Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 155/336 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • Prolog - generate correct bracketing

    - by Henrik Bak
    I'd like to get some help in the following exam problem, i have no idea how to do this: Input: a list of numbers, eg.: [1,2,3,4] Output: every possible correct bracketing. Eg.: (in case of input [1,2,3,4]): ((1 2) (3 4)) ((1 (2 3)) 4) (1 ((2 3) 4)) (1 (2 (3 4))) (((1 2) 3) 4) Bracketing here is like a method with two arguments, for example multiplication - then the output is the possible multiplication orders. Please help, i'm stuck with this one. Any help is appreciated, thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Start a git commit message with a hashmark (#)

    - by knittl
    Git treats lines starting with # as comment lines when committing. this is very annoying when working with a ticket tracking system, and trying to write the ticket number at the beginning of the line, e.g. #123 salt hashed passwords git will simply remove the line from the commit message. is there any way to escape the hash? i tried \ and !, but nothing works. whitespaces before # are preserved, so they aren't a working solution to the problem either.

    Read the article

  • Rails acts_as_taggable_on grouped alphabetically?

    - by Ray Dookie
    Having sorted the tag_counts hash via the following code: sorted_tags = Contact.tag_counts.sort{ |x,y| x.name.downcase <= y.name.downcase } what is the easiest/most efficient way to display the tags in my view grouped by letters? i.e A - "Alpha", "Apple", "Aza" B - "Beta", "Bonkers" . . . Z - "Zeta", "Zimmer" Any ideas?

    Read the article

  • Python modify an xml file

    - by michele
    I have this xml model. link text So I have to add some node (see the text commented) to this file. How I can do it? I have writed this partial code but it doesn't work: xmldoc=minidom.parse(directory) child = xmldoc.createElement("map") for node in xmldoc.getElementsByTagName("Environment"): node.appendChild(child) Thanks in advance.

    Read the article

  • Javascript: Inline function vs predefined functions

    - by glaz666
    Can any body throw me some arguments for using inline functions against passing predefined function name to some handler. I.e. which is better: (function(){ setTimeout(function(){ /*some code here*/ }, 5); })(); versus (function(){ function invokeMe() { /*code*/ } setTimeout(invokeMe, 5); })(); Strange question, but we are almost fighting in the team about this

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • Serve external template in Django

    - by AlexeyMK
    Hey, I want to do something like return render_to_response("http://docs.google.com/View?id=bla", args) and serve an external page with django arguments. Django doesn't like this (it looks for templates in very particular places). What's the easiest way make this work? Right now I'm thinking to use urllib to save the page to somewhere locally on my server and then serve with the templates pointing to there. Note: I'm not looking for anything particularly scalable here, I realize my proposal above is a little dirty.

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Specifying schema for temporary tables

    - by Tom Hunter
    I'm used to seeing temporary tables created with just the hash/number symbol, like this: CREATE TABLE #Test ( [Id] INT ) However, I've recently come across stored procedure code that specifies the schema name when creating temporary tables, for example: CREATE TABLE [dbo].[#Test] ( [Id] INT ) Is there any reason why you would want to do this? If you're only specifying the user's default schema, does it make any difference? Does this refer to the [dbo] schema in the local database or the tempdb database?

    Read the article

  • Rails: Easy way to add more than one flash[:notice] at a time.

    - by Josh Pinter
    I thought every time you do a flash[:notice]="Message" it would add it to the array which would then get displayed during the view but the following just keeps the last flash: flash[:notice] = "Message 1" flash[:notice] = "Message 2" Now I realize it's just a simple hash with a key (I think :)) but is there a better way to do multiple flashes than the following: flash[:notice] = "Message 1<br />" flash[:notice] = "Message 2" Thanks. Josh

    Read the article

  • mounting ext4 fs with block size of 65536

    - by seaquest
    I am doing some benchmarking on EXT4 performance on Compact Flash media. I have created an ext4 fs with block size of 65536. however I can not mount it on ubuntu-10.10-netbook-i386. (it is already mounting ext4 fs with 4096 bytes of block sizes) According to my readings on ext4 it should allow such big block sized fs. I want to hear your comments. root@ubuntu:~# mkfs.ext4 -b 65536 /dev/sda3 Warning: blocksize 65536 not usable on most systems. mke2fs 1.41.12 (17-May-2010) mkfs.ext4: 65536-byte blocks too big for system (max 4096) Proceed anyway? (y,n) y Warning: 65536-byte blocks too big for system (max 4096), forced to continue Filesystem label= OS type: Linux Block size=65536 (log=6) Fragment size=65536 (log=6) Stride=0 blocks, Stripe width=0 blocks 19968 inodes, 19830 blocks 991 blocks (5.00%) reserved for the super user First data block=0 1 block group 65528 blocks per group, 65528 fragments per group 19968 inodes per group Writing inode tables: done Creating journal (1024 blocks): done Writing superblocks and filesystem accounting information: done This filesystem will be automatically checked every 37 mounts or 180 days, whichever comes first. Use tune2fs -c or -i to override. root@ubuntu:~# tune2fs -l /dev/sda3 tune2fs 1.41.12 (17-May-2010) Filesystem volume name: <none> Last mounted on: <not available> Filesystem UUID: 4cf3f507-e7b4-463c-be11-5b408097099b Filesystem magic number: 0xEF53 Filesystem revision #: 1 (dynamic) Filesystem features: has_journal ext_attr resize_inode dir_index filetype extent flex_bg sparse_super large_file huge_file uninit_bg dir_nlink extra_isize Filesystem flags: signed_directory_hash Default mount options: (none) Filesystem state: clean Errors behavior: Continue Filesystem OS type: Linux Inode count: 19968 Block count: 19830 Reserved block count: 991 Free blocks: 18720 Free inodes: 19957 First block: 0 Block size: 65536 Fragment size: 65536 Blocks per group: 65528 Fragments per group: 65528 Inodes per group: 19968 Inode blocks per group: 78 Flex block group size: 16 Filesystem created: Sat Feb 5 14:39:55 2011 Last mount time: n/a Last write time: Sat Feb 5 14:40:02 2011 Mount count: 0 Maximum mount count: 37 Last checked: Sat Feb 5 14:39:55 2011 Check interval: 15552000 (6 months) Next check after: Thu Aug 4 14:39:55 2011 Lifetime writes: 70 MB Reserved blocks uid: 0 (user root) Reserved blocks gid: 0 (group root) First inode: 11 Inode size: 256 Required extra isize: 28 Desired extra isize: 28 Journal inode: 8 Default directory hash: half_md4 Directory Hash Seed: afb5b570-9d47-4786-bad2-4aacb3b73516 Journal backup: inode blocks root@ubuntu:~# mount -t ext4 /dev/sda3 /mnt/ mount: wrong fs type, bad option, bad superblock on /dev/sda3, missing codepage or helper program, or other error In some cases useful info is found in syslog - try dmesg | tail or so

    Read the article

  • Call trace in Android

    - by DenMark
    I want to know how to do method tracing for Android applications. I mean, a sequence of calls on each object, not a stack trace. It's very similar to this question (Call trace in java), but on different platforms (jvm-PC vs dvm-Android). I have no control over the start arguments of dalvik, thus I cannot specify a java agent (or am I wrong here?). Is there another way to do method tracing? Thanks!

    Read the article

  • supress warning for generated c# code

    - by soren.enemaerke
    I have turned on "Treat warnings as errors" for my VS project which mean that I get errors for missing documentation (nice reminder for this particular project). However, part of the code is generated by a custom tool which does not insert xml documentation so I'm looking for away to ignore the missing xml documentation for the generated code only, not for the entire project. I have no influence on the actual file generated and cannot really insert anything in the file (as it is regenerated frequently by the tool) so I looking for something existing outside the generated file (the classes that are generated are partial, if that helps)

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • how get fully result from Asynchronism communication?

    - by rima
    Hi all refer to these post : here1 and here2 at last I solve my problem by build a asynchronous solution,and it work well!!! but there is a problem that i face with it,now my code is like this: class MyProcessStarter { private Process process; private StreamWriter myStreamWriter; private static StringBuilder shellOutput = null; public String GetShellOutput { get { return shellOutput.ToString(); }} public MyProcessStarter(){ shellOutput = new StringBuilder(""); process = new Process(); process.StartInfo.FileName = "sqlplus"; process.StartInfo.UseShellExecute = false; process.StartInfo.CreateNoWindow = true; process.OutputDataReceived += new DataReceivedEventHandler(ShellOutputHandler); process.StartInfo.RedirectStandardInput = true; process.StartInfo.RedirectStandardOutput = true; //process.StartInfo.RedirectStandardError = true; process.Start(); myStreamWriter = process.StandardInput; process.BeginOutputReadLine(); } private static void ShellOutputHandler(object sendingProcess,DataReceivedEventArgs outLine) { if (!String.IsNullOrEmpty(outLine.Data)) shellOutput.Append(Environment.NewLine + outLine.Data); } public void closeConnection() { myStreamWriter.Close(); process.WaitForExit(); process.Close(); } public void RunCommand(string arguments) { myStreamWriter.WriteLine(arguments); myStreamWriter.Flush(); process.WaitForExit(100); Console.WriteLine(shellOutput); Console.WriteLine("============="+Environment.NewLine); process.WaitForExit(2000); Console.WriteLine(shellOutput); } } and my input is like this: myProcesStarter.RunCommand("myusername/mypassword"); Console.writeline(myProcesStarter.GetShellOutput); but take a look at my out put: SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. ============= SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. Enter user-name: Connected to: Oracle Database 11g Enterprise Edition Release 11.1.0.6.0 - Production With the Partitioning, OLAP, Data Mining and Real Application Testing options as u see the output for run a function is not same in different time!So now would you do me a faver and help me that how I can wait until all the output done in other mean how I can customize my process to wait until output finishing ?? because I want to write a sqlcompiler so I need the exact output of shell. plz help me soon.thanxxxxxxxxxxxx :X

    Read the article

  • Remove first and last characters from a string in Lisp

    - by powerj1984
    I am passing in command line arguments to my Lisp program and they are formatted like this when they hit my main function: ("1 1 1" "dot" "2 2 2") I have a dot function and would like to call it directly from the argument, but first I must strip the " characters. I tried variations of this function: (defun remove-quotes (s) (setf (aref s 0) '"")) to no avail, Lisp complains that "" is not a member of base-char. Thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >