Search Results

Search found 7586 results on 304 pages for 'header only'.

Page 153/304 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • Nginx: check content-length before file upload takes place

    - by robw
    I'm trying to prevent users from uploading (accidentally or maliciously) very large files to my website. I have nginx max_client_body_size set to 4M, but if a file larger than this is uploaded, then it uploads the entire file before returning 413 (entity too large). I want to make nginx check the Content-Length header, so that it rejects the request before it's uploaded. Alternatively, a Rails solution would also be acceptable. Any help appreciated.

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • Call the function

    - by riteshkumar1905
    How to call the function in Objective-c. for Example:- I define the function in header (.h file):- -(void)abc and implement this function in implementation file( .m file):- -(void)abc { //..... ///.... } now how would i call this function on that place where i need it..?????

    Read the article

  • node.js and jsdom - no way to detect that an http 500 error was returned?

    - by Nathan Ridley
    I'm using jsdom with node.js and I'm trying to get it to provide me with some indication that an http error has occurred. I've set up a test server that simply returns an http 500 header for all requests, but when I attempt to load it with jsdom, jsdom doesn't throw any error and doesn't seem to provide me with any information that would identify that an http 500 error was returned. What's the best way to detect an http 500 error?

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • Can't install a ruby gem because of an error?

    - by Alex
    Hey there, trying to install a ruby gem but I keep getting the following error: ERROR:failed to build gem native extension /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/bin/ruby extconf.rb mkmf.rb can't find header files for ruby at/System/ Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/ruby.h I'm not exactly sure what is happening here. Is there anyone that knows what is going on and how to fix it? Thanks!

    Read the article

  • Drupal: using lightbox to display complete nodes beside Views ?

    - by Patrick
    hi, I've a View page with all the content of my website (the node headers). When I click on one of these header I would like to load the complete node without refreshing the page and display it on the left. Which modules could I use for it ? I'm currently using a lightbox (moving the content beside it). I was wondering if this the only solution and if it is a good one thanks

    Read the article

  • Using libssl in xCode

    - by kanedo
    Hello, I have tried to include openssl (I try to implement a ssh client) and I've added libssl.dylib to my XCode Project. But I don't know which header I have to include to use it. Can anyone show me a tutorial how to use libssl in xcode? thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Apache serving wrong Content-Type for Rails files

    - by NudeCanalTroll
    Apache keeps serving up my Rails files with a Content-Type of 'text/plain' in the header. I have mod_mime installed, a mime.types files with all the correct MIME assignments, and the following code in my configuration. Any thoughts? DefaultType text/plain <IfModule mime_module> TypesConfig /etc/apache2/mime.types AddType application/x-compress .Z AddType application/x-gzip .gz .tgz </IfModule>

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • How to enable MALLOC_PROTECT_BEFORE in Xcode?

    - by Daniel S.
    After switching on some debug options in Xcode, it now tells me the following in the output: GuardMalloc[Roadcast-4010]: free: magic is 0x0000090b, not 0xdeadbeef. GuardMalloc[Roadcast-4010]: free: header magic value at 0x43f49bf0, for block 0x43f49c00-0x43f50000, has been trashed by a buffer underrun. GuardMalloc[Roadcast-4010]: Try running with MALLOC_PROTECT_BEFORE to catch this error immediately as it happens. How do I switch on MALLOC_PROTECT_BEFORE?

    Read the article

  • JSON object array to store data of a form in local storage temporary (PhoneGap project)

    - by Nadeesha
    I am building a data aqusition system using PhoneGap. .I am trying to store my form data temporary on local storage using JSON,Data should be visible after I close and reopen the application (after pressing Get Data button),But after I close it only the lastly entered record is visible This is my code <!DOCTYPE html> <html> <head> <title>Household Profile DB storage</title> <meta charset="utf-8"> <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1,width=device-width" /> <link rel="stylesheet" href="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.css"> <link rel="stylesheet" href="css/table.css"> <script type="text/javascript" src="js/jquery-1.9.1.min.js"></script> <script type="text/javascript" src="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.js"></script> <script type="text/javascript" src="js/iscroll.js"></script> <script type="text/javascript" charset="utf-8"> function onDeviceReady() { persistData(homeId,owner,gramaND,contactNo,address,race); } function saveLocal(form){ if (window.localStorage) { var fhomeId = form.homeId.value, fowner = form.owner.value, fgramaND = form.gramaND.value, fcontactNo= form.contactNo.value, faddress = form.address.value, frace = form.race.value; alert("hi"); var highscores = [{"homeId": fhomeId, "owner":fowner, "gramaND":fgramaND, "contactNo":fcontactNo, "address":faddress, "race":frace}]; localStorage.setItem("highscores",JSON.stringify(highscores)); alert("The data has been stored successfully."); } else { alert("Your Browser does not support LocalStorage."); } } function readLocal(){ if (window.localStorage) { var scores =[]; //Get the highscores object scores = localStorage.getItem("highscores"); scores = JSON.parse(scores); for (i=0;i<scores.length;i++){ var text = "homeId :"+scores[i].homeId +"<br>"+ "owner:"+ scores[i].owner+"<br>"+ "address"+scores[i].address +"<br>"+ "gramaND"+scores[i].gramaND +"<br>"+ "contactNo"+scores[i].contactNo+"<br>" + '<Button value="DELETE" onclick="'+scores.splice(i, 0)+'><>/Button>'; var tbodyx = document.getElementsByTagName("tbody"); var tr=document.createElement("TR"); var td=document.createElement("TD"); td.innerHTML = text; tr.appendChild(td); tbody.appendChild(tr); } } } </script> </head> <body> <div data-role="page" id="page1"> <!--/header--> <div data-role="header" data-position="inline" data-theme="b"> <a href="#" data-icon="back" data-rel="back" title="Go back">Back</a> <h1>Household Profile</h1> <a href="index.html" data-icon="home">Menu</a> </div> <!--/header--> <div id="wrapper"> <form id="userInput" action ="" method="GET"> <div data-role="content"> <div data-role="fieldcontain"> <label > Home ID </label> <input class="inputClass" id="homeId" placeholder="H0001" value="" data-mini="true" type="text"> </div> <div data-role="fieldcontain"> <label > Owner </label> <input class="inputClass" id="owner" placeholder="Aberathne" value="" type="text"> </div> <div data-role="fieldcontain"> <label class="select">GramaNiladhari Division</label> <select class="inputClass" id="gramaND"> <option value="GramaNiladhari Division 1">GramaNiladhari Division 1</option> <option value="GramaNiladhari Division 2">GramaNiladhari Division 2</option> <option value="GramaNiladhari Division 3">GramaNiladhari Division 3</option> <option value="GramaNiladhari Division 4">GramaNiladhari Division 4</option> </select> </div> <div data-role="fieldcontain"> <label > Contact No </label> <input class="inputClass" id="contactNo" placeholder="071-9545-073" value="" type="number"> </div> <div data-role="fieldcontain"> <label >Address:</label> <textarea cols="40" rows="8" class="inputClass" id="address"></textarea> </div> <div class="ui-block-a"><button type="submit" data-theme="d">Location in a Map</button></div> <div data-role="fieldcontain"> <label >Race</label> <select class="inputClass" id="race"> <option value=" Sinhalese"> Sinhalese</option> <option value=" Sri Lanka Tamils"> Sri Lanka Tamils</option> <option value=" Moors"> Moors</option> <option value=" Indian Tamils "> Indian Tamils </option> <option value=" Malays "> Malays </option> <option value=" Burghers "> Burghers </option> </select> </div> <input class="buttonClass" type="button" value="Insert Data" onclick="saveLocal(this.form);"> </div> </form> </div> <input class="buttonClass" type="button" value="get Data" onclick="readLocal();"> <!-- <p id="dhomeId"></p> <p id="downer"></p> <p id="dgramaND"></p> <p id="dcontactNo"></p> <p id="daddress"></p> <p id="drace"></p>--> <table border="1"> <tbody id="tbody"> <tr><td>test1</td></tr> <tr><td>test2</td></tr> </tbody> </table> </div> </body> </html> Also I need to expand my code to edit and delete record from local storage.

    Read the article

  • How do I show the 'blog last updated' time in Wordpress?

    - by detj
    I want to show the time of the last blog update at the header of my wordpress blog. It's not the last update time of a post but rather any post or page (i.e. any last update done in the blog) e.g. Format: Tuesday, March 16, 2010 Last Update: 6:09 PM ET Is there any template tag to accomplish this?

    Read the article

  • Deleting Multiple rows from a TableView

    - by Sid
    hi Frnz, i want to delete multiple rows from a table view based on users selection.obviously i cant use didSelectRowAtIndexPath method coz it will be called for every row selected. i want to allow user to select multiple rows for deletion and then delete them in one go...Is it possible if yes then how to go about it.Also i am using a single view based project and i want the header of table view changed to "Delete" on the same view when the user want to delete the rows from the view. Thx

    Read the article

  • Compiling Enet in iphone xcode project

    - by EToreo
    Hello, I am trying to compile the Enet source code into my code framework for iPhone games. After modifying the header files I get it compiling and linking, but I absolutely must be compiling with the "Compile Source As" set to "Objective-C++" in my xcode project (because the framework code requires this). When I flip this switch in my test project, I get these errors: Undefined symbols: "_enet_list_clear", referenced from: _enet_host_connect in host.o ... Can anyone help get this linking with "Compile Source As" set to "Objective-C++"?

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >