Search Results

Search found 14399 results on 576 pages for 'python noob'.

Page 159/576 | < Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • PYTHON: Look for match in a nested list

    - by elfuego1
    Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Would you help me with this?

    Read the article

  • Python module being reloaded for each request with django and mod_wsgi

    - by Vishal
    I have a variable in init of a module which get loaded from the database and takes about 15 seconds. For django development server everything is working fine but looks like with apache2 and mod_wsgi the module is loaded with every request (taking 15 seconds). Any idea about this behavior? Update: I have enabled daemon mode in mod wsgi, looks like its not reloading the modules now! needs more testing and I will update.

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Python combinations no repeat by constraint

    - by user2758113
    I have a tuple of tuples (Name, val 1, val 2, Class) tuple = (("Jackson",10,12,"A"), ("Ryan",10,20,"A"), ("Michael",10,12,"B"), ("Andrew",10,20,"B"), ("McKensie",10,12,"C"), ("Alex",10,20,"D")) I need to return all combinations using itertools combinations that do not repeat classes. How can I return combinations that dont repeat classes. For example, the first returned statement would be: tuple0, tuple2, tuple4, tuple5 and so on.

    Read the article

  • Rectangle Rotation in Python/Pygame

    - by mramazingguy
    Hey I'm trying to rotate a rectangle around its center and when I try to rotate the rectangle, it moves up and to the left at the same time. Does anyone have any ideas on how to fix this? def rotatePoint(self, angle, point, origin): sinT = sin(radians(angle)) cosT = cos(radians(angle)) return (origin[0] + (cosT * (point[0] - origin[0]) - sinT * (point[1] - origin[1])), origin[1] + (sinT * (point[0] - origin[0]) + cosT * (point[1] - origin[1]))) def rotateRect(self, degrees): center = (self.collideRect.centerx, self.collideRect.centery) self.collideRect.topleft = self.rotatePoint(degrees, self.collideRect.topleft, center) self.collideRect.topright = self.rotatePoint(degrees, self.collideRect.topright, center) self.collideRect.bottomleft = self.rotatePoint(degrees, self.collideRect.bottomleft, center) self.collideRect.bottomright = self.rotatePoint(degrees, self.collideRect.bottomright, center)

    Read the article

  • file output in python giving me garbage

    - by Richard
    When I write the following code I get garbage for an output. It is just a simple program to find prime numbers. It works when the first for loops range only goes up to 1000 but once the range becomes large the program fail's to output meaningful data output = open("output.dat", 'w') for i in range(2, 10000): prime = 1 for j in range(2, i-1): if i%j == 0: prime = 0 j = i-1 if prime == 1: output.write(str(i) + " " ) output.close() print "writing finished"

    Read the article

  • Sorting Python list based on the length of the string

    - by prosseek
    I want to sort a list of strings based on the string length. I tried to use sort as follows, but it doesn't seem to give me correct result. xs = ['dddd','a','bb','ccc'] print xs xs.sort(lambda x,y: len(x) < len(y)) print xs ['dddd', 'a', 'bb', 'ccc'] ['dddd', 'a', 'bb', 'ccc'] What might be wrong?

    Read the article

  • Python - Compress Ascii String

    - by n0idea
    I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

    Read the article

  • Dynamically adding @property in python

    - by rz
    I know that I can dynamically add an instance method to an object by doing something like: import types def my_method(self): # logic of method # ... # instance is some instance of some class instance.my_method = types.MethodType(my_method, instance) Later on I can call instance.my_method() and self will be bound correctly and everything works. Now, my question: how to do the exact same thing to obtain the behavior that decorating the new method with @property would give? I would guess something like: instance.my_method = types.MethodType(my_method, instance) instance.my_method = property(instance.my_method) But, doing that instance.my_method returns a property object.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • supply inputs to python unittests

    - by zubin71
    I`m relatively new to the concept of unit-testing and have very little experience in the same. I have been looking at lots of articles on how to write unit-tests; however, I still have difficulty in writing tests where conditions like the following arise:- Test user Input. Test input read from a file. Test input read from an environment variable. Itd be great if someone could show me how to approach the above mentioned scenarios; itd still be awesome if you could point me to a few docs/articles/blog posts which I could read.

    Read the article

  • How to print a dictionary in python c api function

    - by dizgam
    PyObject* dict = PyDict_New(); PyDict_SetItem(dict, key, value); PyDict_GetItem(dict, key); Bus error if i use getitem function otherwise not. So Want to confirm that the dictionary has the same values which i have set. Other than using PyDict_GetItem function, Is there any other method to print the values of the dictionary?

    Read the article

  • Implement loops for python 3

    - by Alex
    Implement this loop: total up the product of the numbers from 1 to x. Implement this loop: total up the product of the numbers from a to b. Implement this loop: total up the sum of the numbers from a to b. Implement this loop: total up the sum of the numbers from 1 to x. Implement this loop: count the number of characters in a string s. i'm very lost on implementing loops these are just some examples that i am having trouble with-- if someone could help me understand how to do them that would be awesome

    Read the article

  • Look for match in a nested list in Python

    - by elfuego1
    Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Additionally if the match occurs then I want to change last element of sublist B into first element of sublist A so the final solution would look like this: L1 = [[1, 17, 3, 1], [141, 25, 14, 5]]

    Read the article

  • python: problem with dictionary get method default value

    - by goutham
    I'm having a new problem here .. CODE 1: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name']))) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) CODE 2: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']])) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name']) code 2 fails but code 1 works the data serverInfo_D:{'user': 'usr', 'pass': 'pass'} data: {'par1': 9995, 'extraparam1': 22} val: {'par1','user','pass','extraparam1'} exception are raised for for data dict .. and all code in for loop which iterates over val

    Read the article

  • how to use @ in python.. and the @property

    - by zjm1126
    this is my code: def a(): print 'sss' @a() def b(): print 'aaa' b() and the Traceback is: sss Traceback (most recent call last): File "D:\zjm_code\a.py", line 8, in <module> @a() TypeError: 'NoneType' object is not callable so how to use the '@' thanks updated class a: @property def b(x): print 'sss' aa=a() print aa.b it print : sss None how to use @property thanks

    Read the article

  • Cant overload python socket.send

    - by ralu
    Code from socket import socket class PolySocket(socket): def __init__(self,*p): print "PolySocket init" socket.__init__(self,*p) def sendall(self,*p): print "PolySocket sendall" return socket.sendall(self,*p) def send(self,*p): print "PolySocket send" return socket.send(self,*p) def connect(self,*p): print "connecting..." socket.connect(self,*p) print "connected" HOST="stackoverflow.com" PORT=80 readbuffer="" s=PolySocket() s.connect((HOST, PORT)) s.send("a") s.sendall("a") Output: PolySocket init connecting... connected PolySocket sendall As we can see, send method is not overloaded.

    Read the article

  • Python metaprogramming help

    - by Timmy
    im looking into mongoengine, and i wanted to make a class an "EmbeddedDocument" dynamically, so i do this def custom(cls): cls = type( cls.__name__, (EmbeddedDocument,), cls.__dict__.copy() ) cls.a = FloatField(required=True) cls.b = FloatField(required=True) return cls A = custom( A ) and tried it on some classes, but its not doing some of the base class's init or sumthing in BaseDocument def __init__(self, **values): self._data = {} # Assign initial values to instance for attr_name, attr_value in self._fields.items(): if attr_name in values: setattr(self, attr_name, values.pop(attr_name)) else: # Use default value if present value = getattr(self, attr_name, None) setattr(self, attr_name, value) but this never gets used, thus never setting ._data, and giving me errors. how do i do this?

    Read the article

  • Python: Unpack arbitary length bits for database storage

    - by sberry2A
    I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

    Read the article

  • Unique elements of list within list in python

    - by user2901061
    We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma. I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such: for i, zoo in enumerate(zoos): zoos[i] = zoo.split() However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated. Thanks

    Read the article

< Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >