Search Results

Search found 15187 results on 608 pages for 'boost python'.

Page 154/608 | < Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >

  • feedparser fails during script run, but can't reproduce in interactive python console

    - by Rhubarb
    It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • How to Extract data asocaited with attribute of XML file using python 3.2

    - by user1460383
    I have this xml format..... <event timestamp="0.447463" bustype="LIN" channel="LIN 1"> <col name="Time"/> <col name="Start of Frame">0.440708</col> <col name="Channel">LIN 1</col> <col name="Dir">Tx</col> <col name="Event Type">LIN Frame (Diagnostic Request)</col> <col name="Frame Name">MasterReq_DB</col> <col name="Id">3C</col> <col name="Data">81 06 04 04 FF FF 50 4C</col> <col name="Publisher">TestMaster (simulated)</col> <col name="Checksum">D3 &quot;Classic&quot;</col> <col name="Header Duration">2.090 ms (40.1 bits)</col> <col name="Resp. Duration">4.688 ms (90.0 bits)</col> <col name="Time difference">0.049987</col> <empty/> </event> In above xml, i need to extract data associated with attribute 'name' Am able to get all names but am unable to fetch MasterReq_DB< field Please help me ... Thanks in advance

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Working with bytes and binary data in Python

    - by ignoramus
    Four consecutive bytes in a byte string together specify some value. However, only 7 bits in each byte are used; the most significant bit is ignored (that makes 28 bits altogether). So... b"\x00\x00\x02\x01" would be 000 0000 000 0000 000 0010 000 0001. Or, for the sake of legibility, 10 000 0001. That's the value the four bytes represent. But I want a decimal, so I do this: >>> 0b100000001 257 I can work all that out myself, but how would I incorporate it into a program?

    Read the article

  • Errno socket error in python

    - by Emma
    i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

    Read the article

  • python parsing file json

    - by michele
    File json: {"maps":[{"id":"blabla","iscategorical":"0"},{"id":"blabla","iscategorical":"0"}], "masks":["id":"valore"], "om_points":"value", "parameters":["id":"valore"] } I write this script but it only print all the text. json_data=open(file_directory).read() data = json.loads(json_data) pprint(data) How can I parse the file and extract single values? Thanks in advance.

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

  • python search replace using wildcards

    - by tom smith
    hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • mouse rollover event in Python (VPython)

    - by kame
    Is there something similar to scene.mouse.getclick in the visual module (VPython)? I need it for a rollover. Thanks in advance. EDIT: I need a function for doing something when the mouse moves inside a special area without clicking.

    Read the article

  • Python: unable to inherit from a C extension.

    - by celil
    I am trying to add a few extra methods to a matrix type from the pysparse library. Apart from that I want the new class to behave exactly like the original, so I chose to implement the changes using inheritance. However, when I try from pysparse import spmatrix class ll_mat(spmatrix.ll_mat): pass this results in the following error TypeError: Error when calling the metaclass bases cannot create 'builtin_function_or_method' instances What is this causing this error? Is there a way to use delegation so that my new class behaves exactly the same way as the original?

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • how to send file via http with python

    - by ep45
    Hello, I have a problem. I use Apache with mod_wsgi and webpy, and when i send a file on http, a lot packets are lost. This is my code : web.header('Content-Type','video/x-flv') web.header('Content-length',sizeFile) f = file(FILE_PATH, 'rb') while True: buffer = f.read(4*1024) if buffer : yield buffer else : break f.close() What in my code is wrong ? thanks.

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • python raw_input odd behavior with accents containing strings

    - by Ryan
    I'm writing a program that asks the user for input that contains accents. The user input string is tested to see if it matches a string declared in the program. As you can see below, my code is not working: code # -*- coding: utf-8 -*- testList = ['má'] myInput = raw_input('enter something here: ') print myInput, repr(myInput) print testList[0], repr(testList[0]) print myInput in testList output in eclipse with pydev enter something here: má mv° 'm\xe2\x88\x9a\xc2\xb0' má 'm\xc3\xa1' False output in IDLE enter something here: má má u'm\xe1' má 'm\xc3\xa1' Warning (from warnings module): File "/Users/ryanculkin/Desktop/delete.py", line 8 print myInput in testList UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal False How can I get my code to print True when comparing the two strings? Additionally, I note that the result of running this code on the same input is different depending on whether I use eclipse or IDLE. Why is this? My eventual goal is to put my program on the web; is there anything that I need to be aware of, since the result seems to be so volatile?

    Read the article

  • use doctest and logging in python program

    - by Luke
    #!/usr/bin/python2.4 import logging import sys import doctest def foo(x): """ foo (0) 0 """ print ("%d" %(x)) _logger.debug("%d" %(x)) def _test(): doctest.testmod() _logger = logging.getLogger() _logger.setLevel(logging.DEBUG) _formatter = logging.Formatter('%(message)s') _handler = logging.StreamHandler(sys.stdout) _handler.setFormatter(_formatter) _logger.addHandler(_handler) _test() I would like to use logger module for all of my print statements. I have looked at the first 50 top google links for this, and they seem to agree that doctest uses it's own copy of the stdout. If print is used it works if logger is used it logs to the root console. Can someone please demonstrate a working example with a code snippet that will allow me to combine. Note running nose to test doctest will just append the log output at the end of the test, (assuming you set the switches) it does not treat them as a print statement.

    Read the article

  • Python: how to enclose strings in a list with < and >

    - by Michael Konietzny
    Hello, i would like to enclose strings inside of list into < (formatted like <%s). The current code does the following: def create_worker (general_logger, general_config): arguments = ["worker_name", "worker_module", "worker_class"] __check_arguments(arguments) def __check_arguments(arguments): if len(sys.argv) < 2 + len(arguments): print "Usage: %s delete-project %s" % (__file__," ".join(arguments)) sys.exit(10) The current output looks like this: Usage: ...\handler_scripts.py delete-project worker_name worker_module worker_class and should look like this: Usage: ...\handler_scripts.py delete-project <worker_name> <worker_module> <worker_class> Is there any short way to do this ? Greetings, Michael

    Read the article

  • python: using __import__ to import a module which in turn generates an ImportError

    - by bbb
    Hi there, I have a funny problem I'd like to ask you guys ('n gals) about. I'm importing some module A that is importing some non-existent module B. Of course this will result in an ImportError. This is what A.py looks like import B Now let's import A >>> import A Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/tmp/importtest/A.py", line 1, in <module> import B ImportError: No module named B Alright, on to the problem. How can I know if this ImportError results from importing A or from some corrupt import inside A without looking at the error's string representation. The difference is that either A is not there or does have incorrect import statements. Hope you can help me out... Cheers bb

    Read the article

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

< Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >