Search Results

Search found 523 results on 21 pages for 'invocation'.

Page 16/21 | < Previous Page | 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • Struts 2 discard cache header

    - by Dewfy
    I have strange discarding behavior of struts2 while setting cache option for my image. I'm trying to put image from db to be cached on client side To render image I use ( http://struts.apache.org/2.x/docs/how-can-we-display-dynamic-or-static-images-that-can-be-provided-as-an-array-of-bytes.html ) where special result type render as follow: public void execute(ActionInvocation invocation) throws Exception { ...//some preparation HttpServletResponse response = ServletActionContext.getResponse(); HttpServletRequest request = ServletActionContext.getRequest(); ServletOutputStream os = response.getOutputStream(); try { byte[] imageBytes = action.getImage(); response.setContentType("image/gif"); response.setContentLength(imageBytes.length); //I want cache up to 10 min Date future = new Date(((new Date()).getTime() + 1000 * 10*60l)); ; response.addDateHeader("Expires", future.getTime()); response.setHeader("Cache-Control", "max-age=" + 10*60 + ""); response.addHeader("cache-Control", "public"); response.setHeader("ETag", request.getRequestURI()); os.write(imageBytes); } catch(Exception e) { response.sendError(HttpServletResponse.SC_NOT_FOUND); } os.flush(); os.close(); } But when image is embedded to page it is always reloaded (Firebug shows code 200), and neither Expires, nor max-age are presented in header Host localhost:9090 Accept image/png,image/*;q=0.8,*/*;q=0.5 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 300 Connection keep-alive Referer http://localhost:9090/web/result?matchId=1 Cookie JSESSIONID=4156BEED69CAB0B84D950932AB9EA1AC; If-None-Match /web/_srv/teamcolor Cache-Control max-age=0 I have no idea why it is dissapered, may be problem in url? It is forms with parameter: http://localhost:9090/web/_srv/teamcolor?loginId=3

    Read the article

  • Axis2 SOAP Envelope Header Information

    - by BigZig
    I'm consuming a web service that places an authentication token in the SOAP envelope header. It appears (through looking at the samples that came with the WS WSDL) that if the stub is generated in .NET, this header information is exposed through a member variable in the stub class. However, when I generate my Axis2 java stub using WSDL2Java it doesn't appear to be exposed anywhere. What is the correct way to extract this information from the SOAP envelope header? WSDL: http://www.vbar.com/zangelo/SecurityService.wsdl C# Sample: using System; using SignInSample.Security; // web service using SignInSample.Document; // web service namespace SignInSample { class SignInSampleClass { [STAThread] static void Main(string[] args) { // login to the Vault and set up the document service SecurityService secSvc = new SecurityService(); secSvc.Url = "http://localhost/AutodeskDM/Services/SecurityService.asmx"; secSvc.SecurityHeaderValue = new SignInSample.Security.SecurityHeader(); secSvc.SignIn("Administrator", "", "Vault"); DocumentServiceWse docSvc = new DocumentServiceWse(); docSvc.Url = "http://localhost/AutodeskDM/Services/DocumentService.asmx"; docSvc.SecurityHeaderValue = new SignInSample.Document.SecurityHeader(); docSvc.SecurityHeaderValue.Ticket = secSvc.SecurityHeaderValue.Ticket; docSvc.SecurityHeaderValue.UserId = secSvc.SecurityHeaderValue.UserId; } } } The sample illustrates what I'd like to do. Notice how the secSvc instance has a SecurityHeaderValue member variable that is populated after a successful secSvc.SignIn() invocation. Here's some relevant API documentation regarding the SignIn method: Although there is no return value, a successful sign in will populate the SecurityHeaderValue of the security service. The SecurityHeaderValue information is then used for other web service calls.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Can anyone get app-engine plugin working with Grails on mac os x?

    - by tim
    I have been trying for 4 days to get app-engine and grails working together on my mac to no avail. I am using latest groovy/grails and appengine sdk versions. Im following the app-engine plugin step by step on the grails site.. http://grails.org/plugin/app-engine Groovy Version: 1.7.1 JVM: 1.5.0_22 Grails 1.3.0.RC1 echo $APPENGINE_HOME reveals /Users/markstim/appengine-java-sdk-1.3.2 I perform the following steps 1. grails create-app myapp 2. cd myapp; grails list-plugins reveals hibernate 1.3.0.RC1 -- Hibernate for Grails tomcat 1.3.0.RC1 -- Apache Tomcat plugin for Grails add the following line to Config.groovy google.appengine.application="myapp" install the plugin for app-engine grails install-plugin app-engine and answer 'jpa' when asked (no errors yet) installed plugins list now looks like app-engine 0.8.9 -- Grails AppEngine plugin gorm-jpa 0.7.1 -- GORM-JPA Plugin then grails run-app and get this error as the server is coming up... [java] WARNING: Nested in org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'pluginManager' defined in ServletContext resource [/WEB-INF/applicationContext.xml]: Invocation of init method failed; nested exception is org.codehaus.groovy.grails.exceptions.NewInstanceCreationException: Could not create a new instance of class [GormJpaGrailsPlugin]!: [java] java.lang.NoClassDefFoundError: org.grails.jpa.JpaPluginSupport then if i navigate to localhost:8080 I get HTTP ERROR: 503 Problem accessing /myapp. Reason: SERVICE_UNAVAILABLE Powered by Jetty://

    Read the article

  • Java: Typecasting to Generics

    - by bguiz
    This method that uses method-level generics, that parses the values from a custom POJO, JXlistOfKeyValuePairs (which is exactly that). The only thing is that both the keys and values in JXlistOfKeyValuePairs are Strings. This method wants to taken in, in addition to the JXlistOfKeyValuePairs instance, a Class<T> that defines which data type to convert the values to (assume that only Boolean, Integer and Float are possible). It then outputs a HashMap with the specified type for the values in its entries. This is the code that I have got, and it is obviously broken. private <T extends Object> Map<String, T> fromListOfKeyValuePairs(JXlistOfKeyValuePairs jxval, Class<T> clasz) { Map<String, T> val = new HashMap<String, T>(); List<Entry> jxents = jxval.getEntry(); T value; String str; for (Entry jxent : jxents) { str = jxent.getValue(); value = null; if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } else if (clasz.isAssignableFrom(Float.class)) { value = (T)(Float.parseFloat(str)); } else { logger.warn("Unsupported value type encountered in key-value pairs, continuing anyway: " + clasz.getName()); } val.put(jxent.getKey(), value); } return val; } This is the bit that I want to solve: if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } I get: Inconvertible types required: T found: Boolean Also, if possible, I would like to be able to do this with more elegant code, avoiding Class#isAssignableFrom. Any suggestions? Sample method invocation: Map<String, Boolean> foo = fromListOfKeyValuePairs(bar, Boolean.class);

    Read the article

  • Efficient database access when dealing with multiple abstracted repositories

    - by Nathan Ridley
    I want to know how most people are dealing with the repository pattern when it involves hitting the same database multiple times (sometimes transactionally) and trying to do so efficiently while maintaining database agnosticism and using multiple repositories together. Let's say we have repositories for three different entities; Widget, Thing and Whatsit. Each repository is abstracted via a base interface as per normal decoupling design processes. The base interfaces would then be IWidgetRepository, IThingRepository and IWhatsitRepository. Now we have our business layer or equivalent (whatever you want to call it). In this layer we have classes that access the various repositories. Often the methods in these classes need to do batch/combined operations where multiple repositories are involved. Sometimes one method may make use of another method internally, while that method can still be called independently. What about, in this scenario, when the operation needs to be transactional? Example: class Bob { private IWidgetRepository _widgetRepo; private IThingRepository _thingRepo; private IWhatsitRepository _whatsitRepo; public Bob(IWidgetRepository widgetRepo, IThingRepository thingRepo, IWhatsitRepository whatsitRepo) { _widgetRepo = widgetRepo; _thingRepo= thingRepo; _whatsitRepo= whatsitRepo; } public void DoStuff() { _widgetRepo.StoreSomeStuff(); _thingRepo.ReadSomeStuff(); _whatsitRepo.SaveSomething(); } public void DoOtherThing() { _widgetRepo.UpdateSomething(); DoStuff(); } } How do I keep my access to that database efficient and not have a constant stream of open-close-open-close on connections and inadvertent invocation of MSDTS and whatnot? If my database is something like SQLite, standard mechanisms like creating nested transactions are going to inherently fail, yet the business layer should not have to be concerning itself with such things. How do you handle such issues? Does ADO.Net provide simple mechanisms to handle this or do most people end up wrapping their own custom bits of code around ADO.Net to solve these types of problems?

    Read the article

  • How to handle build rule with unknown targets in OMake when target list generator is built

    - by Michael E
    I have a project which uses OMake for its build system, and I am trying to handle a rather tough corner case. I have some definition files and a tool which can take these definition files and create GraphViz files. There are two problems, though: Each definition file can produce multiple graphs, and the list of graphs it can produce is encoded in the file. My dump tool does have a -list option which lists all the graphs a definition file will produce. This dump tool is built in the source tree. I want this list available in the OMakefile so I can use other rules to convert the DOT files to SVG, and have a phony target depend on all the SVGs (goal: a single build command which builds SVG descriptions of all my graphs). If I only had the first problem, it would be easy - I would run the tool to build a list, and then use that list to build a target which invokes the dumper to output the GraphViz files. However, I am rather stuck on forcing the dump tool to be built before it is needed. If this were make, I would just run make recursively to build the dump tool. OMake does not allow recursive invocation, however, and the build function is only usable from osh. Any suggestions for a good solution to this problem?

    Read the article

  • Is it possible to spoof or reuse VIEWSTATE or detect if it is protected from modification?

    - by Peter Jaric
    Question ASP and ASP.NET web applications use a value called VIEWSTATE in forms. From what I understand, this is used to persist some kind of state on the client between requests to the web server. I have never worked with ASP or ASP.NET and need some help with two questions (and some sub-questions): 1) Is it possible to programmatically spoof/construct a VIEWSTATE for a form? Clarification: can a program look at a form and from that construct the contents of the base64-encoded VIEWSTATE value? 1 a) Or can it always just be left out? 1 b) Can an old VIEWSTATE for a particular form be reused in a later invocation of the same form, or would it just be luck if that worked? 2) I gather from http://msdn.microsoft.com/en-us/library/ms972976.aspx#viewstate_topic12 that it is possible to turn on security so that the VIEWSTATE becomes secure from spoofing. Is it possible for a program to detect that a VIEWSTATE is safeguarded in such a way? 2 a) Is there a one-to-one mapping between the occurrence of EVENTVALIDATION values and secure VIEWSTATEs? Regarding 1) and 2), if yes, can I have a hint about how I would do that? For 2) I am thinking I could base64-decode the value and search for a string that always is found in unencrypted VIEWSTATEs. "First:"? Something else? Background I have made a small tool for detecting and exploiting so called CSRF vulnerabilities. I use it to quickly make proof of concepts of such vulnerabilities that I send to the affected site owners. Quite often I encounter these forms with a VIEWSTATE, and these I don't know if they are secure or not. Edit 1: Clarified question 1 somewhat. Edit 2: Added text in italics.

    Read the article

  • My kernel only works in block (0,0)

    - by ZeroDivide
    I am trying to write a simple matrixMultiplication application that multiplies two square matrices using CUDA. I am having a problem where my kernel is only computing correctly in block (0,0) of the grid. This is my invocation code: dim3 dimBlock(4,4,1); dim3 dimGrid(4,4,1); //Launch the kernel; MatrixMulKernel<<<dimGrid,dimBlock>>>(Md,Nd,Pd,Width); This is my Kernel function __global__ void MatrixMulKernel(int* Md, int* Nd, int* Pd, int Width) { const int tx = threadIdx.x; const int ty = threadIdx.y; const int bx = blockIdx.x; const int by = blockIdx.y; const int row = (by * blockDim.y + ty); const int col = (bx * blockDim.x + tx); //Pvalue stores the Pd element that is computed by the thread int Pvalue = 0; for (int k = 0; k < Width; k++) { Pvalue += Md[row * Width + k] * Nd[k * Width + col]; } __syncthreads(); //Write the matrix to device memory each thread writes one element Pd[row * Width + col] = Pvalue; } I think the problem may have something to do with memory but I'm a bit lost. What should I do to make this code work across several blocks?

    Read the article

  • Passing objects across Appdomains

    - by MUSTAQ
    My issue is similar to the one posted in "http://stackoverflow.com/questions/981773/moving-objects-across-appdomains-in-net". In one of my application, I am creating a separate appdomain. I need to create an instance of a class (Note: this class is derived by MarshalByRefObject) in my parent domain and invoke a MethodA in that instance. This instance is created using "CreateInstanceAndUnwrap". The problem is that this MethodA takes objects of type class as an argument. These objects are not created in the MethodB where i created the appdomain. It was passed as an argument to the MethodB where i create the appdomain. So is it necessary to create a new instance of these objects using "CreateInstanceAndUnwrap" before passing it to the created domain. Not doing this gives me an error in the created domain mentioning that "MyClass object has no attribute foo" during some invocation. Please let me know how to pass the objects across appdomains and execute the method. My statements might be confusing, please let me know for any specific details required.

    Read the article

  • Strange befaviour of spring transaction support for JPA + Hibernate +@Transactional annotation

    - by abovesun
    I found out really strange behavior on relatively simple use case, probably I can't understand it because of not deep knowledges of spring @Transactional nature, but this is quite interesting. I have simple User dao that extends spring JpaDaoSupport class and contains standard save method: @Transactional public User save(User user) { getJpaTemplate().persist(user); return user; } If was working fine until I've add new method to same class: User getSuperUser(), this method should return user with isAdmin == true, and if there is no super user in db, method should create one. Thats how it was looking like: public User createSuperUser() { User admin = null; try { admin = (User) getJpaTemplate().execute(new JpaCallback() { public Object doInJpa(EntityManager em) throws PersistenceException { return em.createQuery("select u from UserImpl u where u.admin = true").getSingleResult(); } }); } catch (EmptyResultDataAccessException ex) { User admin = new User('login', 'password'); admin.setAdmin(true); save(admin); // THIS IS THE POINT WHERE STRANGE THING COMING OUT } return admin; } As you see code is strange forward and I was very confused when found out that no transaction was created and committed on invocation of save(admin) method and no new user wasn't actually created despite @Transactional annotation. In result we have situation: when save() method invokes from outside of UserDAO class - @Transactional annotation counted and user successfully created, but if save() invokes from inside of other method of the same dao class - @Transactional annotation ignored. Here how I was change save() method to force it always create transaction. public User save(User user) { getJpaTemplate().execute(new JpaCallback() { public Object doInJpa(EntityManager em) throws PersistenceException { em.getTransaction().begin(); em.persist(user); em.getTransaction().commit(); return null; } }); return user; } As you see I manually invoke begin and commit. Any ideas?

    Read the article

  • Java constructor using generic types

    - by Beer Me
    I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method breweryMethod() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // breweryMethod() is an instance method // of Brewery, of which <T> is a subclass (right?) c.breweryMethod(); // "The method breweryMethod() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void brewerySubClassMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

    Read the article

  • Java constructor using generic types

    - by user37903
    I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method initBreweryFromObject() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // initBreweryFromObject() is an instance method // of Brewery, of which <T> is a subclass (right?) c.initBreweryFromObject(); // "The method initBreweryFromObject() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void androidMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

    Read the article

  • are there requirements for Struts setters beyond variable name matching?

    - by slk
    I have a model-driven Struts Web action: public class ModelDrivenAction<T extends Object> implements ModelDriven<T>, Preparable { protected Long id; protected T model; @Override public void prepare() {} public void setId(Long id) { this.id = id; } @Override public T getModel() { return model; } public void setModel(T model) { this.model = model; } } I have another action which is not currently model-driven: public class OtherAction implements Preparable { private ModelObj modelObj; private Long modelId; @Override public void prepare() { modelObj = repoService.retrieveModelById(modelId); } public void setModelId(Long modelId) { this.modelId = modelId; } } I wish to make it so, and would like to avoid having to track down all the instances in JavaScript where the action is passed a "modelId" parameter instead of "id" if at all possible. I thought this might work, so either modelId or id could be passed in: public class OtherAction extends ModelDrivenAction<ModelObj> { @Override public void prepare() { model = repoService.retrieveModelById(id); } public void setModelId(Long modelId) { this.id = modelId; } } However, server/path/to/other!method?modelId=123 is failing to set id. I thought so long as a setter matched a parameter name the Struts interceptor would call it on action invocation. Am I missing something here?

    Read the article

  • Trouble swapping values as keys in generic java BST class

    - by user1729869
    I was given a generic binary search tree class with the following declaration: public class BST<K extends Comparable<K>, V> I was asked to write a method that reverses the BST such that the values become the keys and keys become values. When I call the following method (defined in the class given) reverseDict.put(originalDict.get(key), key); I get the following two error messages from Netbeans: Exception in thread "main" java.lang.RuntimeException: Uncompilable source code - Erroneous sym type: BST.put And also: no suitable method found for put(V,K) method BST.put(BST<K,V>.Node,K,V) is not applicable (actual and formal argument lists differ in length) method BST.put(K,V) is not applicable (actual argument V cannot be converted to K by method invocation conversion) where V,K are type-variables: V extends Object declared in method <K,V>reverseBST(BST<K,V>) K extends Comparable<K> declared in method <K,V>reverseBST(BST<K,V>) From what the error messages are telling me, since my values do not extend Comparable I am unable to use them as keys. If I am right, how can I get around that without changing the class given (maybe a cast)?

    Read the article

  • .NET 4 ... Parallel.ForEach() question

    - by CirrusFlyer
    I understand that the new TPL (Task Parallel Library) has implemented the Parallel.ForEach() such that it works with "expressed parallelism." Meaning, it does not guarantee that your delegates will run in multiple threads, but rather it checks to see if the host platform has multiple cores, and if true, only then does it distribute the work across the cores (essentially 1 thread per core). If the host system does not have multiple cores (getting harder and harder to find such a computer) then it will run your code sequenceally like a "regular" foreach loop would. Pretty cool stuff, frankly. Normally I would do something like the following to place my long running operation on a background thread from the ThreadPool: ThreadPool.QueueUserWorkItem( new WaitCallback(targetMethod), new Object2PassIn() ); In a situation whereby the host computer only has a single core does the TPL's Parallel.ForEach() automatically place the invocation on a background thread? Or, should I manaully invoke any TPL calls from a background thead so that if I am executing from a single core computer at least that logic will be off of the GUI's dispatching thread? My concern is if I leave the TPL in charge of all this I want to ensure if it determines it's a single core box that it still marshalls the code that's inside of the Parallel.ForEach() loop on to a background thread like I would have done, so as to not block my GUI. Thanks for any thoughts or advice you may have ...

    Read the article

  • Multithreading for loop while maintaining order

    - by David
    I started messing around with multithreading for a CPU intensive batch process I'm running. Essentially I'm trying to condense multiple single page tiffs into single PDF documents. This works fine with a foreach loop or standard iteration but can be very slow for several 100 page documents. I tried the following based on a some examples I found to use multithreading and it has significant performance improvements however it obliterates the page order instead of 1,2,3,4 it will be 1,3,4,2,6,5 on what thread completes first. My question is how would I utilize this technique while maintaining the page order and if I can will it negate the performance benefit of the multithreading? Thank you in advance. PdfDocument doc = new PdfDocument(); string mail = textBox1.Text; string[] split = mail.Split(new string[] { Environment.NewLine }, StringSplitOptions.None); int counter = split.Count(); // Source must be array or IList. var source = Enumerable.Range(0, 100000).ToArray(); // Partition the entire source array. var rangePartitioner = Partitioner.Create(0, counter); double[] results = new double[counter]; // Loop over the partitions in parallel. Parallel.ForEach(rangePartitioner, (range, loopState) => { // Loop over each range element without a delegate invocation. for (int i = range.Item1; i < range.Item2; i++) { f_prime = split[i].Replace(" " , ""); PdfPage page = doc.AddPage(); XGraphics gfx = XGraphics.FromPdfPage(page); XImage image = XImage.FromFile(f_prime); double x = 0; gfx.DrawImage(image, x, 0); } });

    Read the article

  • Using external SOAP service in Workflow service

    - by whirlwin
    I am using the .NET 4 framework and have made a WCF Workflow Service Application. I want to use a SOAP web service (.NET 3.5) I have running in another instance of VS. The only method that is exposed is the following: [WebMethod] public string Reverse(string input) { char[] chars = input.ToCharArray(); Array.Reverse(chars); return new string(chars); } I have used the following steps to add the service in my Workflow: Add Service Reference Provided the WSDL (the operation shows in the Operations box as expected) Clicked OK Build the solution to ensure that the service shows in my toolbox Drag the service from the toolbox into the workflow However, when I look at the properties of the service in the workflow, there is no way to specify the input argument or where to store the result of the invocation of the service. I only have the option of specifying some obscure parameters such as Body:InArgument<ReverseRequestBody and outBody:OutArgument<ReverseResponseBody (none of which are strings). Here is a screenshot depicting the properties of the service in the workflow: My question is therefore: Is it possible at all to use the SOAP service by specifying a string as the input argument (like it is meant to be used), and also assign the result to a workflow variable?

    Read the article

  • Dispose, when is it called?

    - by Snake
    Consider the following code: namespace DisposeTest { using System; class Program { static void Main(string[] args) { Console.WriteLine("Calling Test"); Test(); Console.WriteLine("Call to Test done"); } static void Test() { DisposeImplementation di = new DisposeImplementation(); } } internal class DisposeImplementation : IDisposable { ~DisposeImplementation() { Console.WriteLine("~ in DisposeImplementation instance called"); } public void Dispose() { Console.WriteLine("Dispose in DisposeImplementation instance called"); } } } The Dispose just never get's called, even if I put a wait loop after the Test(); invocation. So that quite sucks. I want to write a class that is straightforward and very easy to use, to make sure that every possible resource is cleaned up. I don't want to put that responsibilty to the user of my class. Possible solution: use using, or call Dispose myself(basicly the same). Can I force the user to use a using? Or can I force the dispose to be called? Calling GC.Collect(); after Test(); doesn't work either. Putting di to null doesn't invoke Dispose either. The Deconstructor DOES work, so the object get's deconstructed when it exits Test()

    Read the article

  • iPhone application purchase verification -- possible?

    - by Sedate Alien
    The iPhone 3.0 SDK's StoreKit.framework provides support for in-app purchases to give the user additional content, functionality and so on. It is possible for an app to send the transactionReceipt property of SKPaymentTransaction objects to the developer's server for verification of successful purchasing before granting service. Is there any analogous SDK to verify the initial application purchase itself? A developer that wishes for their server to only provide services to genuine applications (i.e. not pirated) without using IAP could do so by verifying the application in this manner, e.g. ensure that only users with the correct transactionReceipt are catered for. I understand that this approach would still be vulnerable to replay attacks; a dedicated group of pirates could share a valid transactionReceipt. However, my server provides a consumable service to users, i.e. once they've connected and done the work, it needn't work a second time so replay attacks are nullified. The service that my app provides is relatively niche. I could distribute it on the App Store as a free application that requires at least one IAP to do anything useful, but I am lead to believe that this would be a very unpopular move among users as it would be considered misleading. If I distribute it as a paid app, I do not know how to ensure that only genuine apps can access the webservice. This is important as every invocation of the webservice costs me money! What are my options?

    Read the article

  • Java reflection Method invocations yield result faster than Fields?

    - by omerkudat
    I was microbenchmarking some code (please be nice) and came across this puzzle: when reading a field using reflection, invoking the getter Method is faster than reading the Field. Simple test class: private static final class Foo { public Foo(double val) { this.val = val; } public double getVal() { return val; } public final double val; // only public for demo purposes } We have two reflections: Method m = Foo.class.getDeclaredMethod("getVal", null); Field f = Foo.class.getDeclaredField("val"); Now I call the two reflections in a loop, invoke on the Method, and get on the Field. A first run is done to warm up the VM, a second run is done with 10M iterations. The Method invocation is consistently 30% faster, but why? Note that getDeclaredMethod and getDeclaredField are not called in the loop. They are called once and executed on the same object in the loop. I also tried some minor variations: made the field non-final, transitive, non-public, etc. All of these combinations resulted in statistically similar performance. Edit: This is on WinXP, Intel Core2 Duo, Sun JavaSE build 1.6.0_16-b01, running under jUnit4 and Eclipse.

    Read the article

  • How to use strtok in C properly so there is no memory leak?

    - by user246392
    I am somewhat confused by what happens when you call strtok on a char pointer in C. I know that it modifies the contents of the string, so if I call strtok on a variable named 'line', its content will change. Assume I follow the bellow approach: void function myFunc(char* line) { // get a pointer to the original memory block char* garbageLine = line; // Do some work // Call strtok on 'line' multiple times until it returns NULL // Do more work free(garbageLine); } Further assume that 'line' is malloced before it is passed to myFunc. Am I supposed to free the original string after using strtok or does it do the job for us? Also, what happens if 'line' is not malloced and I attempt to use the function above? Is it safer to do the following instead? (Assume the programmer won't call free if he knows the line is not malloced) Invocation char* garbageLine = line; myFunc(line); free(garbageLine); Function definition void function myFunc(char* line) { // Do some work // Call strtok on 'line' multiple times until it returns NULL // Do more work }

    Read the article

  • Some VS 2010 RC Updates (including patches for Intellisense and Web Designer fixes)

    - by ScottGu
    [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] We are continuing to make progress on shipping Visual Studio 2010.  I’d like to say a big thank you to everyone who has downloaded and tried out the VS 2010 Release Candidate, and especially to those who have sent us feedback or reported issues with it. This data has been invaluable in helping us find and fix remaining bugs before we ship the final release. Last month I blogged about a patch we released for the VS 2010 RC that fixed a bad intellisense crash issue.  This past week we released two additional patches that you can download and apply to the VS 2010 RC to immediately fix two other common issues we’ve seen people run into: Patch that fixes crashes with Tooltip invocation and when hovering over identifiers The Visual Studio team recently released a second patch that fixes some crashes we’ve seen when tooltips are displayed – most commonly when hovering over an identifier to view a QuickInfo tooltip. You can learn more about this issue from this blog post, and download and apply the patch here. Patch that fixes issues with the Web Forms designer not correctly adding controls to the auto-generated designer files The Visual Web Developer team recently released a patch that fixes issues where web controls are not correctly added to the .designer.cs file associated with the .aspx file – which means they can’t be programmed against in the code-behind file.  This issue is most commonly described as “controls are not being recognized in the code-behind” or “editing existing .aspx files regenerates the .aspx.designer.(vb or cs) file and controls are now missing” or “I can’t embed controls within the Ajax Control Toolkit TabContainer or the <asp:createuserwizard> control”. You can learn more about the issue here, and download the patch that fixes it here. Common Cause of Intellisense and IDE sluggishness on Windows XP, Vista, Win Server 2003/2008 systems Over the last few months we’ve occasionally seen reports of people seeing tremendous slowness when typing and using intellisense within VS 2010 despite running on decent machines.  It took us awhile to track down the cause – but we have found that the common culprit seems to be that these machines don’t have the latest versions of the UIA (Windows Automation) component installed. UIA 3 ships with Windows 7, and is a recommended Windows Update patch on XP and Vista (which is why we didn’t see the problem in our tests – since our machines are patched with all recommended updates).  Many systems (especially on XP) don’t automatically install recommended updates, though, and are running with older versions of UIA. This can cause significant performance slow-downs within the VS 2010 editor when large lists are displayed (for example: with intellisense). If you are running on Windows XP, Vista, or Windows Server 2003 or 2008 and are seeing any performance issues with the editor or IDE, please install the free UIA 3 update that can be downloaded from this page.  If you scroll down the page you’ll find direct links to versions for each OS. Note that we are making improvements to the final release of VS 2010 so that we don’t have big perf issues when UIA 3 isn’t installed – and we are also adding a message within the IDE that will warn you if you don’t have UIA 3 installed and accessibility is activated. Improved Text Rendering with WPF 4 and VS 2010 We recently made some nice changes to WPF 4 which improve the text clarity and text crispness over what was in the VS 2010/.NET 4 Release Candidate.  In particular these changes improve scenarios where you have a dark background with light text. You can learn more about these improvements in this WPF Team blog post.  These changes will be in the final release of VS 2010 and .NET 4. Hope this helps, Scott

    Read the article

  • Asp.NET ReportViewer “report execution has expired or cannot be found” error when using session state service or SQL Server session state

    - by dotneteer
    We encountered an error like: ReportServerException: The report execution x5pl2245iwvvq055khsxzlj5 has expired or cannot be found. (rsExecutionNotFound)]    Microsoft.Reporting.WebForms.ServerReportSoapProxy.OnSoapException(SoapException e) +72    Microsoft.Reporting.WebForms.Internal.Soap.ReportingServices2005.Execution.ProxyMethodInvocation.Execute(RSExecutionConnection connection, ProxyMethod`1 initialMethod, ProxyMethod`1 retryMethod) +428    Microsoft.Reporting.WebForms.Internal.Soap.ReportingServices2005.Execution.RSExecutionConnection.GetExecutionInfo() +133    Microsoft.Reporting.WebForms.ServerReport.EnsureExecutionSession() +197    Microsoft.Reporting.WebForms.ServerReport.LoadViewState(Object viewStateObj) +256    Microsoft.Reporting.WebForms.ServerReport..ctor(SerializationInfo info, StreamingContext context) +355 [TargetInvocationException: Exception has been thrown by the target of an invocation.]    System.RuntimeMethodHandle._SerializationInvoke(Object target, SignatureStruct&amp; declaringTypeSig, SerializationInfo info, StreamingContext context) +0    System.Reflection.RuntimeConstructorInfo.SerializationInvoke(Object target, SerializationInfo info, StreamingContext context) +108    System.Runtime.Serialization.ObjectManager.CompleteISerializableObject(Object obj, SerializationInfo info, StreamingContext context) +273    System.Runtime.Serialization.ObjectManager.FixupSpecialObject(ObjectHolder holder) +49    System.Runtime.Serialization.ObjectManager.DoFixups() +223    System.Runtime.Serialization.Formatters.Binary.ObjectReader.Deserialize(HeaderHandler handler, __BinaryParser serParser, Boolean fCheck, Boolean isCrossAppDomain, IMethodCallMessage methodCallMessage) +188    System.Runtime.Serialization.Formatters.Binary.BinaryFormatter.Deserialize(Stream serializationStream, HeaderHandler handler, Boolean fCheck, Boolean isCrossAppDomain, IMethodCallMessage methodCallMessage) +203    System.Web.Util.AltSerialization.ReadValueFromStream(BinaryReader reader) +788    System.Web.SessionState.SessionStateItemCollection.ReadValueFromStreamWithAssert() +55    System.Web.SessionState.SessionStateItemCollection.DeserializeItem(String name, Boolean check) +281    System.Web.SessionState.SessionStateItemCollection.DeserializeItem(Int32 index) +110    System.Web.SessionState.SessionStateItemCollection.get_Item(Int32 index) +17    System.Web.SessionState.HttpSessionStateContainer.get_Item(Int32 index) +13    System.Web.Util.AspCompatApplicationStep.OnPageStartSessionObjects() +71    System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +2065 This error occurs long after the report viewer page has closed. It occurs to any asp.net page in the application, rendering the entire application unusable until the user gets a new session. The cause of the problem is that the ReportViewer uses session state. When a page retrieves session from any out-of-state session, the session variable of type Microsoft.Reporting.WebForms.ReportHierarchy is deserialized from the session storage. The deserialization could cause the object to connect to the report server when the report is no longer available. The solution is simple but not pretty. We need to clean up the session variable when the report viewer page is closed. One way is to add some Javascript to the page to handle the window.onunload event. In the event handler, call a web service to clean up the session variable. The name of the session variable appears to be randomly generated. So we need to loop through the session variable to find a variable of the type Microsoft.Reporting.WebForms.ReportHierarchy. Microsoft has implemented pinging between the report viewer and the report server to keep the report alive on the server when the report viewer is up; I hope they will go one step further to take care of this problem.

    Read the article

  • Clone a Hard Drive Using an Ubuntu Live CD

    - by Trevor Bekolay
    Whether you’re setting up multiple computers or doing a full backup, cloning hard drives is a common maintenance task. Don’t bother burning a new boot CD or paying for new software – you can do it easily with your Ubuntu Live CD. Not only can you do this with your Ubuntu Live CD, you can do it right out of the box – no additional software needed! The program we’ll use is called dd, and it’s included with pretty much all Linux distributions. dd is a utility used to do low-level copying – rather than working with files, it works directly on the raw data on a storage device. Note: dd gets a bad rap, because like many other Linux utilities, if misused it can be very destructive. If you’re not sure what you’re doing, you can easily wipe out an entire hard drive, in an unrecoverable way. Of course, the flip side of that is that dd is extremely powerful, and can do very complex tasks with little user effort. If you’re careful, and follow these instructions closely, you can clone your hard drive with one command. We’re going to take a small hard drive that we’ve been using and copy it to a new hard drive, which hasn’t been formatted yet. To make sure that we’re working with the right drives, we’ll open up a terminal (Applications > Accessories > Terminal) and enter in the following command sudo fdisk –l We have two small drives, /dev/sda, which has two partitions, and /dev/sdc, which is completely unformatted. We want to copy the data from /dev/sda to /dev/sdc. Note: while you can copy a smaller drive to a larger one, you can’t copy a larger drive to a smaller one with the method described below. Now the fun part: using dd. The invocation we’ll use is: sudo dd if=/dev/sda of=/dev/sdc In this case, we’re telling dd that the input file (“if”) is /dev/sda, and the output file (“of”) is /dev/sdc. If your drives are quite large, this can take some time, but in our case it took just less than a minute. If we do sudo fdisk –l again, we can see that, despite not formatting /dev/sdc at all, it now has the same partitions as /dev/sda.  Additionally, if we mount all of the partitions, we can see that all of the data on /dev/sdc is now the same as on /dev/sda. Note: you may have to restart your computer to be able to mount the newly cloned drive. And that’s it…If you exercise caution and make sure that you’re using the right drives as the input file and output file, dd isn’t anything to be scared of. Unlike other utilities, dd copies absolutely everything from one drive to another – that means that you can even recover files deleted from the original drive in the clone! Similar Articles Productive Geek Tips Reset Your Ubuntu Password Easily from the Live CDHow to Browse Without a Trace with an Ubuntu Live CDRecover Deleted Files on an NTFS Hard Drive from a Ubuntu Live CDCreate a Bootable Ubuntu 9.10 USB Flash DriveWipe, Delete, and Securely Destroy Your Hard Drive’s Data the Easy Way TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Snagit 10 Windows Media Player Glass Icons (icons we like) How to Forecast Weather, without Gadgets Outlook Tools, one stop tweaking for any Outlook version Zoofs, find the most popular tweeted YouTube videos Video preview of new Windows Live Essentials 21 Cursor Packs for XP, Vista & 7

    Read the article

< Previous Page | 12 13 14 15 16 17 18 19 20 21  | Next Page >