Search Results

Search found 1546 results on 62 pages for 'lazy sequences'.

Page 16/62 | < Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >

  • Some unclear PHP syntax

    - by serhio
    I am a PHP beginner and saw on the forum this PHP expression: $regex = <<<'END' / ( [\x00-\x7F] # single-byte sequences 0xxxxxxx | [\xC0-\xDF][\x80-\xBF] # double-byte sequences 110xxxxx 10xxxxxx | [\xE0-\xEF][\x80-\xBF]{2} # triple-byte sequences 1110xxxx 10xxxxxx * 2 | [\xF0-\xF7][\x80-\xBF]{3} # quadruple-byte sequence 11110xxx 10xxxxxx * 3 ) | ( [\x80-\xBF] ) # invalid byte in range 10000000 - 10111111 | ( [\xC0-\xFF] ) # invalid byte in range 11000000 - 11111111 /x END; Is this code correct? What do these strange (for me) constructions like <<<, 'END', /, /x, and END; mean? I recieve: Parse error: syntax error, unexpected T_SL in /home/vhosts/mysite.com/public_html/mypage.php on line X Thanks

    Read the article

  • SSIS - Parallel Execution of Tasks - How efficient is it?

    - by Randy Minder
    I am building an SSIS package that will contain dozens of Sequence tasks. Each Sequence task will contain three tasks. One to truncate a destination table and remove indexes on the table, another to import data from a source table, and a third to add back indexes to the destination table. My question is this. I currently have nine of these Sequences tasks built, and none are dependent on any of the others. When I execute the package, SSIS seems to do a pretty good job of determining which tasks in which Sequence to execute, which, by the way, appears to be quite random. As I continue adding more Sequences, should I attempt to be smarter about how SSIS should execute these Sequences, or is SSIS smart enough to do it itself? Thanks.

    Read the article

  • SQL Server concurrency and generated sequence

    - by Goyuix
    I need a sequence of numbers for an application, and I am hoping to leverage the abilities of SQL Server to do it. I have created the following table and procedure (in SQL Server 2005): CREATE TABLE sequences ( seq_name varchar(50) NOT NULL, seq_value int NOT NULL ) CREATE PROCEDURE nextval @seq_name varchar(50) AS BEGIN DECLARE @seq_value INT SET @seq_value = -1 UPDATE sequences SET @seq_value = seq_value = seq_value + 1 WHERE seq_name = @seq_name RETURN @seq_value END I am a little concerned that without locking the table/row another request could happen concurrently and end up returning the same number to another thread or client. This would be very bad obviously. Is this design safe in this regard? Is there something I can add that would add the necessary locking to make it safe? Note: I am aware of IDENTITY inserts in SQL Server - and that is not what I am looking for this in particular case. Specifically, I don't want to be inserting/deleting rows. This is basically to have a central table that manages the sequential number generator for a bunch of sequences.

    Read the article

  • SCCM2012 R2 – How to integrate MDT with SCCM

    - by Waclaw Chrabaszcz
    Originally posted on: http://geekswithblogs.net/Wchrabaszcz/archive/2013/11/12/sccm2012-r2--how-to-integrate-mdt-with-sccm.aspxThere are two maybe not competitive but parallel products: Microsoft Deployment Toolkit and System Center Configuration manager. Few years ago I was wondering why they are separate, I why I cannot share Task Sequences between them. And how it usually happens in live, when I was focused on other technologies, MDT and SCCM became best friends. Let's integrate MDT with SCCM: If first step you need to download MDT http://www.microsoft.com/en-us/download/details.aspx?id=25175 Install MDT on your SCCM server boxaccept the EULA Join CEIP if you like  Once you completed the installation I would recommend you to complete MDT configuring before integration with the SCCM. Start the Deployment Workbenchinstall updatesyou will need to download and install WAIKcreate new deployment shareleave default values Create MDT databaseMake sure you will create separate database, DO NOT use existing SCCM DB Now we are ready to integrate MDT with SCCMthe Integration tool should discover your server automaticallyAfter reopening SCCM console in task sequences you should have new cool features: How to use them? That's another story …

    Read the article

  • Can an aggregate root hold references of members of another aggregate root?

    - by Rushino
    Hello, I know outside aggregates cant change anything inside an aggregate without passing by his root. That said i would like to know if an aggregate root can hold references of members (objects insides) of another aggregate root? (fellowing DDD rules) Example : a Calendar contain a list of phases which contain a list of sequences which contain a list of assignations Calendar is root because phases and sequences and assignations only work in context of a calendar. You also have Students and Groups of student (called groups) It is possible (fellowing DDD rules) to make Groups holding references of assignations or it need to pass by the root for accessing groups from assignations ? Thanks.

    Read the article

  • F# and the useful infinite Sequence (I think)

    - by MarkPearl
    So I have seen a few posts done by other F# fans on solving project Euler problems. They looked really interesting and I thought with my limited knowledge of F# I would attempt a few and the first one I had a look at was problem 5. Which said : “2520 is the smallest number that can be divided by each of the numbers from 1 to 10 without any remainder. What is the smallest number that is evenly divisible by all of the numbers from 1 to 20?” So I jumped into coding it and straight away got stuck – the C# programmer in me wants to do a loop, starting at one and dividing every number by 1 to 20 to see if they all divide and once a match is found, there is your solution. Obviously not the most elegant way but a good old brute force approach. However I am pretty sure this would not be the F# way…. So after a bit of research I found the Sequences and how useful they were. Sequences seemed like the beginning of an approach to solve my problem. In my head I thought - create a sequence, and then start at the beginning of it and move through it till you find a value that is divisible by 1 to 20. Sounds reasonable? So the question is begged - how would you create a sequence that you are sure will be large enough to hold the solution to the problem? Well… You can’t know! Some more googling and I found what I would call infinite sequences – something that looks like this… let nums = 1 |> Seq.unfold (fun i -> Some (i, i + 1))   My interpretation of this would be as follows… create a sequence, and whenever it is called add 1 to its size (I would appreciate someone helping me on wording this right functionally). Something that I don’t understand fully yet is the forward pipe operator (|>) which I think plays a key role in this code. With this in hand I was able to code a basic optimized solution to this problem. I’m going to go over it some more before I post the full code just in case!

    Read the article

  • How list of references are represented in UML and does that break any DDD rules ?

    - by Rushino
    Hello, How a list of references are represented in UML ? Example : a Calendar contain a list of phases which contain a list of sequences which contain a list of assignations Calendar is root because phases and sequences and assignations only work in context of a calendar. But assignations must hold multiple references to groups of students. (Must work two sides) Would like to know if its possible to hold multiple references of an aggregate root (groups) inside another aggregate root (calendar) member ? Also how a list of references are represented in UML ? it is a simple relation ? Also does this break any rules in DDD domain ? Thanks.

    Read the article

  • How can one make vim change terminal colors?

    - by amn
    I am using command line vim running from an xterm (which runs sh). I have color in vim according to a color scheme I like. The problem is, as usual with 256-color terminals and truecolor color schemes, colors are wrong. Now, I know I can do a gazillion things to fix this, including installing gvim, but I like my terminal. In fact, using xrdb [-merge] .Xresource file, I now actually have xterm override the color values, and the theme now looks perfect. Since, I may be switching to another theme, I need some workflow to have vim actually do what xrdb does - to reset terminal color pallette. Because right now I have to reset color values with xrdb ... first, then launch another xterm to actually use these values, then launch vim from that newly opened xterm to have the exact colors. The way I understood it is that vim color scheme, just as any other terminal application, uses colors by referencing their ids, and X resources set the values themselves. I think I saw somewhere on Internet, that terminal control character sequences can reset actual color values, in fact, I am sure they can - I managed to set my terminal background color at runtime. How would I make vim execute these sequences to match values for the color scheme? And is there any reference to these control sequences, as part of any standard?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Special scheduling Algorithm (pattern expansion)

    - by tovare
    Question Do you think genetic algorithms worth trying out for the problem below, or will I hit local-minima issues? I think maybe aspects of the problem is great for a generator / fitness-function style setup. (If you've botched a similar project I would love hear from you, and not do something similar) Thank you for any tips on how to structure things and nail this right. The problem I'm searching a good scheduling algorithm to use for the following real-world problem. I have a sequence with 15 slots like this (The digits may vary from 0 to 20) : 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 (And there are in total 10 different sequences of this type) Each sequence needs to expand into an array, where each slot can take 1 position. 1 1 0 0 1 1 1 0 0 0 1 1 1 0 0 1 1 0 0 1 1 1 0 0 0 1 1 1 0 0 0 0 1 1 0 0 0 1 1 1 0 0 0 1 1 0 0 1 1 0 0 0 1 1 1 0 0 0 1 1 The constraints on the matrix is that: [row-wise, i.e. horizontally] The number of ones placed, must either be 11 or 111 [row-wise] The distance between two sequences of 1 needs to be a minimum of 00 The sum of each column should match the original array. The number of rows in the matrix should be optimized. The array then needs to allocate one of 4 different matrixes, which may have different number of rows: A, B, C, D A, B, C and D are real-world departments. The load needs to be placed reasonably fair during the course of a 10-day period, not to interfere with other department goals. Each of the matrix is compared with expansion of 10 different original sequences so you have: A1, A2, A3, A4, A5, A6, A7, A8, A9, A10 B1, B2, B3, B4, B5, B6, B7, B8, B9, B10 C1, C2, C3, C4, C5, C6, C7, C8, C9, C10 D1, D2, D3, D4, D5, D6, D7, D8, D9, D10 Certain spots on these may be reserved (Not sure if I should make it just reserved/not reserved or function-based). The reserved spots might be meetings and other events The sum of each row (for instance all the A's) should be approximately the same within 2%. i.e. sum(A1 through A10) should be approximately the same as (B1 through B10) etc. The number of rows can vary, so you have for instance: A1: 5 rows A2: 5 rows A3: 1 row, where that single row could for instance be: 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 etc.. Sub problem* I'de be very happy to solve only part of the problem. For instance being able to input: 1 1 2 3 4 2 2 3 4 2 2 3 3 2 3 And get an appropriate array of sequences with 1's and 0's minimized on the number of rows following th constraints above.

    Read the article

  • Python: For loop problem

    - by Yasmin
    I have a simple for loop problem, when i run the code below it prints out series of 'blue green' sequences then a series of 'green' sequences. I want the output to be; if row[4] is equal to 1 to print blue else print green. for row in rows: for i in `row[4]`: if i ==`1`: print 'blue ' else: print 'green ' Any help would be grateful thanks Yas

    Read the article

  • Cleaning up a SQL SP with Regex

    - by Douglas Osborne
    1) If I am running a find and replace in SQL 2005 - what would be the regular expression to find tab and space sequences ( or space and tab sequences ) and replace them with just tab? 2) If I have a line which begins with a space - is there a regular expression to convert that leading space to a tab? 3) What would be the regular expression to remove all of the spaces before a CR/LF in a SQL statement? TIA for the help - I know this will be trivial to most of you, Doug

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • Can an algorithmic process ever give true random numbers ?

    - by Arkapravo
    I have worked with random functions in python,ruby, MATLAB, Bash and Java. Nearly every programming language has a function to generate Random numbers. However, these apparently random sequences are termed as pseudo-random number sequences as the generation follows a deterministic approach, and the sequence seems to repeat (usually with a very large period). My question, can an algorithmic/programming process ever yield true random numbers ? The questions probably is more of theoretical computer science than just programming !

    Read the article

  • Is it possible to store only a checksum of a large file in git?

    - by Andrew Grimm
    I'm a bioinformatician currently extracting normal-sized sequences from genomic files. Some genomic files are large enough that I don't want to put them into the main git repository, whereas I'm putting the extracted sequences into git. Is it possible to tell git "Here's a large file - don't store the whole file, just take its checksum, and let me know if that file is missing or modified." If that's not possible, I guess I'll have to either git-ignore the large files, or, as suggested in this question, store them in a submodule.

    Read the article

  • Merging two Regular Expressions to Truncate Words in Strings

    - by Alix Axel
    I'm trying to come up with the following function that truncates string to whole words (if possible, otherwise it should truncate to chars): function Text_Truncate($string, $limit, $more = '...') { $string = trim(html_entity_decode($string, ENT_QUOTES, 'UTF-8')); if (strlen(utf8_decode($string)) > $limit) { $string = preg_replace('~^(.{1,' . intval($limit) . '})(?:\s.*|$)~su', '$1', $string); if (strlen(utf8_decode($string)) > $limit) { $string = preg_replace('~^(.{' . intval($limit) . '}).*~su', '$1', $string); } $string .= $more; } return trim(htmlentities($string, ENT_QUOTES, 'UTF-8', true)); } Here are some tests: // Iñtërnâtiônàlizætiøn and then the quick brown fox... (49 + 3 chars) echo dyd_Text_Truncate('Iñtërnâtiônàlizætiøn and then the quick brown fox jumped overly the lazy dog and one day the lazy dog humped the poor fox down until she died.', 50, '...'); // Iñtërnâtiônàlizætiøn_and_then_the_quick_brown_fox_... (50 + 3 chars) echo dyd_Text_Truncate('Iñtërnâtiônàlizætiøn_and_then_the_quick_brown_fox_jumped_overly_the_lazy_dog and one day the lazy dog humped the poor fox down until she died.', 50, '...'); They both work as it is, however if I drop the second preg_replace() I get the following: Iñtërnâtiônàlizætiøn_and_then_the_quick_brown_fox_jumped_overly_the_lazy_dog and one day the lazy dog humped the poor fox down until she died.... I can't use substr() because it only works on byte level and I don't have access to mb_substr() ATM, I've made several attempts to join the second regex with the first one but without success. Please help S.M.S., I've been struggling with this for almost an hour. EDIT: I'm sorry, I've been awake for 40 hours and I shamelessly missed this: $string = preg_replace('~^(.{1,' . intval($limit) . '})(?:\s.*|$)?~su', '$1', $string); Still, if someone has a more optimized regex (or one that ignores the trailing space) please share: "Iñtërnâtiônàlizætiøn and then " "Iñtërnâtiônàlizætiøn_and_then_" EDIT 2: I still can't get rid of the trailing whitespace, can someone help me out?

    Read the article

  • php - regex- preg_replace - space after line-break!

    - by aSeptik
    Hi all guys! still on regex! i want learn it but i'm still crashing the head into my keybord! ;-) ok very trivial for you, i'm sure! Assuming i have this sting, the \s is where the space actualy is... \n where linebreak is.. DESCRIPTION: The quick brown fox jum`\s\n` `\s`ps over the lazy dog now, what i need to do is remove All the space after the A-Z: that i have achieved by this regex: /\s+(?![A-Z:])/m that produce this result DESCRIPTION: The quick brown fox jum ps over the lazy dog as you can see it leave the space between jum and ps how to have a result like this? DESCRIPTION: The quick brown fox jumps over the lazy dog thank's for the time!

    Read the article

  • java regex: capture multiline sequence between tokens

    - by Guillaume
    I'm struggling with regex for splitting logs files into log sequence in order to match pattern inside these sequences. log format is: timestamp fieldA fieldB fieldn log message1 timestamp fieldA fieldB fieldn log message2 log message2bis timestamp fieldA fieldB fieldn log message3 The timestamp regex is known. I want to extract every log sequence (potentialy multiline) between timestamps. And I want to keep the timestamp. I want in the same time to keep the exact count of lines. What I need is how to decorate timestamp pattern to make it split my log file in log sequence. I can not split the whole file as a String, since the file content is provided in a CharBuffer Here is sample method that will be using this log sequence matcher: private void matches(File f, CharBuffer cb) { Matcher sequenceBreak = sequencePattern.matcher(cb); // sequence matcher int lines = 1; int sequences = 0; while (sequenceBreak.find()) { sequences++; String sequence = sequenceBreak.group(); if (filter.accept(sequence)) { System.out.println(f + ":" + lines + ":" + sequence); } //count lines Matcher lineBreak = LINE_PATTERN.matcher(sequence); while (lineBreak.find()) { lines++; } if (sequenceBreak.end() == cb.limit()) { break; } } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Idiomatic way to build a custom structure from XML zipper in Clojure

    - by Checkers
    Say, I'm parsing an RSS feed and want to extract a subset of information from it. (def feed (-> "http://..." clojure.zip/xml-zip clojure.xml/parse)) I can get links and titles separately: (xml-> feed :channel :item :link text) (xml-> feed :channel :item :title text) However I can't figure out the way to extract them at the same time without traversing the zipper more than once, e.g. (let [feed (-> "http://..." clojure.zip/xml-zip clojure.xml/parse)] (zipmap (xml-> feed :channel :item :link text) (xml-> feed :channel :item :title text))) ...or a variation of thereof, involving mapping multiple sequences to a function that incrementally builds a map with, say, assoc. Not only I have to traverse the sequence multiple times, the sequences also have separate states, so elements must be "aligned", so to speak. That is, in a more complex case than RSS, a sub-element may be missing in particular element, making one of sequences shorter by one (there are no gaps). So the result may actually be incorrect. Is there a better way or is it, in fact, the way you do it in Clojure?

    Read the article

  • May 20th Links: ASP.NET MVC, ASP.NET, .NET 4, VS 2010, Silverlight

    - by ScottGu
    Here is the latest in my link-listing series.  Also check out my VS 2010 and .NET 4 series and ASP.NET MVC 2 series for other on-going blog series I’m working on. [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] ASP.NET MVC How to Localize an ASP.NET MVC Application: Michael Ceranski has a good blog post that describes how to localize ASP.NET MVC 2 applications. ASP.NET MVC with jTemplates Part 1 and Part 2: Steve Gentile has a nice two-part set of blog posts that demonstrate how to use the jTemplate and DataTable jQuery libraries to implement client-side data binding with ASP.NET MVC. CascadingDropDown jQuery Plugin for ASP.NET MVC: Raj Kaimal has a nice blog post that demonstrates how to implement a dynamically constructed cascading dropdownlist on the client using jQuery and ASP.NET MVC. How to Configure VS 2010 Code Coverage for ASP.NET MVC Unit Tests: Visual Studio enables you to calculate the “code coverage” of your unit tests.  This measures the percentage of code within your application that is exercised by your tests – and can give you a sense of how much test coverage you have.  Gunnar Peipman demonstrates how to configure this for ASP.NET MVC projects. Shrinkr URL Shortening Service Sample: A nice open source application and code sample built by Kazi Manzur that demonstrates how to implement a URL Shortening Services (like bit.ly) using ASP.NET MVC 2 and EF4.  More details here. Creating RSS Feeds in ASP.NET MVC: Damien Guard has a nice post that describes a cool new “FeedResult” class he created that makes it easy to publish and expose RSS feeds from within ASP.NET MVC sites. NoSQL with MongoDB, NoRM and ASP.NET MVC Part 1 and Part 2: Nice two-part blog series by Shiju Varghese on how to use MongoDB (a document database) with ASP.NET MVC.  If you are interested in document databases also make sure to check out the Raven DB project from Ayende. Using the FCKEditor with ASP.NET MVC: Quick blog post that describes how to use FCKEditor – an open source HTML Text Editor – with ASP.NET MVC. ASP.NET Replace Html.Encode Calls with the New HTML Encoding Syntax: Phil Haack has a good blog post that describes a useful way to quickly update your ASP.NET pages and ASP.NET MVC views to use the new <%: %> encoding syntax in ASP.NET 4.  I blogged about the new <%: %> syntax – it provides an easy and concise way to HTML encode content. Integrating Twitter into an ASP.NET Website using OAuth: Scott Mitchell has a nice article that describes how to take advantage of Twiter within an ASP.NET Website using the OAuth protocol – which is a simple, secure protocol for granting API access. Creating an ASP.NET report using VS 2010 Part 1, Part 2, and Part 3: Raj Kaimal has a nice three part set of blog posts that detail how to use SQL Server Reporting Services, ASP.NET 4 and VS 2010 to create a dynamic reporting solution. Three Hidden Extensibility Gems in ASP.NET 4: Phil Haack blogs about three obscure but useful extensibility points enabled with ASP.NET 4. .NET 4 Entity Framework 4 Video Series: Julie Lerman has a nice, free, 7-part video series on MSDN that walks through how to use the new EF4 capabilities with VS 2010 and .NET 4.  I’ll be covering EF4 in a blog series that I’m going to start shortly as well. Getting Lazy with System.Lazy: System.Lazy and System.Lazy<T> are new features in .NET 4 that provide a way to create objects that may need to perform time consuming operations and defer the execution of the operation until it is needed.  Derik Whittaker has a nice write-up that describes how to use it. LINQ to Twitter: Nifty open source library on Codeplex that enables you to use LINQ syntax to query Twitter. Visual Studio 2010 Using Intellitrace in VS 2010: Chris Koenig has a nice 10 minute video that demonstrates how to use the new Intellitrace features of VS 2010 to enable DVR playback of your debug sessions. Make the VS 2010 IDE Colors look like VS 2008: Scott Hanselman has a nice blog post that covers the Visual Studio Color Theme Editor extension – which allows you to customize the VS 2010 IDE however you want. How to understand your code using Dependency Graphs, Sequence Diagrams, and the Architecture Explorer: Jennifer Marsman has a nice blog post describes how to take advantage of some of the new architecture features within VS 2010 to quickly analyze applications and legacy code-bases. How to maintain control of your code using Layer Diagrams: Another great blog post by Jennifer Marsman that demonstrates how to setup a “layer diagram” within VS 2010 to enforce clean layering within your applications.  This enables you to enforce a compiler error if someone inadvertently violates a layer design rule. Collapse Selection in Solution Explorer Extension: Useful VS 2010 extension that enables you to quickly collapse “child nodes” within the Visual Studio Solution Explorer.  If you have deeply nested project structures this extension is useful. Silverlight and Windows Phone 7 Building a Simple Windows Phone 7 Application: A nice tutorial blog post that demonstrates how to take advantage of Expression Blend to create an animated Windows Phone 7 application. If you haven’t checked out my Windows Phone 7 Twitter Tutorial I also recommend reading that. Hope this helps, Scott P.S. If you haven’t already, check out this month’s "Find a Hoster” page on the www.asp.net website to learn about great (and very inexpensive) ASP.NET hosting offers.

    Read the article

  • Funky Behavior NoTracking Query Entities

    I’ve been using a lot of NoTracking queries to grab lists of data that I don’t need change tracked. It enhances performance and cuts down on resources. There are some nuances about these entities, however. One of the interesting behaviors of EF4’s Lazy Loading is that even if you have entities that you have queried with NoTracking on, they will still lazy load related entities. Unless you’ve read this somewhere (it’s on the ADO.NET team’s blog post which introduces...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Bash color prompt and long commands

    - by Eric J.
    I'm colorizing parts of my bash prompt using ANSI escape sequences. This works great, until the command I'm currently typing in is long enough that it has to wrap. Instead of the rest of the command displaying on the next line, it wraps back to column 1 of the current line, overwriting the beginning of the prompt. I get that behavior with this prompt: export PS1="[\u][\033[0;32;40mdemo \033[0;33;40m1.5.40.b\033[0;37;40m] \w> \033[0m" but it works correctly with the same prompt, ANSI sequences remove: export PS1="[\u][demo 1.5.40.b] \w> " I'm connecting using the current version of Putty, with default Putty settings. The OS is Ubuntu 8.10.

    Read the article

< Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >