386 libaa1:i386 libieee1284-3:i386 libgcrypt11:i386 libthai0:i386 libao4:i386 libkeyutils1:i386 libxmu6:i386 libcanberra-gtk0:i386 libvorbisfile3:i386 libqt4-sql:i386 esound-common libxpm4:i386 libqt4-svg:i386 libusb-0.1-4:i386 libgail-common:i386 libxrender1:i386 libhcrypto4-heimdal:i386 libraw1394-11:i386 libnspr4:i386 libshout3:i386 libdv4:i386 libhx509-5-heimdal:i386 libxau-dev libqt4-xml:i386 gstreamer0.10-x:i386 libgettextpo0:i386 libxss1:i386 libgd2-xpm:i386 libheimbase1-heimdal:i386 libtiff4:i386 libsdl-net1.2:i386 libjasper1:i386 libgnome-keyring0:i386 libxtst6:i386 gtk2-engines-pixbuf:i386 libqtgui4:i386 libtag1c2a:i386 librsvg2-2:i386 libavahi-client3:i386 libssl0.9.8:i386 libmpg123-0:i386 libmad0:i386 libsasl2-2:i386 xorg-sgml-doctools libgsoap1 gtk2-engines-oxygen:i386 libfontconfig1:i386 xaw3dg:i386 libpango1.0-0:i386 libsm6:i386 libx11-dev libheimntlm0-heimdal:i386 libpulsedsp:i386 lib32stdc++6 libx11-doc libqt4-sql-mysql:i386 libxcb-render0:i386 libodbc1:i386 libexif12:i386 libqt4-scripttools:i386 librtmp0:i386 libgssapi-krb5-2:i386 libxi6:i386 libqtwebkit4:i386 libxcb1-dev libxp6:i386 libaudio2:i386 libxcursor1:i386 libxcb-shm0:i386 libxt6:i386 libxv1:i386 libsasl2-modules:i386 libavahi-common3:i386 libxrandr2:i386 x11proto-core-dev libsqlite3-0:i386 libmng1:i386 libgtk2.0-0:i386 libxdmcp-dev libpthread-stubs0-dev libltdl7:i386 libkrb5-26-heimdal:i386 libssl1.0.0:i386 glib-networking:i386 libgpg-error0:i386 libsoup2.4-1:i386 libgphoto2-2:i386 libtag1-vanilla:i386 libaudiofile1:i386 libglade2-0:i386 Use 'apt-get autoremove' to remove them. The following extra packages will be installed: default-jre default-jre-headless icedtea-6-jre-cacao icedtea-6-jre-jamvm icedtea-netx icedtea-netx-common libglade2-0:i386 libpython3.2 openjdk-6-jre openjdk-6-jre-headless openjdk-6-jre-lib python3 python3-minimal python3-uno python3.2 python3.2-minimal Suggested packages: icedtea-plugin sun-java6-fonts fonts-ipafont-gothic fonts-ipafont-mincho ttf-telugu-fonts ttf-oriya-fonts ttf-kannada-fonts ttf-bengali-fonts python3-doc python3-tk python3.2-doc binfmt-support The following packages will be REMOVED: activity-log-manager-control-center aisleriot alacarte apparmor apport apport-gtk apt-xapian-index aptdaemon apturl apturl-common bluez bluez-alsa bluez-alsa:i386 bluez-gstreamer checkbox checkbox-qt command-not-found compiz compiz-gnome compiz-plugins-main-default compizconfig-backend-gconf deja-dup duplicity eog evolution-data-server firefox firefox-globalmenu firefox-gnome-support foomatic-db-compressed-ppds gconf-editor gconf2 gdb gedit gir1.2-mutter-3.0 gir1.2-peas-1.0 gir1.2-rb-3.0 gir1.2-totem-1.0 gir1.2-ubuntuoneui-3.0 gksu gnome-applets gnome-applets-data gnome-bluetooth gnome-contacts gnome-control-center gnome-media gnome-menus gnome-orca gnome-panel gnome-panel-data gnome-session-fallback gnome-shell gnome-sudoku gnome-terminal gnome-terminal-data gnome-themes-standard gnome-tweak-tool gnome-user-share gstreamer0.10-gconf gwibber gwibber-service gwibber-service-facebook gwibber-service-identica gwibber-service-twitter hplip hplip-data ia32-libs ia32-libs-multiarch:i386 ibus ibus-pinyin ibus-table indicator-datetime indicator-power jockey-common jockey-gtk landscape-client-ui-install language-selector-common language-selector-gnome launchpad-integration libcanberra-gtk-module libcanberra-gtk-module:i386 libcanberra-gtk3-module libcompizconfig0 libfolks-eds25 libgksu2-0 libgnome-media-profiles-3.0-0 libgnome2-0 libgnome2-common libgnomevfs2-0 libgnomevfs2-common libgweather-3-0 libgweather-common libgwibber-gtk2 libgwibber2 libmetacity-private0 libmutter0 libpeas-1.0-0 libpurple-bin libpython2.7 libreoffice-gnome librhythmbox-core5 libsyncdaemon-1.0-1 libtotem0 libubuntuoneui-3.0-1 light-themes lsb-release metacity metacity-common mutter-common nautilus-dropbox nautilus-share network-manager-gnome nvidia-common nvidia-settings nvidia-settings-updates onboard oneconf openjdk-7-jdk openjdk-7-jre openprinting-ppds pidgin pidgin-libnotify pidgin-otr printer-driver-foo2zjs printer-driver-ptouch printer-driver-pxljr printer-driver-sag-gdi printer-driver-splix python python-appindicator python-apport python-apt python-apt-common python-aptdaemon python-aptdaemon.gtk3widgets python-aptdaemon.pkcompat python-brlapi python-cairo python-central python-chardet python-configglue python-crypto python-cups python-cupshelpers python-dateutil python-dbus python-debian python-debtagshw python-defer python-dirspec python-egenix-mxdatetime python-egenix-mxtools python-gconf python-gdbm python-gi python-gi-cairo python-glade2:i386 python-gmenu python-gnomekeyring python-gnupginterface python-gobject python-gobject-2 python-gpgme python-gst0.10 python-gtk2 python-httplib2 python-ibus python-imaging python-keyring python-launchpadlib python-lazr.restfulclient python-lazr.uri python-libproxy python-libxml2 python-louis python-mako python-markupsafe python-minimal python-notify python-numeric:i386 python-oauth python-openssl python-packagekit python-pam python-pexpect python-piston-mini-client python-pkg-resources python-problem-report python-protobuf python-pyatspi2 python-pycurl python-pyinotify python-renderpm python-reportlab python-reportlab-accel python-serial python-simplejson python-smbc python-software-properties python-speechd python-twisted-bin python-twisted-core python-twisted-names python-twisted-web python-ubuntu-sso-client python-ubuntuone-client python-ubuntuone-control-panel python-ubuntuone-storageprotocol python-uno python-virtkey python-wadllib python-xapian python-xdg python-xkit python-zeitgeist python-zope.interface python2.7 python2.7-minimal rhythmbox rhythmbox-mozilla rhythmbox-plugin-cdrecorder rhythmbox-plugin-magnatune rhythmbox-plugin-zeitgeist rhythmbox-plugins rhythmbox-ubuntuone screen-resolution-extra sessioninstaller skype software-center software-center-aptdaemon-plugins software-properties-common software-properties-gtk system-config-printer-common system-config-printer-gnome system-config-printer-udev texlive-extra-utils totem totem-mozilla totem-plugins ubuntu-artwork ubuntu-desktop ubuntu-minimal ubuntu-sso-client ubuntu-sso-client-gtk ubuntu-standard ubuntu-system-service ubuntuone-client ubuntuone-client-gnome ubuntuone-control-panel ubuntuone-couch ubuntuone-installer ufw unattended-upgrades unity unity-2d unity-common unity-lens-applications unity-lens-video unity-scope-musicstores unity-scope-video-remote update-manager update-manager-core update-notifier update-notifier-common usb-creator-common usb-creator-gtk virtualbox virtualbox-dkms virtualbox-qt xdiagnose xul-ext-ubufox zeitgeist zeitgeist-core zeitgeist-datahub The following NEW packages will be installed: default-jre default-jre-headless icedtea-6-jre-cacao icedtea-6-jre-jamvm icedtea-netx icedtea-netx-common libglade2-0:i386 libpython3.2 openjdk-6-jre openjdk-6-jre-headless openjdk-6-jre-lib python3 python3-minimal python3-uno python3.2 python3.2-minimal WARNING: The following essential packages will be removed. This should NOT be done unless you know exactly what you are doing! python-minimal python2.7-minimal (due to python-minimal) 0 upgraded, 16 newly installed, 273 to remove and 0 not upgraded. 2 not fully installed or removed. Need to get 39.1 MB of archives. After this operation, 324 MB disk space will be freed. You are about to do something potentially harmful. To continue type in the phrase 'Yes, do as I say!' ?] Thats not good, is it?! Should i run this command or should i run another command to fix this problem? Would be great if somebody can help me. :) Thanks in advance. best regards

    Read the article

  • Multi-tenant ASP.NET MVC – Introduction

    - by zowens
    I’ve read a few different blogs that talk about multi-tenancy and how to resolve some of the issues surrounding multi-tenancy. What I’ve come to realize is that these implementations overcomplicate the issues and give only a muddy implementation! I’ve seen some really illogical code out there. I have recently been building a multi-tenancy framework for internal use at eagleenvision.net. Through this process, I’ve realized a few different techniques to make building multi-tenant applications actually quite easy. I will be posting a few different entries over the issue and my personal implementation. In this first post, I will discuss what multi-tenancy means and how my implementation will be structured.   So what’s the problem? Here’s the deal. Multi-tenancy is basically a technique of code-reuse of web application code. A multi-tenant application is an application that runs a single instance for multiple clients. Here the “client” is different URL bindings on IIS using ASP.NET MVC. The problem with different instances of the, essentially, same application is that you have to spin up different instances of ASP.NET. As the number of running instances of ASP.NET grows, so does the memory footprint of IIS. Stack Exchange shifted its architecture to multi-tenancy March. As the blog post explains, multi-tenancy saves cost in terms of memory utilization and physical disc storage. If you use the same code base for many applications, multi-tenancy just makes sense. You’ll reduce the amount of work it takes to synchronize the site implementations and you’ll thank your lucky stars later for choosing to use one application for multiple sites. Multi-tenancy allows the freedom of extensibility while relying on some pre-built code.   You’d think this would be simple. I have actually seen a real lack of reference material on the subject in terms of ASP.NET MVC. This is somewhat surprising given the number of users of ASP.NET MVC. However, I will certainly fill the void ;). Implementing a multi-tenant application takes a little thinking. It’s not straight-forward because the possibilities of implementation are endless. I have yet to see a great implementation of a multi-tenant MVC application. The only one that comes close to what I have in mind is Rob Ashton’s implementation (all the entries are listed on this page). There’s some really nasty code in there… something I’d really like to avoid. He has also written a library (MvcEx) that attempts to aid multi-tenant development. This code is even worse, in my honest opinion. Once I start seeing Reflection.Emit, I have to assume the worst :) In all seriousness, if his implementation makes sense to you, use it! It’s a fine implementation that should be given a look. At least look at the code. I will reference MvcEx going forward as a comparison to my implementation. I will explain why my approach differs from MvcEx and how it is better or worse (hopefully better).   Core Goals of my Multi-Tenant Implementation The first, and foremost, goal is to use Inversion of Control containers to my advantage. As you will see throughout this series, I pass around containers quite frequently and rely on their use heavily. I will be using StructureMap in my implementation. However, you could probably use your favorite IoC tool instead. <RANT> However, please don’t be stupid and abstract your IoC tool. Each IoC is powerful and by abstracting the capabilities, you’re doing yourself a real disservice. Who in the world swaps out IoC tools…? No one!</RANT> (It had to be said.) I will outline some of the goodness of StructureMap as we go along. This is really an invaluable tool in my tool belt and simple to use in my multi-tenant implementation. The second core goal is to represent a tenant as easily as possible. Just as a dependency container will be a first-class citizen, so will a tenant. This allows us to easily extend and use tenants. This will also allow different ways of “plugging in” tenants into your application. In my implementation, there will be a single dependency container for a single tenant. This will enable isolation of the dependencies of the tenant. The third goal is to use composition as a means to delegate “core” functions out to the tenant. More on this later.   Features In MvcExt, “Modules” are a code element of the infrastructure. I have simplified this concept and have named this “Features”. A feature is a simple element of an application. Controllers can be specified to have a feature and actions can have “sub features”. Each tenant can select features it needs and the other features will be hidden to the tenant’s users. My implementation doesn’t require something to be a feature. A controller can be common to all tenants. For example, (as you will see) I have a “Content” controller that will return the CSS, Javascript and Images for a tenant. This is common logic to all tenants and shouldn’t be hidden or considered a “feature”; Content is a core component.   Up next My next post will be all about the code. I will reveal some of the foundation to the way I do multi-tenancy. I will have posts dedicated to Foundation, Controllers, Views, Caching, Content and how to setup the tenants. Each post will be in-depth about the issues and implementation details, while adhering to my core goals outlined in this post. As always, comment with questions of DM me on twitter or send me an email.

    Read the article

  • Error on 64 Bit Install of IIS &ndash; LoadLibraryEx failed on aspnet_filter.dll

    - by Rick Strahl
    I’ve been having a few problems with my Windows 7 install and trying to get IIS applications to run properly in 64 bit. After installing IIS and creating virtual directories for several of my applications and firing them up I was left with the following error message from IIS: Calling LoadLibraryEx on ISAPI filter “c:\windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll” failed This is on Windows 7 64 bit and running on an ASP.NET 4.0 Application configured for running 64 bit (32 bit disabled). It’s also on what is essentially a brand new installation of IIS and Windows 7. So it failed right out of the box. The problem here is that IIS is trying to loading this ISAPI filter from the 32 bit folder – it should be loading from Framework64 folder note the Framework folder. The aspnet_filter.dll component is a small Win32 ISAPI filter used to back up the cookieless session state for ASP.NET on IIS 7 applications. It’s not terribly important because of this focus, but it’s a default loaded component. After a lot of fiddling I ended up with two solutions (with the help and support of some Twitter folks): Switch IIS to run in 32 bit mode Fix the filter listing in ApplicationHost.config Switching IIS to allow 32 Bit Code This is a quick fix for the problem above which enables 32 bit code in the Application Pool. The problem above is that IIS is trying to load a 32 bit ISAPI filter and enabling 32 bit code gets you around this problem. To configure your Application Pool, open the Application Pool in IIS Manager bring up Advanced Options and Enable 32 Bit Applications: And voila the error message above goes away. Fix Filters Enabling 32 bit code is a quick fix solution to this problem, but not an ideal one. If you’re running a pure .NET application that doesn’t need to do COM or pInvoke Interop with 32 bit apps there’s usually no need for enabling 32 bit code in an Application Pool as you can run in native 64 bit code. So trying to get 64 bit working natively is a pretty key feature in my opinion :-) So what’s the problem – why is IIS trying to load a 32 bit DLL in a 64 bit install, especially if the application pool is configured to not allow 32 bit code at all? The problem lies in the server configuration and the fact that 32 bit and 64 bit configuration settings exist side by side in IIS. If I open my Default Web Site (or any other root Web Site) and go to the ISAPI filter list here’s what I see: Notice that there are 3 entries for ASP.NET 4.0 in this list. Only two of them however are specifically scoped to the specifically to 32 bit or 64 bit. As you can see the 64 bit filter correctly points at the Framework64 folder to load the dll, while both the 32 bit and the ‘generic’ entry point at the plain Framework 32 bit folder. Aha! Hence lies our problem. You can edit ApplicationHost.config manually, but I ran into the nasty issue of not being able to easily edit that file with the 32 bit editor (who ever thought that was a good idea???? WTF). You have to open ApplicationHost.Config in a 64 bit native text editor – which Visual Studio is not. Or my favorite editor: EditPad Pro. Since I don’t have a native 64 bit editor handy Notepad was my only choice. Or as an alternative you can use the IIS 7.5 Configuration Editor which lets you interactively browse and edit most ApplicationHost settings. You can drill into the configuration hierarchy visually to find your keys and edit attributes and sub values in property editor type interface. I had no idea this tool existed prior to today and it’s pretty cool as it gives you some visual clues to options available – especially in absence of an Intellisense scheme you’d get in Visual Studio (which doesn’t work). To use the Configuration Editor go the Web Site root and use the Configuration Editor option in the Management Group. Drill into System.webServer/isapiFilters and then click on the Collection’s … button on the right. You should now see a display like this: which shows all the same attributes you’d see in ApplicationHost.config (cool!). These entries correspond to these raw ApplicationHost.config entries: <filter name="ASP.Net_4.0" path="C:\Windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0" /> <filter name="ASP.Net_4.0_64bit" path="C:\Windows\Microsoft.NET\Framework64\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0,bitness64" /> <filter name="ASP.Net_4.0_32bit" path="C:\Windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0,bitness32" /> The key attribute we’re concerned with here is the preCondition and the bitness subvalue. Notice that the ‘generic’ version – which comes first in the filter list – has no bitness assigned to it, so it defaults to 32 bit and the 32 bit dll path. And this is where our problem comes from. The simple solution to fix the startup problem is to remove the generic entry from this list here or in the filters list shown earlier and leave only the bitness specific versions active. The preCondition attribute acts as a filter and as you can see here it filters the list by runtime version and bitness value. This is something to keep an eye out in general – if a bitness values are missing it’s easy to run into conflicts like this with any settings that are global and especially those that load modules and handlers and other executable code. On 64 bit systems it’s a good idea to explicitly set the bitness of all entries or remove the non-specific versions and add bit specific entries. So how did this get misconfigured? I installed IIS before everything else was installed on this machine and then went ahead and installed Visual Studio. I suspect the Visual Studio install munged this up as I never saw a similar problem on my live server where everything just worked right out of the box. In searching about this problem a lot of solutions pointed at using aspnet_regiis –r from the Framework64 directory, but that did not fix this extra entry in the filters list – it adds the required 32 bit and 64 bit entries, but it doesn’t remove the errand un-bitness set entry. Hopefully this post will help out anybody who runs into a similar situation without having to trouble shoot all the way down into the configuration settings and noticing the bitness settings. It’s a good lesson learned for me – this is my first desktop install of a 64 bit OS and things like this are what I was reluctant to find. Now that I ran into this I have a good idea what to look for with 32/64 bit misconfigurations in IIS at least.© Rick Strahl, West Wind Technologies, 2005-2011Posted in IIS7   ASP.NET  

    Read the article

  • Silverlight 4 Tools for VS 2010 and WCF RIA Services Released

    - by ScottGu
    The final release of the Silverlight 4 Tools for Visual Studio 2010 and WCF RIA Services is now available for download.  Download and Install If you already have Visual Studio 2010 installed (or the free Visual Web Developer 2010 Express), then you can install both the Silverlight 4 Tooling Support as well as WCF RIA Services support by downloading and running this setup package (note: please make sure to uninstall the preview release of the Silverlight 4 Tools for VS 2010 if you have previously installed that).  The Silverlight 4 Tools for VS 2010 package extends the Silverlight support built into Visual Studio 2010 and enables support for Silverlight 4 applications as well.  It also installs WCF RIA Services application templates and libraries: Today’s release includes the English edition of the Silverlight 4 Tooling – localized versions will be available next month for other Visual Studio languages as well. Silverlight Tooling Support Visual Studio 2010 includes rich tooling support for building Silverlight and WPF applications. It includes a WYSIWYG designer surface that enables you to easily use controls to construct UI – including the ability to take advantage of layout containers, and apply styles and resources: The VS 2010 designer enables you to leverage the rich data binding support within Silverlight and WPF, and easily wire-up bindings on controls.  The Data Sources window within Silverlight projects can be used to reference POCO objects (plain old CLR objects), WCF Services, WCF RIA Services client proxies or SharePoint Lists.  For example, let’s assume we add a “Person” class like below to our project: We could then add it to the Data Source window which will cause it to show up like below in the IDE: We can optionally customize the default UI control types that are associated for each property on the object.  For example, below we’ll default the BirthDate property to be represented by a “DatePicker” control: And then when we drag/drop the Person type from the Data Sources onto the design-surface it will automatically create UI controls that are bound to the properties of our Person class: VS 2010 allows you to optionally customize each UI binding further by selecting a control, and then right-click on any of its properties within the property-grid and pull up the “Apply Bindings” dialog: This will bring up a floating data-binding dialog that enables you to easily configure things like the binding path on the data source object, specify a format convertor, specify string-format settings, specify how validation errors should be handled, etc: In addition to providing WYSIWYG designer support for WPF and Silverlight applications, VS 2010 also provides rich XAML intellisense and code editing support – enabling a rich source editing environment. Silverlight 4 Tool Enhancements Today’s Silverlight 4 Tooling Release for VS 2010 includes a bunch of nice new features.  These include: Support for Silverlight Out of Browser Applications and Elevated Trust Applications You can open up a Silverlight application’s project properties window and click the “Enable Running Application Out of Browser” checkbox to enable you to install an offline, out of browser, version of your Silverlight 4 application.  You can then customize a number of “out of browser” settings of your application within Visual Studio: Notice above how you can now indicate that you want to run with elevated trust, with hardware graphics acceleration, as well as customize things like the Window style of the application (allowing you to build a nice polished window style for consumer applications). Support for Implicit Styles and “Go to Value Definition” Support: Silverlight 4 now allows you to define “implicit styles” for your applications.  This allows you to style controls by type (for example: have a default look for all buttons) and avoid you having to explicitly reference styles from each control.  In addition to honoring implicit styles on the designer-surface, VS 2010 also now allows you to right click on any control (or on one of it properties) and choose the “Go to Value Definition…” context menu to jump to the XAML where the style is defined, and from there you can easily navigate onward to any referenced resources.  This makes it much easier to figure out questions like “why is my button red?”: Style Intellisense VS 2010 enables you to easily modify styles you already have in XAML, and now you get intellisense for properties and their values within a style based on the TargetType of the specified control.  For example, below we have a style being set for controls of type “Button” (this is indicated by the “TargetType” property).  Notice how intellisense now automatically shows us properties for the Button control (even within the <Setter> element): Great Video - Watch the Silverlight Designer Features in Action You can see all of the above Silverlight 4 Tools for Visual Studio 2010 features (and some more cool ones I haven’t mentioned) demonstrated in action within this 20 minute Silverlight.TV video on Channel 9: WCF RIA Services Today we also shipped the V1 release of WCF RIA Services.  It is included and automatically installed as part of the Silverlight 4 Tools for Visual Studio 2010 setup. WCF RIA Services makes it much easier to build business applications with Silverlight.  It simplifies the traditional n-tier application pattern by bringing together the ASP.NET and Silverlight platforms using the power of WCF for communication.  WCF RIA Services provides a pattern to write application logic that runs on the mid-tier and controls access to data for queries, changes and custom operations. It also provides end-to-end support for common tasks such as data validation, authentication and authorization based on roles by integrating with Silverlight components on the client and ASP.NET on the mid-tier. Put simply – it makes it much easier to query data stored on a server from a client machine, optionally manipulate/modify the data on the client, and then save it back to the server.  It supports a validation architecture that helps ensure that your data is kept secure and business rules are applied consistently on both the client and middle-tiers. WCF RIA Services uses WCF for communication between the client and the server  It supports both an optimized .NET to .NET binary serialization format, as well as a set of open extensions to the ATOM format known as ODATA and an optional JavaScript Object Notation (JSON) format that can be used by any client. You can hear Nikhil and Dinesh talk a little about WCF RIA Services in this 13 minutes Channel 9 video. Putting it all Together – the Silverlight 4 Training Kit Check out the Silverlight 4 Training Kit to learn more about how to build business applications with Silverlight 4, Visual Studio 2010 and WCF RIA Services. The training kit includes 8 modules, 25 videos, and several hands-on labs that explain Silverlight 4 and WCF RIA Services concepts and walks you through building an end-to-end application with them.    The training kit is available for free and is a great way to get started. Summary I’m really excited about today’s release – as they really complete the Silverlight development story and deliver a great end to end runtime + tooling story for building applications.  All of the above features are available for use both in VS 2010 as well as the free Visual Web Developer 2010 Express Edition – making it really easy to get started building great solutions. Hope this helps, Scott P.S. In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu

    Read the article

  • Metro: Introduction to the WinJS ListView Control

    - by Stephen.Walther
    The goal of this blog entry is to provide a quick introduction to the ListView control – just the bare minimum that you need to know to start using the control. When building Metro style applications using JavaScript, the ListView control is the primary control that you use for displaying lists of items. For example, if you are building a product catalog app, then you can use the ListView control to display the list of products. The ListView control supports several advanced features that I plan to discuss in future blog entries. For example, you can group the items in a ListView, you can create master/details views with a ListView, and you can efficiently work with large sets of items with a ListView. In this blog entry, we’ll keep things simple and focus on displaying a list of products. There are three things that you need to do in order to display a list of items with a ListView: Create a data source Create an Item Template Declare the ListView Creating the ListView Data Source The first step is to create (or retrieve) the data that you want to display with the ListView. In most scenarios, you will want to bind a ListView to a WinJS.Binding.List object. The nice thing about the WinJS.Binding.List object is that it enables you to take a standard JavaScript array and convert the array into something that can be bound to the ListView. It doesn’t matter where the JavaScript array comes from. It could be a static array that you declare or you could retrieve the array as the result of an Ajax call to a remote server. The following JavaScript file – named products.js – contains a list of products which can be bound to a ListView. (function () { "use strict"; var products = new WinJS.Binding.List([ { name: "Milk", price: 2.44 }, { name: "Oranges", price: 1.99 }, { name: "Wine", price: 8.55 }, { name: "Apples", price: 2.44 }, { name: "Steak", price: 1.99 }, { name: "Eggs", price: 2.44 }, { name: "Mushrooms", price: 1.99 }, { name: "Yogurt", price: 2.44 }, { name: "Soup", price: 1.99 }, { name: "Cereal", price: 2.44 }, { name: "Pepsi", price: 1.99 } ]); WinJS.Namespace.define("ListViewDemos", { products: products }); })(); The products variable represents a WinJS.Binding.List object. This object is initialized with a plain-old JavaScript array which represents an array of products. To avoid polluting the global namespace, the code above uses the module pattern and exposes the products using a namespace. The list of products is exposed to the world as ListViewDemos.products. To learn more about the module pattern and namespaces in WinJS, see my earlier blog entry: http://stephenwalther.com/blog/archive/2012/02/22/metro-namespaces-and-modules.aspx Creating the ListView Item Template The ListView control does not know how to render anything. It doesn’t know how you want each list item to appear. To get the ListView control to render something useful, you must create an Item Template. Here’s what our template for rendering an individual product looks like: <div id="productTemplate" data-win-control="WinJS.Binding.Template"> <div class="product"> <span data-win-bind="innerText:name"></span> <span data-win-bind="innerText:price"></span> </div> </div> This template displays the product name and price from the data source. Normally, you will declare your template in the same file as you declare the ListView control. In our case, both the template and ListView are declared in the default.html file. To learn more about templates, see my earlier blog entry: http://stephenwalther.com/blog/archive/2012/02/27/metro-using-templates.aspx Declaring the ListView The final step is to declare the ListView control in a page. Here’s the markup for declaring a ListView: <div data-win-control="WinJS.UI.ListView" data-win-options="{ itemDataSource:ListViewDemos.products.dataSource, itemTemplate:select('#productTemplate') }"> </div> You declare a ListView by adding the data-win-control to an HTML DIV tag. The data-win-options attribute is used to set two properties of the ListView. The ListView is associated with its data source with the itemDataSource property. Notice that the data source is ListViewDemos.products.dataSource and not just ListViewDemos.products. You need to associate the ListView with the dataSoure property. The ListView is associated with its item template with the help of the itemTemplate property. The ID of the item template — #productTemplate – is used to select the template from the page. Here’s what the complete version of the default.html page looks like: <!DOCTYPE html> <html> <head> <meta charset="utf-8"> <title>ListViewDemos</title> <!-- WinJS references --> <link href="//Microsoft.WinJS.0.6/css/ui-dark.css" rel="stylesheet"> <script src="//Microsoft.WinJS.0.6/js/base.js"></script> <script src="//Microsoft.WinJS.0.6/js/ui.js"></script> <!-- ListViewDemos references --> <link href="/css/default.css" rel="stylesheet"> <script src="/js/default.js"></script> <script src="/js/products.js" type="text/javascript"></script> <style type="text/css"> .product { width: 200px; height: 100px; border: white solid 1px; } </style> </head> <body> <div id="productTemplate" data-win-control="WinJS.Binding.Template"> <div class="product"> <span data-win-bind="innerText:name"></span> <span data-win-bind="innerText:price"></span> </div> </div> <div data-win-control="WinJS.UI.ListView" data-win-options="{ itemDataSource:ListViewDemos.products.dataSource, itemTemplate:select('#productTemplate') }"> </div> </body> </html> Notice that the page above includes a reference to the products.js file: <script src=”/js/products.js” type=”text/javascript”></script> The page above also contains a Template control which contains the ListView item template. Finally, the page includes the declaration of the ListView control. Summary The goal of this blog entry was to describe the minimal set of steps which you must complete to use the WinJS ListView control to display a simple list of items. You learned how to create a data source, declare an item template, and declare a ListView control.

    Read the article

  • Behind ASP.NET MVC Mock Objects

    - by imran_ku07
       Introduction:           I think this sentence now become very familiar to ASP.NET MVC developers that "ASP.NET MVC is designed with testability in mind". But what ASP.NET MVC team did for making applications build with ASP.NET MVC become easily testable? Understanding this is also very important because it gives you some help when designing custom classes. So in this article i will discuss some abstract classes provided by ASP.NET MVC team for the various ASP.NET intrinsic objects, including HttpContext, HttpRequest, and HttpResponse for making these objects as testable. I will also discuss that why it is hard and difficult to test ASP.NET Web Forms.      Description:           Starting from Classic ASP to ASP.NET MVC, ASP.NET Intrinsic objects is extensively used in all form of web application. They provide information about Request, Response, Server, Application and so on. But ASP.NET MVC uses these intrinsic objects in some abstract manner. The reason for this abstraction is to make your application testable. So let see the abstraction.           As we know that ASP.NET MVC uses the same runtime engine as ASP.NET Web Form uses, therefore the first receiver of the request after IIS and aspnet_filter.dll is aspnet_isapi.dll. This will start the application domain. With the application domain up and running, ASP.NET does some initialization and after some initialization it will call Application_Start if it is defined. Then the normal HTTP pipeline event handlers will be executed including both HTTP Modules and global.asax event handlers. One of the HTTP Module is registered by ASP.NET MVC is UrlRoutingModule. The purpose of this module is to match a route defined in global.asax. Every matched route must have IRouteHandler. In default case this is MvcRouteHandler which is responsible for determining the HTTP Handler which returns MvcHandler (which is derived from IHttpHandler). In simple words, Route has MvcRouteHandler which returns MvcHandler which is the IHttpHandler of current request. In between HTTP pipeline events the handler of ASP.NET MVC, MvcHandler.ProcessRequest will be executed and shown as given below,          void IHttpHandler.ProcessRequest(HttpContext context)          {                    this.ProcessRequest(context);          }          protected virtual void ProcessRequest(HttpContext context)          {                    // HttpContextWrapper inherits from HttpContextBase                    HttpContextBase ctxBase = new HttpContextWrapper(context);                    this.ProcessRequest(ctxBase);          }          protected internal virtual void ProcessRequest(HttpContextBase ctxBase)          {                    . . .          }             HttpContextBase is the base class. HttpContextWrapper inherits from HttpContextBase, which is the parent class that include information about a single HTTP request. This is what ASP.NET MVC team did, just wrap old instrinsic HttpContext into HttpContextWrapper object and provide opportunity for other framework to provide their own implementation of HttpContextBase. For example           public class MockHttpContext : HttpContextBase          {                    . . .          }                     As you can see, it is very easy to create your own HttpContext. That's what did the third party mock frameworks like TypeMock, Moq, RhinoMocks, or NMock2 to provide their own implementation of ASP.NET instrinsic objects classes.           The key point to note here is the types of ASP.NET instrinsic objects. In ASP.NET Web Form and ASP.NET MVC. For example in ASP.NET Web Form the type of Request object is HttpRequest (which is sealed) and in ASP.NET MVC the type of Request object is HttpRequestBase. This is one of the reason that makes test in ASP.NET WebForm is difficult. because their is no base class and the HttpRequest class is sealed, therefore it cannot act as a base class to others. On the other side ASP.NET MVC always uses a base class to give a chance to third parties and unit test frameworks to create thier own implementation ASP.NET instrinsic object.           Therefore we can say that in ASP.NET MVC, instrinsic objects are of type base classes (for example HttpContextBase) .Actually these base classes had it's own implementation of same interface as the intrinsic objects it abstracts. It includes only virtual members which simply throws an exception. ASP.NET MVC also provides the corresponding wrapper classes (for example, HttpRequestWrapper) which provides a concrete implementation of the base classes in the form of ASP.NET intrinsic object. Other wrapper classes may be defined by third parties in the form of a mock object for testing purpose.           So we can say that a Request object in ASP.NET MVC may be HttpRequestWrapper or may be MockRequestWrapper(assuming that MockRequestWrapper class is used for testing purpose). Here is list of ASP.NET instrinsic and their implementation in ASP.NET MVC in the form of base and wrapper classes. Base Class Wrapper Class ASP.NET Intrinsic Object Description HttpApplicationStateBase HttpApplicationStateWrapper Application HttpApplicationStateBase abstracts the intrinsic Application object HttpBrowserCapabilitiesBase HttpBrowserCapabilitiesWrapper HttpBrowserCapabilities HttpBrowserCapabilitiesBase abstracts the HttpBrowserCapabilities class HttpCachePolicyBase HttpCachePolicyWrapper HttpCachePolicy HttpCachePolicyBase abstracts the HttpCachePolicy class HttpContextBase HttpContextWrapper HttpContext HttpContextBase abstracts the intrinsic HttpContext object HttpFileCollectionBase HttpFileCollectionWrapper HttpFileCollection HttpFileCollectionBase abstracts the HttpFileCollection class HttpPostedFileBase HttpPostedFileWrapper HttpPostedFile HttpPostedFileBase abstracts the HttpPostedFile class HttpRequestBase HttpRequestWrapper Request HttpRequestBase abstracts the intrinsic Request object HttpResponseBase HttpResponseWrapper Response HttpResponseBase abstracts the intrinsic Response object HttpServerUtilityBase HttpServerUtilityWrapper Server HttpServerUtilityBase abstracts the intrinsic Server object HttpSessionStateBase HttpSessionStateWrapper Session HttpSessionStateBase abstracts the intrinsic Session object HttpStaticObjectsCollectionBase HttpStaticObjectsCollectionWrapper HttpStaticObjectsCollection HttpStaticObjectsCollectionBase abstracts the HttpStaticObjectsCollection class      Summary:           ASP.NET MVC provides a set of abstract classes for ASP.NET instrinsic objects in the form of base classes, allowing someone to create their own implementation. In addition, ASP.NET MVC also provide set of concrete classes in the form of wrapper classes. This design really makes application easier to test and even application may replace concrete implementation with thier own implementation, which makes ASP.NET MVC very flexable.

    Read the article

  • VS 2010 SP1 (Beta) and IIS Express

    - by ScottGu
    Last month we released the VS 2010 Service Pack 1 (SP1) Beta.  You can learn more about the VS 2010 SP1 Beta from Jason Zander’s two blog posts about it, and from Scott Hanselman’s blog post that covers some of the new capabilities enabled with it.  You can download and install the VS 2010 SP1 Beta here. IIS Express Earlier this summer I blogged about IIS Express.  IIS Express is a free version of IIS 7.5 that is optimized for developer scenarios.  We think it combines the ease of use of the ASP.NET Web Server (aka Cassini) currently built-into VS today with the full power of IIS.  Specifically: It’s lightweight and easy to install (less than 5Mb download and a quick install) It does not require an administrator account to run/debug applications from Visual Studio It enables a full web-server feature set – including SSL, URL Rewrite, and other IIS 7.x modules It supports and enables the same extensibility model and web.config file settings that IIS 7.x support It can be installed side-by-side with the full IIS web server as well as the ASP.NET Development Server (they do not conflict at all) It works on Windows XP and higher operating systems – giving you a full IIS 7.x developer feature-set on all Windows OS platforms IIS Express (like the ASP.NET Development Server) can be quickly launched to run a site from a directory on disk.  It does not require any registration/configuration steps. This makes it really easy to launch and run for development scenarios. Visual Studio 2010 SP1 adds support for IIS Express – and you can start to take advantage of this starting with last month’s VS 2010 SP1 Beta release. Downloading and Installing IIS Express IIS Express isn’t included as part of the VS 2010 SP1 Beta.  Instead it is a separate ~4MB download which you can download and install using this link (it uses WebPI to install it).  Once IIS Express is installed, VS 2010 SP1 will enable some additional IIS Express commands and dialog options that allow you to easily use it. Enabling IIS Express for Existing Projects Visual Studio today defaults to using the built-in ASP.NET Development Server (aka Cassini) when running ASP.NET Projects: Converting your existing projects to use IIS Express is really easy.  You can do this by opening up the project properties dialog of an existing project, and then by clicking the “web” tab within it and selecting the “Use IIS Express” checkbox. Or even simpler, just right-click on your existing project, and select the “Use IIS Express…” menu command: And now when you run or debug your project you’ll see that IIS Express now starts up and runs automatically as your web-server: You can optionally right-click on the IIS Express icon within your system tray to see/browse all of sites and applications running on it: Note that if you ever want to revert back to using the ASP.NET Development Server you can do this by right-clicking the project again and then select the “Use Visual Studio Development Server” option (or go into the project properties, click the web tab, and uncheck IIS Express).  This will revert back to the ASP.NET Development Server the next time you run the project. IIS Express Properties Visual Studio 2010 SP1 exposes several new IIS Express configuration options that you couldn’t previously set with the ASP.NET Development Server.  Some of these are exposed via the property grid of your project (select the project node in the solution explorer and then change them via the property window): For example, enabling something like SSL support (which is not possible with the ASP.NET Development Server) can now be done simply by changing the “SSL Enabled” property to “True”: Once this is done IIS Express will expose both an HTTP and HTTPS endpoint for the project that we can use: SSL Self Signed Certs IIS Express ships with a self-signed SSL cert that it installs as part of setup – which removes the need for you to install your own certificate to use SSL during development.  Once you change the above drop-down to enable SSL, you’ll be able to browse to your site with the appropriate https:// URL prefix and it will connect via SSL. One caveat with self-signed certificates, though, is that browsers (like IE) will go out of their way to warn you that they aren’t to be trusted: You can mark the certificate as trusted to avoid seeing dialogs like this – or just keep the certificate un-trusted and press the “continue” button when the browser warns you not to trust your local web server. Additional IIS Settings IIS Express uses its own per-user ApplicationHost.config file to configure default server behavior.  Because it is per-user, it can be configured by developers who do not have admin credentials – unlike the full IIS.  You can customize all IIS features and settings via it if you want ultimate server customization (for example: to use your own certificates for SSL instead of self-signed ones). We recommend storing all app specific settings for IIS and ASP.NET within the web.config file which is part of your project – since that makes deploying apps easier (since the settings can be copied with the application content).  IIS (since IIS 7) no longer uses the metabase, and instead uses the same web.config configuration files that ASP.NET has always supported – which makes xcopy/ftp based deployment much easier. Making IIS Express your Default Web Server Above we looked at how we can convert existing sites that use the ASP.NET Developer Web Server to instead use IIS Express.  You can configure Visual Studio to use IIS Express as the default web server for all new projects by clicking the Tools->Options menu  command and opening up the Projects and Solutions->Web Projects node with the Options dialog: Clicking the “Use IIS Express for new file-based web site and projects” checkbox will cause Visual Studio to use it for all new web site and projects. Summary We think IIS Express makes it even easier to build, run and test web applications.  It works with all versions of ASP.NET and supports all ASP.NET application types (including obviously both ASP.NET Web Forms and ASP.NET MVC applications).  Because IIS Express is based on the IIS 7.5 codebase, you have a full web-server feature-set that you can use.  This means you can build and run your applications just like they’ll work on a real production web-server.  In addition to supporting ASP.NET, IIS Express also supports Classic ASP and other file-types and extensions supported by IIS – which also makes it ideal for sites that combine a variety of different technologies. Best of all – you do not need to change any code to take advantage of it.  As you can see above, updating existing Visual Studio web projects to use it is trivial.  You can begin to take advantage of IIS Express today using the VS 2010 SP1 Beta. Hope this helps, Scott

    Read the article

< Previous Page | 147 148 149 150 151 152 153 154 155 156 157 158  | Next Page >