Search Results

Search found 4222 results on 169 pages for 'dtd parsing'.

Page 158/169 | < Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • StringBuffer wont read whole stream into a string (JAVA/Android)

    - by Levara
    Hi all! I'm making an android program that retrieves content of a webpage using HttpURLConnection. I'm new to both Java and Android. Problem is: Reader reads whole page source, but in the last while iteration it doesn't append to stringBuffer that last part. Using debbuger I have determined that, in the last loop iteration, string buff is created, but stringBuffer just doesnt append it. I need to parse retrieved content. Is there any better way to handle the content for parsing than using strings. I've read on numerous other sites that string size in Java is limited only by available heap size. I've tried with StringBuilder too. Anyone know what could be the problem. Btw feel free to suggest any improvements to the code. Thanks! URL u; try { u = new URL("http://feeds.timesonline.co.uk/c/32313/f/440134/index.rss"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestProperty("User-agent","Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.1; SV1; .NET CLR 1.1.4322; InfoPath.1; .NET CLR 2.0.50727)"); c.setRequestMethod("GET"); c.setDoOutput(true); c.setReadTimeout(3000); c.connect(); StringBuffer stringBuffer = new StringBuffer(""); InputStream in = c.getInputStream(); InputStreamReader inp = new InputStreamReader(in); BufferedReader reader = new BufferedReader(inp); char[] buffer = new char[3072]; int len1 = 0; while ( (len1 = reader.read(buffer)) != -1 ) { String buff = new String(buffer,0,len1); stringBuffer.append(buff); } String stranica = new String(stringBuffer); c.disconnect(); reader.close(); inp.close(); in.close();

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • cellForRowAtIndexPath called too late

    - by Mihai Fonoage
    Hi, I am trying to re-load a table every time some data I get from the web is available. This is what I have: SearchDataViewController: - (void)parseDatatXML { parsingDelegate = [[XMLParsingDelegate alloc] init]; parsingDelegate.searchDataController = self; // CONTAINS THE TABLE THAT NEEDS RE-LOADING; ImplementedSearchViewController *searchController = [[ImplementedSearchViewController alloc] initWithNibName:@"ImplementedSearchView" bundle:nil]; ProjectAppDelegate *delegate = [[UIApplication sharedApplication] delegate]; UINavigationController *nav = (UINavigationController *)[delegate.splitViewController.viewControllers objectAtIndex: 0]; NSArray *viewControllers = [[NSArray alloc] initWithObjects:nav, searchController, nil]; self.splitViewController.viewControllers = viewControllers; [viewControllers release]; // PASS A REFERENCE TO THE PARSING DELEGATE SO THAT IT CAN CALL reloadData on the table parsingDelegate.searchViewController = searchController; [searchController release]; // Build the url request used to fetch data ... NSURLRequest *dataURLRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:dataURL]]; parsingDelegate.feedConnection = [[[NSURLConnection alloc] initWithRequest:dataURLRequest delegate:parsingDelegate] autorelease]; } ImplementedSearchViewController: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSLog(@"count = %d", [keys count]); // keys IS A NSMutableArray return [self.keys count]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { ... cell.textLabel.text = [keys objectAtIndex:row]; ... } XMLParsingDelgate: -(void) updateSearchTable:(NSArray *)array { ... [self.currentParseBatch addObject:(NSString *)[array objectAtIndex:1]]; // RELOAD TABLE [self.searchViewController.table reloadData]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if ([elementName isEqualToString:@"..."]) { self.currentParseBatch = [NSMutableArray array]; searchViewController.keys = self.currentParseBatch; ... } ... } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if ([elementName isEqualToString:@"..."]) { ... [self performSelectorOnMainThread:@selector(updateSearchTable:) withObject:array waitUntilDone:NO]; } ... } My problem is that when I debug, the calls go between reloadData and numberOfRowsInSection until the keys array is filled with the last data, time at which the cellForRowAtIndexPath gets called. I wanted the table to be updated for each element I send, one by one, instead of just in the end. Any ideas why this behavior? Thank you!

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

  • C# Getting a node with attributes from SelectSingleNode

    - by bdefreese
    Hi folks, I am quite the n00b but lately I have been playing with parsing some XML data. I actually found a nice feature on this site where I can get to a specific node with a specific attribute by doing: docFoo.SelectSingleNode("foo/bar/baz[@name='qux']); However, the data looks like this: <saving-throws> <saving-throw> <name>Fortitude</name> <abbr>Fort</abbr> <ability>Con</ability> <modifiers> <modifier name="base" value="2"/> <modifier name="ability" value="5"/> <modifier name="magic" value="0"/> <modifier name="feat" value="0"/> <modifier name="race" value="0"/> <modifier name="familar" value="0"/> <modifier name="feature" value="0"/> <modifier name="user" value="0"/> <modifier name="misc" value="0"/> </modifiers> </saving-throw> <saving-throw> <name>Reflex</name> <abbr>Ref</abbr> <ability>Dex</ability> <modifiers> <modifier name="base" value="6"/> <modifier name="ability" value="1"/> <modifier name="magic" value="0"/> <modifier name="feat" value="0"/> <modifier name="race" value="0"/> <modifier name="familar" value="0"/> <modifier name="feature" value="0"/> <modifier name="user" value="0"/> <modifier name="misc" value="0"/> </modifiers> </saving-throw> And I want to be able to get the node with name=base but for each saving-throw node where childnode "abbr" = xx. Can I somehow do that in a single SelectSingleNode or am I going to have to stop at saving throw and walk through the rest of the tree? Thanks!

    Read the article

  • What are the steps to convert this function to a model/controller in Zend Framework?

    - by Joel
    Hi guys, I'm learning Zend Framework MVC, and I have a website that is mainly static php pages. However one of the pages is using functions, etc, and I'm trying to figure out what the process is for converting this to an OOP setup. Within the <body> I have this function (and more, but this is the first function): function filterEventDetails($contentText) { $data = array(); foreach($contentText as $row) { if(strstr($row, 'When: ')) { ##cleaning "when" string to get date in the format "May 28, 2009"## $data['duration'] = str_replace('When: ','',$row); list($when, ) = explode(' to ',$data['duration']); $data['when'] = substr($when,4); if(strlen($data['when'])>13) $data['when'] = trim(str_replace(strrchr($data['when'], ' '),'',$data['when'])); $data['duration'] = substr($data['duration'], 0, strlen($data['duration'])-4); //trimming time zone identifier (UTC etc.) } if(strstr($row, 'Where: ')) { $data['where'] = str_replace('Where: ','',$row); //pr($row); //$where = strstr($row, 'Where: '); //pr($where); } if(strstr($row, 'Event Description: ')) { $event_desc = str_replace('Event Description: ','',$row); //$event_desc = strstr($row, 'Event Description: '); ## Filtering event description and extracting venue, ticket urls etc from it. //$event_desc = str_replace('Event Description: ','',$contentText[3]); $event_desc_array = explode('|',$event_desc); array_walk($event_desc_array,'get_desc_second_part'); //pr($event_desc_array); $data['venue_url'] = $event_desc_array[0]; $data['details'] = $event_desc_array[1]; $data['tickets_url'] = $event_desc_array[2]; $data['tickets_button'] = $event_desc_array[3]; $data['facebook_url'] = $event_desc_array[4]; $data['facebook_icon'] = $event_desc_array[5]; } } return $data; } ?> So right now I have this in my example.phtml view page. I understand this needs to be a model and acted on by the controller, but I'm really not sure where to start with this conversion? This is a function tht is taking info from a Google calendar and parsing it for the view. Thanks for any help!

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • How to manually (bitwise) perform (float)x? (homework)

    - by Silver
    Now, here is the function header of the function I'm supposed to implement: /* * float_from_int - Return bit-level equivalent of expression (float) x * Result is returned as unsigned int, but * it is to be interpreted as the bit-level representation of a * single-precision floating point values. * Legal ops: Any integer/unsigned operations incl. ||, &&. also if, while * Max ops: 30 * Rating: 4 */ unsigned float_from_int(int x) { ... } We aren't allowed to do float operations, or any kind of casting. Now I tried to implement the first algorithm given at this site: http://locklessinc.com/articles/i2f/ Here's my code: unsigned float_from_int(int x) { // grab sign bit int xIsNegative = 0; int absValOfX = x; if(x < 0){ xIsNegative = 1; absValOfX = -x; } // zero case if(x == 0){ return 0; } //int shiftsNeeded = 0; /*while(){ shiftsNeeded++; }*/ unsigned I2F_MAX_BITS = 15; unsigned I2F_MAX_INPUT = ((1 << I2F_MAX_BITS) - 1); unsigned I2F_SHIFT = (24 - I2F_MAX_BITS); unsigned result, i, exponent, fraction; if ((absValOfX & I2F_MAX_INPUT) == 0) result = 0; else { exponent = 126 + I2F_MAX_BITS; fraction = (absValOfX & I2F_MAX_INPUT) << I2F_SHIFT; i = 0; while(i < I2F_MAX_BITS) { if (fraction & 0x800000) break; else { fraction = fraction << 1; exponent = exponent - 1; } i++; } result = (xIsNegative << 31) | exponent << 23 | (fraction & 0x7fffff); } return result; } But it didn't work (see test error below): Test float_from_int(-2147483648[0x80000000]) failed... ...Gives 0[0x0]. Should be -822083584[0xcf000000] 4 4 0 float_times_four I don't know where to go from here. How should I go about parsing the float from this int?

    Read the article

  • Visual studio 2010 colourizers, intellisense and the rest. Where to start!!

    - by Owen
    Ok, before I begin I realize that there is a lot of documentation on this subject but I have thus far failed to get even basic colourization working for VS2010. My goal is to simply get to a point where I can open a document and everything is coloured red, from here I can implement the relevant parsing logic. Here's what I have tried/found: 1) Downloaded all the relevent SDK's and such- Found the ook sample (http://code.msdn.microsoft.com/ookLanguage) - didn't build, didn't work. 2) Knowing almost nothing about MEF read through "Implementing a Language Service By Using the Managed Package Framework" - http://msdn.microsoft.com/en-us/library/bb166533(v=VS.100).aspx This was pretty much a copy and paste of all the basic stuff here, and also updating some references which were out of date with the sample see: http://social.msdn.microsoft.com/Forums/en-US/vsx/thread/a310fe67-afd2-4592-b295-3fc86fec7996 Now, I have got to a point where when running the package MEF appears to have hooked up correctly (I know this because with the debugger open I can see that the packages initialize and FDoIdle methods are being hit). When I open a file of the extension I have registered with the ProvideLanguageExtensionAttribute everything dies as if in an endless loop, yet no debug symbols hit (though they are loaded). Looking at the ook sample and the MEF examples they seem to be totally different approaches to the same problem. In the ook sample there are notions of Clasifications and Completion controllers which aren't mentioned in the MEF example. Also, they don't seem to create a Package or Language service, so I have no idea how it should work? With the MEF example, my assumption is that I need to hook into the "IScanner.ScanTokenAndProvideInfoAboutIt" to provide syntax highlighting? Which would be fine if I could ever hit this method. So my first question I guess is which approach should I be taking here? Or do they both somehow tie together? My second questions is, where can I find a basic fully working project that implements bog standard basic syntax highlighting and intellisense or VS2010? Thirdly, in the MEF example when I created a Package there were a bunch of test projects created for me. I appears that the integration tests launch the VS2010 test rig somehow, but the test fails. It would be good to write my service with tests but I have no idea what/how I can test each interaction so any references to testing Language services would be helpful. Finally, please throw any resource/book links my way that I may find useful. Cheers, Chris. N.B. Sorry I realize this is part question part rant, but I have never been so confused.

    Read the article

  • JavaScript (via Greasemonkey) failing to set "title" attributes on <a> tags

    - by rjray
    I have the following (fairly) simple JavaScript snippet that I have wired into Greasemonkey. It goes through a page, looks for <a> tags whose href points to tinyurl.com, and adds a "title" attribute that identifies the true destination of the link. Much of the important code comes from an older (unsupported) Greasemonkey script that quits working when the inner component that held the XPath implementation changed. My script: (function() { var providers = new Array(); providers['tinyurl.com'] = function(link, fragment) { // This is mostly taken from the (broken due to XPath component // issues) tinyurl_popup_preview script. link.title = "Loading..."; GM_xmlhttpRequest({ method: 'GET', url: 'http://preview.tinyurl.com/' + fragment, onload: function(res) { var re = res.responseText.match("<blockquote><b>(.+)</b></blockquote>"); if (re) { link.title = re[1].replace(/\<br \/\>/g, "").replace(/&amp;/g, "&"); } else { link.title = "Parsing failed..."; } }, onerror: function() { link.title = "Connection failed..."; } }); }; var uriPattern = /(tinyurl\.com)\/([a-zA-Z0-9]+)/; var aTags = document.getElementsByTagName("a"); for (i = 0; i < aTags.length; i++) { var data = aTags[i].href.match(uriPattern); if (data != null && data.length > 1 && data[2] != "preview") { var source = data[1]; var fragment = data[2]; var link = aTags[i]; aTags[i].addEventListener("mouseover", function() { if (link.title == "") { (providers[source])(link, fragment); } }, false); } } })(); (The reason the "providers" associative array is set up the way it is, is so that I can expand this to cover other URL-shortening services as well.) I have verified that all the various branches of code are being reached correctly, in cases where the link being examined does and does not match the pattern. What isn't happening, is any change to the "title" attribute of the anchor tags. I've watched this via Firebug, thrown alert() calls in left and right, and it just never changes. In a previous iteration all expressions of the form: link.title = "..."; had originally been: link.setAttribute("title", "..."); That didn't work, either. I'm no newbie to JavaScript OR Greasemonkey, but this one has me stumped!

    Read the article

  • JAVA: XML parsers gives null element

    - by Johan
    When I try to parse a XML-file, it gives sometimes a null element by the title. I think it has to do with HTML-tags &#039; How can I solve this problem? I have the follow XML-file: <item> <title>&#039; Nieuwe DVD &#039;</title> <description>tekst, tekst tekst</description> <link>dvd.html</link> <category>nieuws</category> <pubDate>Sat, 1 Jan 2011 9:24:00 +0000</pubDate> </item> And the follow code to parse the xml-file: //DocumentBuilderFactory, DocumentBuilder are used for //xml parsing DocumentBuilderFactory dbf = DocumentBuilderFactory .newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); //using db (Document Builder) parse xml data and assign //it to Element Document document = db.parse(is); Element element = document.getDocumentElement(); //take rss nodes to NodeList element.normalize(); NodeList nodeList = element.getElementsByTagName("item"); if (nodeList.getLength() > 0) { for (int i = 0; i < nodeList.getLength(); i++) { //take each entry (corresponds to <item></item> tags in //xml data Element entry = (Element) nodeList.item(i); entry.normalize(); Element _titleE = (Element) entry.getElementsByTagName( "title").item(0); Element _categoryE = (Element) entry .getElementsByTagName("category").item(0); Element _pubDateE = (Element) entry .getElementsByTagName("pubDate").item(0); Element _linkE = (Element) entry.getElementsByTagName( "link").item(0); String _title = _titleE.getFirstChild().getNodeValue(); String _category = _categoryE.getFirstChild().getNodeValue(); Date _pubDate = new Date(_pubDateE.getFirstChild().getNodeValue()); String _link = _linkE.getFirstChild().getNodeValue(); //create RssItemObject and add it to the ArrayList RssItem rssItem = new RssItem(_title, _category, _pubDate, _link); rssItems.add(rssItem); conn.disconnect(); }

    Read the article

  • what is the purpose of getEventType() method in XMLStreamReader Class

    - by KItis
    I have sample code written for parsing xml file using javax.xml package. it uses the method called getEventType() , but I can not understand the purpose of this method. i wrote simple application to understand its usefulness, but it output only some random numbers for which I can not make any sense, could some one help me to get this point right. Here is the sample code I have written. public List parseXML(File f) throws XMLStreamException{ xmlInputFactory = new WstxInputFactory(); xmlInputFactory.setProperty(XMLInputFactory2.IS_REPLACING_ENTITY_REFERENCES, Boolean.FALSE); xmlInputFactory.setProperty(XMLInputFactory2.IS_SUPPORTING_EXTERNAL_ENTITIES, Boolean.FALSE); xmlInputFactory.setProperty(XMLInputFactory2.IS_COALESCING,Boolean.FALSE); xmlInputFactory.setProperty(XMLInputFactory2.IS_VALIDATING,Boolean.FALSE); xmlInputFactory.configureForSpeed(); List<Task> tasks = new LinkedList<Task>(); //xmlStreamReader = xmlInputFactory.createXMLStreamReader(new StringReader(dmml)); xmlStreamReader = xmlInputFactory.createXMLStreamReader(f); int eventType = xmlStreamReader.getEventType(); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); eventType = xmlStreamReader.next(); System.out.println(eventType); /*String currentElement = ""; String currentElementText = ""; }

    Read the article

  • How SQLite on Android handles long stings?

    - by Levara
    Hi! I'm wondering how Android's implementation of SQLite handles long Strings. Reading from online documentation on sqlite, it said that strings in sqlite are limited to 1 million characters. My strings are definitely smaller. I'm creating a simple RSS application, and after parsing a html document, and extracting text, I'm having problem saving it to a database. I have 2 tables in database, feeds and articles. RSS feeds are correctly saved and retrieved from feeds table, but when saving to the articles table, logcat is saying that it cannot save extracted text to it's column. I don't know if other columns are making problems too, no mention of them in logcat. I'm wondering, since text is from an article on web, are signs like (",',;) creating problems? Is Android automaticaly escaping them, or I have to do that. I'm using a technique for inserting similar to one in notepad tutorial: public long insertArticle(long feedid, String title, String link, String description, String h1, String h2, String h3, String p, String image, long date) { ContentValues initialValues = new ContentValues(); initialValues.put(KEY_FEEDID, feedid); initialValues.put(KEY_TITLE, title); initialValues.put(KEY_LINK, link); initialValues.put(KEY_DESCRIPTION, description ); initialValues.put(KEY_H1, h1 ); initialValues.put(KEY_H2, h2); initialValues.put(KEY_H3, h3); initialValues.put(KEY_P, p); initialValues.put(KEY_IMAGE, image); initialValues.put(KEY_DATE, date); return mDb.insert(DATABASE_TABLE_ARTICLES,null, initialValues); } Column P is for extracted text, h1, h2 and h3 are for headers from a page. Logcat reports only column p to be the problem. The table is created with following statement: private static final String DATABASE_CREATE_ARTICLES = "create table articles( _id integer primary key autoincrement, feedid integer, title text, link text not null, description text," + "h1 text, h2 text, h3 text, p text, image text, date integer);"; Thanks!

    Read the article

  • expecte ')' before className

    - by Akbarbuneri
    Hi I have a class DataObject as Header ::: #import <Foundation/Foundation.h> @interface DataObject : NSObject { NSString *erorrMessage; BOOL hasError; NSDictionary *dataValues; } @property(nonatomic, retain)NSString *erorrMessage; @property(nonatomic)BOOL hasError; @property(nonatomic, retain)NSDictionary *dataValues; @end Class Implementation:::: #import "DataObject.h" @implementation DataObject @synthesize erorrMessage; @synthesize hasError; @synthesize dataValues; @end And I have another class as DataManager Header as :::: #import <Foundation/Foundation.h> @interface DataManager : NSObject - (DataObject *)getData :(NSString*)url; @end Implementation :::: #import "DataManager.h" #import "DataObject.h" #import "JSON.h" @implementation DataManager - (DataObject *)getData :(NSString*)url{ DataObject* dataObject = [[DataObject alloc]init]; NSString *urlString = [NSString stringWithFormat:url]; NSURLRequest *request = [NSURLRequest requestWithURL:[NSURL URLWithString:urlString]]; //TODO: Here we have to check the internet connection before requesting. NSError * erorrOnRequesting; NSData *data = [NSURLConnection sendSynchronousRequest:request returningResponse:nil error:&erorrOnRequesting]; NSString* responseString = [[NSString alloc] initWithData:data encoding:NSUTF8StringEncoding]; if( erorrOnRequesting != nil) { dataObject.hasError = YES; dataObject.erorrMessage = @"Error on requsting to the web server"; return dataObject; } NSError *errorOnParsing; SBJSON *json = [[SBJSON new] autorelease]; NSDictionary *dataValues = [json objectWithString:responseString error:&errorOnParsing]; [responseString release]; if(errorOnParsing != nil) { //TODO: We have to send the website a feedback that there is some problem on the server end. dataObject.hasError = YES; dataObject.erorrMessage = @"Error on parsing, the server returned invalid data."; return dataObject; } dataObject.hasError = NO; dataObject.dataValues = dataValues; return dataObject; } @end Now when I build I got an error in the DataManager header where I #import Dataobject header, it says "error: expected')' before DataObject" I don;t understand what I miss. Thanks for the help..

    Read the article

  • How can I enable a debugging mode via a command-line switch for my Perl program?

    - by Michael Mao
    I am learning Perl in a "head-first" manner. I am absolutely a newbie in this language: I am trying to have a debug_mode switch from CLI which can be used to control how my script works, by switching certain subroutines "on and off". And below is what I've got so far: #!/usr/bin/perl -s -w # purpose : make subroutine execution optional, # which is depending on a CLI switch flag use strict; use warnings; use constant DEBUG_VERBOSE => "v"; use constant DEBUG_SUPPRESS_ERROR_MSGS => "s"; use constant DEBUG_IGNORE_VALIDATION => "i"; use constant DEBUG_SETPPING_COMPUTATION => "c"; our ($debug_mode); mainMethod(); sub mainMethod # () { if(!$debug_mode) { print "debug_mode is OFF\n"; } elsif($debug_mode) { print "debug_mode is ON\n"; } else { print "OMG!\n"; exit -1; } checkArgv(); printErrorMsg("Error_Code_123", "Parsing Error at..."); verbose(); } sub checkArgv #() { print ("Number of ARGV : ".(1 + $#ARGV)."\n"); } sub printErrorMsg # ($error_code, $error_msg, ..) { if(defined($debug_mode) && !($debug_mode =~ DEBUG_SUPPRESS_ERROR_MSGS)) { print "You can only see me if -debug_mode is NOT set". " to DEBUG_SUPPRESS_ERROR_MSGS\n"; die("terminated prematurely...\n") and exit -1; } } sub verbose # () { if(defined($debug_mode) && ($debug_mode =~ DEBUG_VERBOSE)) { print "Blah blah blah...\n"; } } So far as I can tell, at least it works...: the -debug_mode switch doesn't interfere with normal ARGV the following commandlines work: ./optional.pl ./optional.pl -debug_mode ./optional.pl -debug_mode=v ./optional.pl -debug_mode=s However, I am puzzled when multiple debug_modes are "mixed", such as: ./optional.pl -debug_mode=sv ./optional.pl -debug_mode=vs I don't understand why the above lines of code "magically works". I see both of the "DEBUG_VERBOS" and "DEBUG_SUPPRESS_ERROR_MSGS" apply to the script, which is fine in this case. However, if there are some "conflicting" debug modes, I am not sure how to set the "precedence of debug_modes"? Also, I am not certain if my approach is good enough to Perlists and I hope I am getting my feet in the right direction. One biggest problem is that I now put if statements inside most of my subroutines for controlling their behavior under different modes. Is this okay? Is there a more elegant way? I know there must be a debug module from CPAN or elsewhere, but I want a real minimal solution that doesn't depend on any other module than the "default". And I cannot have any control on the environment where this script will be executed...

    Read the article

  • problem with get http request from IPhone

    - by user317192
    Hi, I am writing a sample PHP Web Service that is sending GET Http request from the iphone to the web server. The server side code is returning JSON Data to iphone, the server side code looks like: function getUsers(){ $con=mysql_connect("localhost","root","123456") or die(mysql_error()); if(!mysql_select_db("eventsfast",$con)) { echo "Unable to connect to DB"; exit; } $sql="SELECT * from users"; $result=mysql_query($sql); if(!$result) { die('Could not successfully run query Error:'.mysql_error()); } $data = array(); while($row = mysql_fetch_assoc($result)){ $data['username'][] = $row['username']; $data['password'][]= $row['password']; } mysql_close($con); //print_r(json_encode($data)); //return (json_encode($data)); return json_encode('success'); } getUsers(); ? Its a simple code that Fetches all the data from the user table and send it to the iphone application. *****************************************************IPHONE APPLICATION (void)viewDidLoad { [super viewDidLoad]; responseData = [[NSMutableData data] retain]; NSURLRequest *request = [NSURLRequest requestWithURL:[NSURL URLWithString:@"http://localhost:8888/GetData.php"]]; [[NSURLConnection alloc] initWithRequest:request delegate:self]; } (void)connection:(NSURLConnection *)connection didReceiveResponse:(NSURLResponse *)response { [responseData setLength:0]; } (void)connection:(NSURLConnection *)connection didReceiveData:(NSData *)data { [responseData appendData:data]; } (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error { label.text = [NSString stringWithFormat:@"Connection failed: %@", [error description]]; } (void)connectionDidFinishLoading:(NSURLConnection *)connection { [connection release]; NSString *responseString = [[NSString alloc] initWithData:responseData encoding:NSUTF8StringEncoding]; [responseData release]; NSError *error; SBJSON *json = [[SBJSON new] autorelease]; NSArray *luckyNumbers = [json objectWithString:responseString error:&error]; [responseString release]; if (luckyNumbers == nil) label.text = [NSString stringWithFormat:@"JSON parsing failed: %@", [error localizedDescription]]; else { NSMutableString *text = [NSMutableString stringWithString:@"Lucky numbers:\n"]; for (int i = 0; i < [luckyNumbers count]; i++) [text appendFormat:@"%@\n", [luckyNumbers objectAtIndex:i]]; NSLog(text); label.text = text; } } ********************PROBLEM**************** The problem is that nothing is coming on iphone side of the application........... the response doesn't contains anything.............. Please help..............

    Read the article

  • How do I defer execution of some Ruby code until later and run it on demand in this scenario?

    - by Kyle Kaitan
    I've got some code that looks like the following. First, there's a simple Parser class for parsing command-line arguments with options. class Parser def initialize(&b); ...; end # Create new parser. def parse(args = ARGV); ...; end # Consume command-line args. def opt(...); ...; end # Declare supported option. def die(...); ...; end # Validation handler. end Then I have my own Parsers module which holds some metadata about parsers that I want to track. module Parsers ParserMap = {} def self.make_parser(kind, desc, &b) b ||= lambda {} module_eval { ParserMap[kind] = {:desc => "", :validation => lambda {} } ParserMap[kind][:desc] = desc # Create new parser identified by `<Kind>Parser`. Making a Parser is very # expensive, so we defer its creation until it's actually needed later # by wrapping it in a lambda and calling it when we actually need it. const_set(name_for_parser(kind), lambda { Parser.new(&b) }) } end # ... end Now when you want to add a new parser, you can call make_parser like so: make_parser :db, "login to database" do # Options that this parser knows how to parse. opt :verbose, "be verbose with output messages" opt :uid, "user id" opt :pwd, "password" end Cool. But there's a problem. We want to optionally associate validation with each parser, so that we can write something like: validation = lambda { |parser, opts| parser.die unless opts[:uid] && opts[:pwd] # Must provide login. } The interface contract with Parser says that we can't do any validation until after Parser#parse has been called. So, we want to do the following: Associate an optional block with every Parser we make with make_parser. We also want to be able to run this block, ideally as a new method called Parser#validate. But any on-demand method is equally suitable. How do we do that?

    Read the article

  • Getting hp-snmp-agents on HP ProLiant DL360 on Lenny working

    - by mark
    After receiving our HP ProLiant DL360 I'd like to integrate the machine into our Munin system and thus enable ProLiant specific information to be exposed via SNMP. I'm running Debian Lenny with kernel 2.6.26-2-vserver-amd64 . I've followed http://downloads.linux.hp.com/SDR/getting_started.html and the HP repository has been added to /etc/apt/sources.list.d/HP-ProLiantSupportPack.list . Setting up Lenny SNMP itself is not a problem, I configure it to have a public v1 community string to read all data and it works. I install hp-snmp-agents and run hpsnmpconfig and it adds additional lines to the top of /etc/snmp/snmpd.conf : dlmod cmaX /usr/lib64/libcmaX64.so snmpd gets restarted. Via lsof I can see that libcmaX64 was loaded and is used by snmpd, put I do not get any additional information out of snmp. I use snmpwalk -v 1 -c public ... and I can see many OIDs but I do not see the new ones I'd expect, most notably temperatures, fan speed and such. The OIDs I'm expecting are e.g. 1.3.6.1.4.1.232.6.2.6.8.1.4.1 , this is from the existing munin plugins from http://exchange.munin-monitoring.org/plugins/snmp__hp_temp/version/1 . snmpd[19007]: cmaX: Parsing shared as a type was unsucessful snmpd[19007]: cmaX: listening for subagents on port 25375 snmpd[19007]: cmaX: subMIB 1 handler has disconnected snmpd[19007]: cmaX: subMIB 2 handler has disconnected snmpd[19007]: cmaX: subMIB 3 handler has disconnected snmpd[19007]: cmaX: subMIB 5 handler has disconnected snmpd[19007]: cmaX: subMIB 6 handler has disconnected snmpd[19007]: cmaX: subMIB 8 handler has disconnected snmpd[19007]: cmaX: subMIB 9 handler has disconnected snmpd[19007]: cmaX: sent ColdStarts on ports 25376 to 25393 snmpd[19007]: cmaX: subMIB 10 handler has disconnected snmpd[19007]: cmaX: subMIB 11 handler has disconnected snmpd[19007]: cmaX: subMIB 14 handler has disconnected snmpd[19007]: cmaX: subMIB 15 handler has disconnected snmpd[19007]: cmaX: subMIB 16 handler has disconnected snmpd[19007]: cmaX: subMIB 21 handler has disconnected snmpd[19007]: cmaX: subMIB 22 handler has disconnected snmpd[19007]: cmaX: subMIB 23 handler has disconnected snmpd[19007]: cmaX: subMIB 1 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 2 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 3 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 5 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 6 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 8 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 9 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 10 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 11 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 14 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 15 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 16 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 21 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 22 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 23 will be sent on port 25376 to hp Advanced Server Management_Peer snmpd[19007]: cmaX: subMIB 18 handler has disconnected snmpd[19007]: cmaX: subMIB 18 will be sent on port 25393 to cpqnicd snmpd[19007]: NET-SNMP version 5.4.1 This doesn't look particular bad for me, it's just informational I guess. I've compared the walking OID output with and without the module and there's no difference in the OID served back at all. Are there any other prerequisites I'm missing? I've also noticed that from the time I installed hp-snmp-agents it adds a lot of additional daemons and that my load suddenly jumps to 1. I've uninstalled the package for now. Is this expected behavior?

    Read the article

< Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >