Search Results

Search found 7586 results on 304 pages for 'header only'.

Page 153/304 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • when rendering the page on different browsers layout changes

    - by user1776590
    I have create a website using asp.net and when I render the the website on firefox and IE the website look the same and when rendering it on Chrome it move the button lower and changes the location of it this is my master page code <%@ Master Language="C#" AutoEventWireup="true" CodeBehind="UMSite.master.cs" Inherits="WebApplication4.UMSiteMaster" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"> <head runat="server"> <title></title> <link href="~/Styles/UM.css" rel="stylesheet" type="text/css" /> <asp:ContentPlaceHolder ID="HeadContent" runat="server"> </asp:ContentPlaceHolder> </head> <body> <form id="Form1" runat="server"> <div class="page"> <div class="header"> <div class="title"> <h1><img alt="" src="Styles/UMHeader.png" width= "950" height= "65" /></h1> <div class="clear hideSkiplink"> <asp:Menu ID="NavigationMenu" runat="server" CssClass="menu" EnableViewState="false" IncludeStyleBlock="false" Orientation="Horizontal"> <Items> <asp:MenuItem NavigateUrl="~/Home.aspx" Text="Home"/> </Items> </asp:Menu> </div> </div> </div></h1> <div class="main" runat="server"> <asp:ContentPlaceHolder ID="MainContent" runat="server"/> </div> </form> </body> </html> the below is the css /* DEFAULTS ----------------------------------------------------------*/ body { background: #b6b7bc; font-size: .80em; font-family: "Helvetica Neue", "Lucida Grande", "Segoe UI", Arial, Helvetica, Verdana, sans-serif; margin: 0px; padding: 0px; color: #696969; height: 192px; } a:link, a:visited { color: #034af3; } a:hover { color: #1d60ff; text-decoration: none; } a:active { color: #034af3; } p { margin-bottom: 10px; line-height: 1.6em; } /* HEADINGS ----------------------------------------------------------*/ h1, h2, h3, h4, h5, h6 { font-size: 1.5em; color: #666666; font-variant: small-caps; text-transform: none; font-weight: 200; margin-bottom: 0px; } h1 { font-size: 1.6em; padding-bottom: 0px; margin-bottom: 0px; } h2 { font-size: 1.5em; font-weight: 600; } h3 { font-size: 1.2em; } h4 { font-size: 1.1em; } h5, h6 { font-size: 1em; } /* this rule styles <h1> and <h2> tags that are the first child of the left and right table columns */ .rightColumn > h1, .rightColumn > h2, .leftColumn > h1, .leftColumn > h2 { margin-top: 0px; } /* PRIMARY LAYOUT ELEMENTS ----------------------------------------------------------*/ .page { width: 950px; height:auto; background-color: #fff; margin: 10px auto 5px auto; border: 1px solid #496077; } .header { position:relative; margin: 0px; padding: 0px; background: #E30613; width: 100%; top: 0px; left: 0px; height: 90px; } .header h1 { font-weight: 700; margin: 0px; padding: 0px 0px 0px 0px; color: #E30613; border: none; line-height: 2em; font-size: 2em; } .main { padding: 0px 12px; margin: 0px 0px 0px 0px; min-height: 630px; width:auto; background-image:url('UMBackground.png'); } .leftCol { padding: 6px 0px; margin: 0px 0px 0px 0px; width: 200px; min-height: 200px; width:auto; } .footer { color: #4e5766; padding: 0px 0px 0px 0px; margin: 0px auto; text-align: center; line-height: normal; } /* TAB MENU ----------------------------------------------------------*/ div.hideSkiplink { background-color:#E30613; width: 950px; height: 35px; margin-top: 0px; } div.menu { padding: 1px 0px 1px 2px; } div.menu ul { list-style: none; margin: 0px; padding: 5px; width: auto; } div.menu ul li a, div.menu ul li a:visited { background-color: #E30613; border: 1.25px #00BFFF solid; color: #F5FFFA; display:inline; line-height: 1.35em; padding: 10px 30px; text-decoration: none; white-space: nowrap; } div.menu ul li a:hover { background-color: #000000; color: #F5FFFA; text-decoration: none; } div.menu ul li a:active { background-color: #E30613; color: #cfdbe6; text-decoration: none; } /* FORM ELEMENTS ----------------------------------------------------------*/ fieldset { margin: 1em 0px; padding: 1em; border: 1px solid #ccc; } fieldset p { margin: 2px 12px 10px 10px; } fieldset.login label, fieldset.register label, fieldset.changePassword label { display: block; } fieldset label.inline { display: inline; } legend { font-size: 1.1em; font-weight: 600; padding: 2px 4px 8px 4px; } input.textEntry { width: 320px; border: 1px solid #ccc; } input.passwordEntry { width: 320px; border: 1px solid #ccc; } div.accountInfo { width: 42%; } /* MISC ----------------------------------------------------------*/ .clear { clear: both; } .title { display: block; float: left; text-align: left; width: 947px; height: 132px; } .loginDisplay { font-size: 1.1em; display: block; text-align: right; padding: 10px; color: White; } .loginDisplay a:link { color: white; } .loginDisplay a:visited { color: white; } .loginDisplay a:hover { color: white; } .failureNotification { font-size: 1.2em; color: Red; } .bold { font-weight: bold; } .submitButton { text-align: right; padding-right: 10px; }

    Read the article

  • node.js and jsdom - no way to detect that an http 500 error was returned?

    - by Nathan Ridley
    I'm using jsdom with node.js and I'm trying to get it to provide me with some indication that an http error has occurred. I've set up a test server that simply returns an http 500 header for all requests, but when I attempt to load it with jsdom, jsdom doesn't throw any error and doesn't seem to provide me with any information that would identify that an http 500 error was returned. What's the best way to detect an http 500 error?

    Read the article

  • Call the function

    - by riteshkumar1905
    How to call the function in Objective-c. for Example:- I define the function in header (.h file):- -(void)abc and implement this function in implementation file( .m file):- -(void)abc { //..... ///.... } now how would i call this function on that place where i need it..?????

    Read the article

  • Using libssl in xCode

    - by kanedo
    Hello, I have tried to include openssl (I try to implement a ssh client) and I've added libssl.dylib to my XCode Project. But I don't know which header I have to include to use it. Can anyone show me a tutorial how to use libssl in xcode? thanks

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • Apache serving wrong Content-Type for Rails files

    - by NudeCanalTroll
    Apache keeps serving up my Rails files with a Content-Type of 'text/plain' in the header. I have mod_mime installed, a mime.types files with all the correct MIME assignments, and the following code in my configuration. Any thoughts? DefaultType text/plain <IfModule mime_module> TypesConfig /etc/apache2/mime.types AddType application/x-compress .Z AddType application/x-gzip .gz .tgz </IfModule>

    Read the article

  • Drupal: using lightbox to display complete nodes beside Views ?

    - by Patrick
    hi, I've a View page with all the content of my website (the node headers). When I click on one of these header I would like to load the complete node without refreshing the page and display it on the left. Which modules could I use for it ? I'm currently using a lightbox (moving the content beside it). I was wondering if this the only solution and if it is a good one thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • How to enable MALLOC_PROTECT_BEFORE in Xcode?

    - by Daniel S.
    After switching on some debug options in Xcode, it now tells me the following in the output: GuardMalloc[Roadcast-4010]: free: magic is 0x0000090b, not 0xdeadbeef. GuardMalloc[Roadcast-4010]: free: header magic value at 0x43f49bf0, for block 0x43f49c00-0x43f50000, has been trashed by a buffer underrun. GuardMalloc[Roadcast-4010]: Try running with MALLOC_PROTECT_BEFORE to catch this error immediately as it happens. How do I switch on MALLOC_PROTECT_BEFORE?

    Read the article

  • JSON object array to store data of a form in local storage temporary (PhoneGap project)

    - by Nadeesha
    I am building a data aqusition system using PhoneGap. .I am trying to store my form data temporary on local storage using JSON,Data should be visible after I close and reopen the application (after pressing Get Data button),But after I close it only the lastly entered record is visible This is my code <!DOCTYPE html> <html> <head> <title>Household Profile DB storage</title> <meta charset="utf-8"> <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1,width=device-width" /> <link rel="stylesheet" href="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.css"> <link rel="stylesheet" href="css/table.css"> <script type="text/javascript" src="js/jquery-1.9.1.min.js"></script> <script type="text/javascript" src="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.js"></script> <script type="text/javascript" src="js/iscroll.js"></script> <script type="text/javascript" charset="utf-8"> function onDeviceReady() { persistData(homeId,owner,gramaND,contactNo,address,race); } function saveLocal(form){ if (window.localStorage) { var fhomeId = form.homeId.value, fowner = form.owner.value, fgramaND = form.gramaND.value, fcontactNo= form.contactNo.value, faddress = form.address.value, frace = form.race.value; alert("hi"); var highscores = [{"homeId": fhomeId, "owner":fowner, "gramaND":fgramaND, "contactNo":fcontactNo, "address":faddress, "race":frace}]; localStorage.setItem("highscores",JSON.stringify(highscores)); alert("The data has been stored successfully."); } else { alert("Your Browser does not support LocalStorage."); } } function readLocal(){ if (window.localStorage) { var scores =[]; //Get the highscores object scores = localStorage.getItem("highscores"); scores = JSON.parse(scores); for (i=0;i<scores.length;i++){ var text = "homeId :"+scores[i].homeId +"<br>"+ "owner:"+ scores[i].owner+"<br>"+ "address"+scores[i].address +"<br>"+ "gramaND"+scores[i].gramaND +"<br>"+ "contactNo"+scores[i].contactNo+"<br>" + '<Button value="DELETE" onclick="'+scores.splice(i, 0)+'><>/Button>'; var tbodyx = document.getElementsByTagName("tbody"); var tr=document.createElement("TR"); var td=document.createElement("TD"); td.innerHTML = text; tr.appendChild(td); tbody.appendChild(tr); } } } </script> </head> <body> <div data-role="page" id="page1"> <!--/header--> <div data-role="header" data-position="inline" data-theme="b"> <a href="#" data-icon="back" data-rel="back" title="Go back">Back</a> <h1>Household Profile</h1> <a href="index.html" data-icon="home">Menu</a> </div> <!--/header--> <div id="wrapper"> <form id="userInput" action ="" method="GET"> <div data-role="content"> <div data-role="fieldcontain"> <label > Home ID </label> <input class="inputClass" id="homeId" placeholder="H0001" value="" data-mini="true" type="text"> </div> <div data-role="fieldcontain"> <label > Owner </label> <input class="inputClass" id="owner" placeholder="Aberathne" value="" type="text"> </div> <div data-role="fieldcontain"> <label class="select">GramaNiladhari Division</label> <select class="inputClass" id="gramaND"> <option value="GramaNiladhari Division 1">GramaNiladhari Division 1</option> <option value="GramaNiladhari Division 2">GramaNiladhari Division 2</option> <option value="GramaNiladhari Division 3">GramaNiladhari Division 3</option> <option value="GramaNiladhari Division 4">GramaNiladhari Division 4</option> </select> </div> <div data-role="fieldcontain"> <label > Contact No </label> <input class="inputClass" id="contactNo" placeholder="071-9545-073" value="" type="number"> </div> <div data-role="fieldcontain"> <label >Address:</label> <textarea cols="40" rows="8" class="inputClass" id="address"></textarea> </div> <div class="ui-block-a"><button type="submit" data-theme="d">Location in a Map</button></div> <div data-role="fieldcontain"> <label >Race</label> <select class="inputClass" id="race"> <option value=" Sinhalese"> Sinhalese</option> <option value=" Sri Lanka Tamils"> Sri Lanka Tamils</option> <option value=" Moors"> Moors</option> <option value=" Indian Tamils "> Indian Tamils </option> <option value=" Malays "> Malays </option> <option value=" Burghers "> Burghers </option> </select> </div> <input class="buttonClass" type="button" value="Insert Data" onclick="saveLocal(this.form);"> </div> </form> </div> <input class="buttonClass" type="button" value="get Data" onclick="readLocal();"> <!-- <p id="dhomeId"></p> <p id="downer"></p> <p id="dgramaND"></p> <p id="dcontactNo"></p> <p id="daddress"></p> <p id="drace"></p>--> <table border="1"> <tbody id="tbody"> <tr><td>test1</td></tr> <tr><td>test2</td></tr> </tbody> </table> </div> </body> </html> Also I need to expand my code to edit and delete record from local storage.

    Read the article

  • accessing Ruby variable(from model or controller) in SASS

    - by corroded
    Is there a way to access ruby variables in sass or do i have to make a custom function for it? What im trying to do is to generate a stylesheet for each user so in the controller, i do something like: def show respond_to do |format| format.css{render :partial => "styles"} end end then in the view name _styles.haml i do this: :sass #header :background url(user.banner.url) is this possible at all?

    Read the article

  • How to send raw XML in Python?

    - by davywahd
    Hi, I am trying to send raw xml to a service in Python. I have a the address of the service and my question is how would I wrap XML in python and send it to the service. The address is in the format below. 192.1100.2.2:54239 And say the XML is: <xml version="1.0" encoding="UTF-8"><header/><body><code><body/> Anyone know what to do?

    Read the article

  • How do I show the 'blog last updated' time in Wordpress?

    - by detj
    I want to show the time of the last blog update at the header of my wordpress blog. It's not the last update time of a post but rather any post or page (i.e. any last update done in the blog) e.g. Format: Tuesday, March 16, 2010 Last Update: 6:09 PM ET Is there any template tag to accomplish this?

    Read the article

  • Are protocols inheritable in Objective-C?

    - by aquaibm
    I saw this in some header file in the framework directory: @interface NSCharacterSet : NSObject <NSCopying, NSMutableCopying, NSCoding> @end @interface NSMutableCharacterSet : NSCharacterSet <NSCopying, NSMutableCopying> @end I thought protocols were inheritable.If I am right about that,There is no need to type <NSCopying, NSMutableCopying> again after "NSMutableCharacterSet : NSCharacterSet".And NSMutableCharacterSet also conforms to NSCoding protocol, right? Than why is Apple typing that again?Am I making mistake?

    Read the article

  • Linking CSS Navbar WIth Wordpress Pages

    - by JCHASE11
    I am using wordpress as a full on CMS on a site I am building. One thing I cant seem to figure out is how to link up my navigation bar to the pages I am creating in wordpress. I am using a sprite image hover navbar that is defined in the header.php file. Does anyone have any idea how I can take a typical CSS sprite navbar and link it up with the pages I am creating within wordpress?

    Read the article

  • How to poll the popular websites in PHP?

    - by Runner
    It's springed from this answer: http://superuser.com/questions/129741/how-does-search-engines-update-indexing-so-soon/129743#129743 BTW,for the servers that's polled,is it the same whether the request is just for polling(header information) or complete web page?

    Read the article

  • C++ snippet support in visual studio?

    - by Jeremy Bell
    I'm writing code in native C++ (not C++/CLR). I know that there is no built-in support for C++ with regards to the snippet manager and snipper picker interfaces, however I found a utility called "snippy" which supposedly can generate C++ snippets. Here is a c++ snippet that the program generated: <?xml version="1.0" encoding="utf-8"?> <CodeSnippets xmlns="http://schemas.microsoft.com/VisualStudio/2005/CodeSnippet"> <CodeSnippet Format="1.0.0"> <Header> <Title>MySnippet</Title> <Shortcut>MySnippet</Shortcut> <Description>Just a test snippet</Description> <Author>Me</Author> <SnippetTypes> <SnippetType>Expansion</SnippetType> </SnippetTypes> </Header> <Snippet> <Declarations> <Literal Editable="true"> <ID>literal1</ID> <ToolTip>just a placeholder</ToolTip> <Default> </Default> <Function> </Function> </Literal> </Declarations> <Code Language="cpp"><![CDATA[cout << "$literal1$" << std::endl;]]></Code> </Snippet> </CodeSnippet> </CodeSnippets> If there is support in visual C++, even in a limited capacity, for C++ snippets, how do I add them to my environment, and what are the limitations? All I need is support for basic expansion snippets that I can invoke by typing a shortcut and hitting tab, and which supports basic literals that I can tab through (basically, if it supports the above snippet, I'm good). If this can't be done, are there any free add-ons or extensions to visual studio that support snippets for C++? I'm using both visual studio 2010 and 2008, but I mostly write code in 2010 right now.

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >