Search Results

Search found 7190 results on 288 pages for 'character codes'.

Page 16/288 | < Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >

  • my jQuery codes suspected to fail on IE 7

    - by Kyle
    I have received numerous calls from users lately, stating that they are not able to access the conference sites with IE7. These sites are created from a template, and they are managed on Joomla. Previously on other sites, there have no problems or complaints. However, with the recent complaints , I suspect that the culprit is my simple jQuery codes since the sites that have been reported have been created recently and incorporated with jQuery features. Site A (does not contain any jQuery): digitalmediaroi.net Site B (With recent complaints that fails to load on certain IE7): http://brownfieldscanada.com/ These are the jQuery codes that are running concurrently on a page. Are they using too much memory, therefore causing a problem on IE 7 ? <span id="alertTxt" style="text-align:center;display:none"><span style="color:#CC0000; font-weight:bold;">ALERT:</span> Municipalities, Developers, Owners, QPs, Consultants, Lawyers, Service Providers</span> <span id="alertTxt2" style="text-align:center; font-weight:bold; display:none">This high-level summit is specifically designed for YOU!</span> <span id="alertTxt3" style="text-align:center; font-weight:bold; display:none; color:#184b26;">Don't miss our Ground Water Protection, Shallow Soil and Waterfront Properties Workshop</span> <span id="alertTxt4" style="text-align:center; font-weight:bold; display:none"><a href="register/registeronline.html" title="Register for the Transforming &amp; Revitalizing Downtowns Summit!" style="font-family:ariel, helvetica, san-serif; color:#000099; text-decoration:underline;">Online registration now available!</a></span> <script type="text/javascript"> function animateTxt() { $j("#alertTxt").fadeIn(2000).delay(6000).fadeOut(1500, function() { $j("#alertTxt2").fadeIn(2000).delay(3000).fadeOut(1500,function(){ $j("#alertTxt3").fadeIn(2000).delay(6000).fadeOut(1500,function(){ $j("#alertTxt4").delay(500).fadeIn(2000).delay(4000).fadeOut(1500,function(){ animateTxt();}); }); }); }); } animateTxt(); </script> <script type="text/javascript">// <![CDATA[ var imgs1 = new Array("http://www.brownfieldscanada.com/images/brown-images/sponsors/intrinsik.jpg", "http://www.brownfieldscanada.com/images/brown-images/sponsors/stantec.jpg"); var imgs1_alt = new Array("Intrinsik - Sponsor of Ontario Brownfields Regulatory Summit", "Stantec - Sponsor of Ontario Brownfields Regulatory Summit"); var sponsor_names = new Array("Sponsor:","Sponsor:"); var lnks1 = new Array("http://www.intrinsikscience.com/", "http://www.stantec.com/"); var currentAd1 = 0; var imgCt1 = imgs1.length; function cycle1() { if (currentAd1 == imgCt1) { currentAd1 = 0; } var banner1 = document.getElementById('adBanner1'); var link1 = document.getElementById('adLink1'); banner1.src=imgs1[currentAd1]; banner1.alt=imgs1_alt[currentAd1]; link1.href=lnks1[currentAd1]; document.getElementById('sponsorheader').innerHTML = sponsor_names[currentAd1]; $j("#adBanner1").fadeIn(2000).delay(5000).fadeOut(1500, function(){ currentAd1++; cycle1(); }); } cycle1(); // ]]></script> <script type="text/javascript">// <![CDATA[ var partner_img = new Array("http://www.brownfieldscanada.com/images/brown-images/partners/BuildingLogo-2.jpg", "http://www.brownfieldscanada.com/images/brown-images/partners/NRU-Publishing_logo.jpg", "http://www.brownfieldscanada.com/images/brown-images/partners/haz_mat.jpg", "http://www.brownfieldscanada.com/images/brown-images/partners/oppi_logo_blue_with_tag.jpg", "http://www.brownfieldscanada.com/images/brown-images/partners/renew_logo.jpg", "http://www.brownfieldscanada.com/images/brown-images/partners/DCN.jpg"); var partner_lnks = new Array("http://www.building.ca/", "http://www.nrupublishing.com/", "http://www.hazmatmag.com/", "http://www.ontarioplanners.on.ca/", "http://renewcanada.net/", "http://www.dailycommercialnews.com/"); var partner_alt = new Array("Building.ca - Parter for Ontario Brownfields Regulatory Summit", "NRU Publishing - Partner for Ontario Brownfields Regulatory Summit", "HazMat Management Magazine - Partner for Ontario Brownfields Regulatory Summit", "The Ontario Professional Planners Institute - Partner for Ontario Brownfields Regulatory Summit", "Renew Canada - Partner for Ontario Brownfields Regulatory Summit", "Daily Commercial News and Construction Record - Partner for Ontario Brownfields Regulatory Summit"); var partner_title = new Array("Real Estate Development • Construction • Architecture", "NRU Publishing", "HazMat Management Magazine", "The Ontario Professional Planners Institute", "ReNew Canada", "Daily Commercial News and Construction Record"); var partner_name = new Array("Partner:","Partner:","Partner:","Partner:","Partner:", "Partner:"); var partner_num = 0; var partner_total = 6; function partnerCycle() { if (partner_num == partner_total) { partner_num = 0; } var partnerBanner = document.getElementById('partnerBanner'); var link1 = document.getElementById('partnerLink'); partnerBanner.src=partner_img[partner_num]; partnerBanner.alt=partner_alt[partner_num]; document.getElementById('partnerLink').href=partner_lnks[partner_num]; document.getElementById('partnerLink').title=partner_title[partner_num]; document.getElementById('partnerheader').innerHTML="<strong>"+partner_name[partner_num]+"</strong>"; $j("#partnerBanner").fadeIn(2000).delay(3000).fadeOut(1500, function(){ partner_num++; partnerCycle(); }); } partnerCycle(); // </script>

    Read the article

  • GWT: Wrong Key Codes generated with a French keyboard

    - by Flueras Bogdan
    On any french keyboard(AZERTY) the dot char '.' is generated with (Shift + ;) combination while the percent char '%' is generated with (Shift + ù) combination So when I type one of the above combinations in a GWT text area to write '.' or ' %', the key codes generated for these events are KEY_DELETE in the former case and KEY_LEFT in the latter. TextArea txtArea = new TextArea(); txtArea.addKeyPressHandler(new KeyPressHandler() { public void onKeyPress(KeyPressEvent event) { switch (charCode) { case KeyCodes.KEY_LEFT: { // key code 37 System.out.write("KEY LEFT"); break; } case KeyCodes.KEY_DELETE: { // key code 46 System.out.write("DELETE"); break; } } Workaround: get charCode and do a character match: charCode = event.getCharCode(); if (charCode == '.') {...} else if (charCode == '%') {...} Is this a GWT bug? And is there a more elegant way to handle this ?

    Read the article

  • Returning control codes as JSON to a jquery ajax json call

    - by Graham
    I want to know if it is possible to return ascii control codes in JSON format from classic ASP to a jQuery ajax call. This is my jQuery call: $.ajax({ url: "/jsontest.asp", type: "POST", cache: false, dataType: "json", complete: function(data) { var o = $.parseJSON(data.responseText.toString()); }, error: function(data1, data2) { alert("There has been an error - please try again"); } }); This is my called page: {"val1":123,"val2","abcdef"} The above works fine, but if I change my called page to include ascii character 31 (1F) like so: {"val1":123,"val2","abc\x1Fdef"} then I get the alert in my error function. Can this be done, and if so, how please. Note: I'm using jQuery 1.7.1 and both IIS 6 and IIS 7 I have tried: \x1f, %1f, and \u001f

    Read the article

  • log the http response codes in the file

    - by dexter
    i have created HTTP::Request which looks like this: #!/usr/bin/perl require HTTP::Request; require LWP::UserAgent; require HTTP::Cookies; $request = HTTP::Request->new(GET => 'http://www.google.com/'); $ua = LWP::UserAgent->new; $cookie_jar = HTTP::Cookies->new(); $ua->cookie_jar($cookie_jar); $cookie_jar->set_cookie(0,'testCookie','cookieValue','/','http://www.google.com/',80,0,0,86400,0); $response = $ua->request($request); if($response->is_success){ print "sucess\n"; print $response->code; print "\n"; } else { print "fail\n"; die $response->code; print "\n"; } now, When i send Request: i want to log the http response codes in the file please help thank you

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Are QR codes guaranteed to work?

    - by Kiz
    Not sure if this will get closed as "not a real question" but I asked this on Superuser and it was closed for that very reason. We are thinking of implementing a QR code which will be sent to a number of users via an email which links through to a webpage. Now I'm aware that you can just Google 'QR codes' and there are a plethora of options that allow you to make a QR code. My question is thus; if we do go with this solution can we guarantee that it would work cross platform? I.e. on Android, iOS, Symbian etc? Once a QR code is generated will it work on ANY app on ANY platform? Thanks and apologies if this is not really a 'programming question' Thanks Kiran

    Read the article

  • Get access to a lot of iPhone and iPad Quality Source Codes for only $89

    - by Pixmator
    Hi developers and coming developers! We are happy to release this new concept from Pixmator.com, where you can get access to a lot of iPhone and iPad source codes for only $89. Start making a pro-developed application by these great application examples with is followed with a Source Code, so you can get everything out of it! These applications is present with a fully professionally designed graphic. The engine and the code is as well, as the graphic! It looks awesome. It is awesome. Take a look, it doesn't hurt anyone. Hope you guys like it! It will be available for purchase soon! Check out the link below: Check it out here!

    Read the article

  • How to make a C program that can run x86 hex codes

    - by Iowa15
    I have an array of hex codes that translate into assembly instructions and I want to create program in C that can execute these. unsigned char rawData[5356] = { 0x4C, 0x01, 0x0A, 0x00, 0x00, 0x00, 0x00, 0x00, 0x64, 0x0C, 0x00, 0x00, 0x3D, 0x00, 0x00, 0x00, 0x00, 0x00, 0x04, 0x01, 0x2E, 0x74, 0x65, 0x78, 0x74, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0xB4, 0x05, 0x00, 0x00, 0xA4, 0x01, 0x00, 0x00, 0x68, 0x08, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x61, 0x00, 0x00, 0x00, 0x20, 0x00, 0x30, 0x60, 0x2E, 0x64, 0x61, 0x74, 0x61, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x40, 0x00, 0x30, 0xC0, 0x2E, 0x62, 0x73, 0x73, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x04, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x80, 0x00, 0x30, 0xC0, 0x2F, 0x34, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x14, 0x00, 0x00, 0x00, 0x58, 0x07, 0x00, 0x00, 0x32, 0x0C, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x01, 0x00, 0x00, 0x00, 0x20, 0x10, 0x30, 0x60, 0x2F, 0x33, 0x32, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x14, 0x00, 0x00, 0x00, 0x6C, 0x07, 0x00, 0x00,...and so on

    Read the article

  • Replace multible data codes in a datafram with names

    - by Shabana
    I have a problem in replacing codes in a dataframe of 3890 observations. My dataframe has a character variable df$IJN which contains values from 1 to 27. I would like to replace these with meaningful data as follow If(1 OR 6 OR 10 OR 14 OR 18 OR 22 OR 26) should be replaced with UL. If(3 OR 7 OR 11 OR 15 OR 19 OR 23 OR 27) should be replaced with LL. If(4 OR 8 OR 12 OR 16 OR 20 OR 24) should be replaced with UR. If(5 OR 9 OR 13 OR 17 OR 21 OR 25) should be replaced with LR. (U,L,R,and L Refer to Upper, Lower, Right, and Left sites in the order) I thought of a for() with if() could not manage with it Also thought of df[which(df=="27")] ="LL" may work one by one not sure! Any help please. R v3.1 - Windows 7 E-H Shabana, Paris.

    Read the article

  • I lost my CSS Codes of my important Website, Why?

    - by Hooshkar
    Very weird, i had opened notepad ++ and working on my CSS codes for my website, suddenly my little niece unplugged the computer, when i re-start the computer and opened again the same CSS codes file in notepad ++, so all i am seeing is "NULL NULL NULL NULL NULL NULL NULL" there is no codes, all lost. I opened the same CSS codes file in other editors and its all empty no codes.. is there a way to fix it, because it was my hard work. and what can be the cause? Thank you.

    Read the article

  • How to initialize static const char array for ASCII codes [C++]

    - by Janney
    I want to initialize a static const char array with ASCII codes in a constructor, here's my code: class Card { public: Suit(void) { static const char *Suit[4] = {0x03, 0x04, 0x05, 0x06}; // here's the problem static const string *Rank[ 13 ] = {'A', '2', '3', '4', '5', '6', '7', '8', '9', '10', 'J', 'Q', 'K'}; // and here. } However i got a whole lot of errors stating that 'initializing' : cannot convert from 'char' to 'const std::string *' 'initializing' : cannot convert from 'int' to 'const std::string *' please help me! Thank you so much.

    Read the article

  • Generic Text Only printer driver mangles control codes

    - by Terry
    If an escape character (or most other characters < 0x20) is sent to the generic / text only printer it gets printed as a period. Using the code in the WinDDK is it possible to 'correct' this behaviour so that it passes it through unmodified? The general scenario for this is that some application ('user app') outputs a document to a windows printer. My application requires this data in plain text form and so what I do is run a generic / text only printer that talks to a virtual com port. This generally works fine except where the 'user app' outputs binary data to the print queue without using the correct mechanism (which seems to work fine on some printer drivers, such as the Epson POS ones, but not the generic / text only one). I've tried changing the print processor selection without success and also tried looking at the gtt files to see if I could readily map in these characters as though they were printable, but the minidriver tool won't let me do that. Any suggestions?

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • magento - multilingual site + Add store codes to url - want to show flag icons

    - by Mustapha George
    I want to have a multi-language magento site use a flag image instead of a language selector box for user to select language of page. There is a nice article on this at http://www.atwix.com/magento/replace-language-selector-flag-icons/ Only issue is that we use "Add store codes to url" option. I hacked this code, but it can use some refinement and make it more Magento looking. <?php if(count($this->getStores())>1): ?> <div class="form-language"> <div class="langs-wrapper"> <?php foreach ($this->getStores() as $_lang): ?> <?php if ($_lang->getCode() != 'default'): ?> <? $base_url = Mage::getBaseUrl(); // remove language in base url $base_url = str_replace('/en/' , "" , $base_url); $base_url = str_replace('/fr/' , "" , $base_url); $current_url = $this->helper('core/url')->getCurrentUrl(); // take out base url and language code $rest_of_url = str_replace($base_url , "" , $current_url); $rest_of_url = str_replace('/en/' , "" , $rest_of_url); $rest_of_url = str_replace('/fr/' , "" , $rest_of_url); // assmble new url $new_url = $base_url . '/' . $_lang->getCode() . '/' . $rest_of_url; ?> <a class="lang-flag" href="<?php echo $new_url ;?>"><img src="<?php echo $this->getSkinUrl('images/flags/' . $_lang->getCode() . '.png');?>" alt=""></a> <?php endif;?> <?php endforeach;?> </div> </div> <?php endif;?>

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Organizing multiple embed codes with jQuery

    - by Nimbuz
    I have several embed codes on my website, for example: Embed Code #1: <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/f8Lp2ssd5A9ErAc&hl=en_US&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/f8Lp2A9ErAc&hl=en_US&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="480" height="385"></embed></object> Embed Code #2: <script type="text/javascript"> _qoptions={ qacct:"p-3asdb5E0g6" }; </script> <script type="text/javascript" src="http://edge.quantserve.com/quant.js"></script> <noscript> <a href="http://www.quantcast.com/p-3asdb5E0g6" target="_blank"><img src="http://pixel.quantserve.com/pixel/p-3asdb5E0g6.gif" style="display: none;" border="0" height="1" width="1" alt="Quantcast"/></a> </noscript> and so on.. How do organize them and separate them into an external single js file to keep the markup clean? Thanks for your help!

    Read the article

  • sorting a gridview alphabetically when columns are codes

    - by nat
    hi there i have a gridview populated by a Web Service search function. some of the columns in the grid are templatefields, because the values coming back from the search (in a datatable) are ids - i then use these ids to lookup the values when the rowdatabound event is triggered and populate a label or some such. this means that my sorting function for these id/lookup columns sorts by the ids rather than the textual value that i have looked up and actually populated the grid with (although i do put the ids in the grids datakeys). what i want to do is top be able to sort by the looked up textual value rather than the codes for these particular columns. what i was going to do to get around this was to when the datatable comes back from the search, adding more columns the textual values and doing all the looking up then, thus being able to sort directly from the manually added columns. is there another way to do this? as that approach seems like a bit of a bodge. although i guess it does remove having to do the looking up in the rowdatabound event.... my sorting function works by sticking the datatable in the session and on each bind grabbing the sort column and binding the gridview to a DataView with the sort attribute set to the column - and the direction. thanks nat

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • What are the IR codes the new Apple Remote (alu) uses?

    - by index
    I would like to clone the new Apple Remote (infrared, second generation, aluminium) just for fun with a microcontroller. Most codes of the previous model can be found in the LIRC remote control database (all except the key combinations menu + <<,play, which unpair, change ID, pair the remote. I also don't know which bit encodes the battery status. It uses a modified 32 bit NEC protocol (reverse LIRC codes bytewise). But the new Apple remote uses two additional codes for the play and the new select button. I don't have a mac, so I can't brute force test codes either ;-) So if someone possesses such a remote and the ability of recording those two new buttons and three combinations I'd really appreciate it. If you can't run LIRC (or it gets confused by the new codes) and you don't have an oscilloscope or logic analyser, maybe you could hook up a photo diode to your sound input and record the codes with Audacity? Just hit record, hit each button and combo a few times, hit stop, upload the uncompressed WAV file to a sharing site, done. That'd be great!

    Read the article

< Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >