Search Results

Search found 4603 results on 185 pages for 'lower bound'.

Page 164/185 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • UINavigation Bar while moving view for writing in a textfield

    - by ObiWanKeNerd
    i'm using this code to move the view when i'm about to type on a textfield, otherwise the keyboard may cover the textfield if it's in the lower side of the screen. I would like to know if there is a way to maintain the UINavigation Bar in it's place, because with this code the bar will move with all the view outside the screen, becoming untouchable until i end editing the textfield (closing the keyboard). CGFloat animatedDistance; static const CGFloat KEYBOARD_ANIMATION_DURATION = 0.3; static const CGFloat MINIMUM_SCROLL_FRACTION = 0.2; static const CGFloat MAXIMUM_SCROLL_FRACTION = 0.8; static const CGFloat PORTRAIT_KEYBOARD_HEIGHT = 216; static const CGFloat LANDSCAPE_KEYBOARD_HEIGHT = 162; - (void)textFieldDidBeginEditing:(UITextField *)textField { CGRect textFieldRect = [self.view.window convertRect:textField.bounds fromView:textField]; CGRect viewRect = [self.view.window convertRect:self.view.bounds fromView:self.view]; CGFloat midline = textFieldRect.origin.y + 0.5 * textFieldRect.size.height; CGFloat numerator = midline - viewRect.origin.y - MINIMUM_SCROLL_FRACTION * viewRect.size.height; CGFloat denominator = (MAXIMUM_SCROLL_FRACTION - MINIMUM_SCROLL_FRACTION) * viewRect.size.height; CGFloat heightFraction = numerator / denominator; if (heightFraction < 0.0) { heightFraction = 0.0; } else if (heightFraction > 1.0) { heightFraction = 1.0; } UIInterfaceOrientation orientation = [[UIApplication sharedApplication] statusBarOrientation]; if (orientation == UIInterfaceOrientationPortrait || orientation == UIInterfaceOrientationPortraitUpsideDown) { animatedDistance = floor(PORTRAIT_KEYBOARD_HEIGHT * heightFraction); } else { animatedDistance = floor(LANDSCAPE_KEYBOARD_HEIGHT * heightFraction); } CGRect viewFrame = self.view.frame; viewFrame.origin.y -= animatedDistance; [UIView beginAnimations:nil context:NULL]; [UIView setAnimationBeginsFromCurrentState:YES]; [UIView setAnimationDuration:KEYBOARD_ANIMATION_DURATION]; [self.view setFrame:viewFrame]; [UIView commitAnimations]; } - (void)textFieldDidEndEditing:(UITextField *)textField { CGRect viewFrame = self.view.frame; viewFrame.origin.y += animatedDistance; [UIView beginAnimations:nil context:NULL]; [UIView setAnimationBeginsFromCurrentState:YES]; [UIView setAnimationDuration:KEYBOARD_ANIMATION_DURATION]; [self.view setFrame:viewFrame]; [UIView commitAnimations]; } Thanks in advance!

    Read the article

  • RMI applet is making requests on random ports and blocked consequently

    - by Dan
    /// I have set up RMI system successfully on local ubuntu srver. Registry port 1099 and remote object export on 1100(fixed by calling super(1100)) Now I am trying to make it work on Ubuntu over internet with a public IP. I could bind service properly with public ip.But the client applet is trying to connect to ubuntu server at random ports. Below is the error thrown by client applet: // Exception network: Connecting public-ip:1100 with proxy=DIRECT network: Connecting public-ip/cgi-bin/java-rmi.cgi?forward=1099 with proxy=DIRECT network: Connecting public-ip:3733 with proxy=DIRECT network: Connecting public-ip:3721 with proxy=DIRECT // java.rmi.ConnectException: Connection refused to host: public-ip; nested exception is: java.net.ConnectException: Connection refused: connect at sun.rmi.transport.tcp.TCPEndpoint.newSocket(Unknown Source)Source) at java.net.AbstractPlainSocketImpl.connectToAddress(Unknown Source) ... // // I have only 2 ports open on server, i.e., 1099(registry) and 1100(export). How can I fix ports in applet requests such that it does always connect server on same open port? // // Another issue.As I have bound service on public IP i.e. //public-ip:1099/ServiceName, a job running on server to send message to clinets is not able to make request to RMI service. public-ip URL does not work on same machine,i.e., server.Do you think I should use fixed socket factory?If so please give me code snippet and guide me how i can set it up. //Exception java.rmi.ConnectException: Connection refused to host: public-ip; nested exception is: java.net.ConnectException: Connection refused at sun.rmi.transport.tcp.TCPEndpoint.newSocket(TCPEndpoint.java:619) at sun.rmi.transport.tcp.TCPChannel.createConnection(TCPChannel.java:216) at sun.rmi.transport.tcp.TCPChannel.newConnection(TCPChannel.java:202) at sun.rmi.server.UnicastRef.invoke(UnicastRef.java:128) at java.rmi.server.RemoteObjectInvocationHandler.invokeRemoteMethod(RemoteObjectInvocationHandler.java:194) at java.rmi.server.RemoteObjectInvocationHandler.invoke(RemoteObjectInvocationHandler.java:148) at $Proxy5.getUserID(Unknown Source) at rmi.source.xxxxxx$JobScheduler.run(xxxxServerImpl.java:293) at java.util.TimerThread.mainLoop(Timer.java:555) at java.util.TimerThread.run(Timer.java:505) Caused by: java.net.ConnectException: Connection refused at java.net.PlainSocketImpl.socketConnect(Native Method) at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:337) at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:198) at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180) at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:391) at java.net.Socket.connect(Socket.java:579) at java.net.Socket.connect(Socket.java:528) at java.net.Socket.(Socket.java:425) at java.net.Socket.(Socket.java:208) at sun.rmi.transport.proxy.RMIDirectSocketFactory.createSocket(RMIDirectSocketFactory.java:40) at sun.rmi.transport.proxy.RMIMasterSocketFactory.createSocket(RMIMasterSocketFactory.java:146) at sun.rmi.transport.tcp.TCPEndpoint.newSocket(TCPEndpoint.java:613) ... 9 more Coould you please help me? Thanks a lot in advance. Dan

    Read the article

  • Insane CPU usage in QT 5.0

    - by GravityScore
    I'm having trouble using the QT framework, particularly with the paintEvent of QWidget. I have a QWidget set up, and am overriding the paintEvent of it. I need to render a bunch of rectangles (grid system), 51 by 19, leading to 969 rectangles being drawn. This is done in a for loop. Then I also need to draw an image on each on of these grids. The QWidget is added to a QMainWindow, which is shown. This works nicely, but it's using up 47% of CPU per window open! And I want to allow the user to open multiple windows like this, likey having 3-4 open at a time, which puts the CPU close to 150%. Why does this happen? Here is the paintEvent contents. The JNI calls don't cause the CPU usage, commenting them out doesn't lower it, but commenting out the p.fillRect and Renderer::renderString (which draws the image) lowers the CPU to about 5%. // Background QPainter p(this); p.fillRect(0, 0, this->width(), this->height(), QBrush(QColor(0, 0, 0))); // Lines for (int y = 0; y < Global::terminalHeight; y++) { // Line and color method ID jmethodID lineid = Manager::jenv->GetMethodID(this->javaClass, "getLine", "(I)Ljava/lang/String;"); error(); jmethodID colorid = Manager::jenv->GetMethodID(this->javaClass, "getColorLine", "(I)Ljava/lang/String;"); error(); // Values jstring jl = (jstring) Manager::jenv->CallObjectMethod(this->javaObject, lineid, jint(y)); error(); jstring cjl = (jstring) Manager::jenv->CallObjectMethod(this->javaObject, colorid, jint(y)); error(); // Convert to C values const char *l = Manager::jenv->GetStringUTFChars(jl, 0); const char *cl = Manager::jenv->GetStringUTFChars(cjl, 0); QString line = QString(l); QString color = QString(cl); // Render line for (int x = 0; x < Global::terminalWidth; x++) { QColor bg = Renderer::colorForHex(color.mid(x + color.length() / 2, 1)); // Cell location on widget int cellx = x * Global::cellWidth + Global::xoffset; int celly = y * Global::cellHeight + Global::yoffset; // Background p.fillRect(cellx, celly, Global::cellWidth, Global::cellHeight, QBrush(bg)); // String // Renders the image to the grid Renderer::renderString(p, tc, text, cellx, celly); } // Release Manager::jenv->ReleaseStringUTFChars(jl, l); Manager::jenv->ReleaseStringUTFChars(cjl, cl); }

    Read the article

  • How to perform duplicate key validation using entlib (or DataAnnotations), MVC, and Repository pattern

    - by olivehour
    I have a set of ASP.NET 4 projects that culminate in an MVC (3 RC2) app. The solution uses Unity and EntLib Validation for cross-cutting dependency injection and validation. Both are working great for injecting repository and service layer implementations. However, I can't figure out how to do duplicate key validation. For example, when a user registers, we want to make sure they don't pick a UserID that someone else is already using. For this type of validation, the validating object must have a repository reference... or some other way to get an IQueryable / IEnumerable reference to check against other rows already in the DB. What I have is a UserMetadata class that has all of the property setters and getters for a user, along with all of the appropriate DataAnnotations and EntLib Validation attributes. There is also a UserEntity class implemented using EF4 POCO Entity Generator templates. The UserEntity depends on UserMetadata, because it has a MetadataTypeAttribute. I also have a UserViewModel class that has the same exact MetadataType attribute. This way, I can apply the same validation rules, via attributes, to both the entity and viewmodel. There are no concrete references to the Repository classes whatsoever. All repositories are injected using Unity. There is also a service layer that gets dependency injection. In the MVC project, service layer implementation classes are injected into the Controller classes (the controller classes only contain service layer interface references). Unity then injects the Repository implementations into the service layer classes (service classes also only contain interface references). I've experimented with the DataAnnotations CustomValidationAttribute in the metadata class. The problem with this is the validation method must be static, and the method cannot instantiate a repository implementation directly. My repository interface is IRepository, and I have only one single repository implementation class defined as EntityRepository for all domain objects. To instantiate a repository explicitly I would need to say new EntityRepository(), which would result in a circular dependency graph: UserMetadata [depends on] DuplicateUserIDValidator [depends on] UserEntity [depends on] UserMetadata. I've also tried creating a custom EntLib Validator along with a custom validation attribute. Here I don't have the same problem with a static method. I think I could get this to work if I could just figure out how to make Unity inject my EntityRepository into the validator class... which I can't. Right now, all of the validation code is in my Metadata class library, since that's where the custom validation attribute would go. Any ideas on how to perform validations that need to check against the current repository state? Can Unity be used to inject a dependency into a lower-layer class library?

    Read the article

  • iphone problem receiving UDP packets

    - by SooDesuNe
    I'm using sendto() and recvfrom() to send some simple packets via UDP over WiFI. I've tried using two phones, and a simulator, the results I'm getting are: Packets sent from phones - recieved by simulator Packets sent from simulator - simulator recvfrom remains blocking. Packets sent from phones - other phone recvfrom remains blocking. I'm not sure how to start debugging this one, since the simulator/mac is able to receive the the packets, but the phones don't appear to be getting the message. A slight aside, do I need to keep my packets below the MTU for my network? Or is fragmentation handled by the OS or some other lower level software? UPDATE: I forgot to include the packet size and structure. I'm transmitting: typedef struct PacketForTransmission { int32_t packetTypeIdentifier; char data[64]; // size to fit my biggest struct } PacketForTransmission; of which the char data[64] is: typedef struct PacketHeader{ uint32_t identifier; uint32_t datatype; } PacketHeader; typedef struct BasePacket{ PacketHeader header; int32_t cardValue; char sendingDeviceID[41]; //dont forget to save room for the NULL terminator! } BasePacket; typedef struct PositionPacket{ BasePacket basePacket; int32_t x; int32_t y; } PositionPacket; sending packet is like: PositionPacket packet; bzero(&packet, sizeof(packet)); //fill packet with it's associated data PacketForTransmission transmissionPacket; transmissionPacket.packetTypeIdentifier = kPositionPacketType; memcpy(&transmissionPacket.data, (void*)&packet, sizeof(packet)); //put the PositionPacket into data[64] size_t sendResult = sendto(_socket, &transmissionPacket, sizeof(transmissionPacket), 0, [address bytes], [address length]); NSLog(@"packet sent of size: %i", sendResult); and recieving packets is like: while(1){ char dataBuffer[8192]; struct sockaddr addr; socklen_t socklen = sizeof(addr); ssize_t len = recvfrom(_socket, dataBuffer, sizeof(dataBuffer), 0, &addr, &socklen); //continues blocking here NSLog(@"packet recieved of length: %i", len); //do some more stuff }

    Read the article

  • How to replace all id attributes of a child collection of complex types using jQuery in ASP.net MVC

    - by TJB
    Here's my situation: I'm writing an ASP.net MVC 1 website and I have a create/edit form that uses the default model binding to parse the form into a strongly typed complex object. The object I'm posting has a child collection of another complex type and the way I format my id's for the model binder is as follows: <div class="childContainer" > <!-- There's one of these for each property for each child collection item --> <%= Html.TextBox("ChildCollectionName[0].ChildPropertyName", /* blah blah */ ) %> <%= Html.TextBox("ChildCollectionName[0].OtherChildPropertyName", /* blah blah */ ) %> <!-- ... --> </div> This gets rendered as <div class="childContainer" > <input id="ChildCollectionName[0]_ChildPropertyName" ... /> <input id="ChildCollectionName[0]_OtherChildPropertyName" ... /> ... </div> <div class="childContainer" > <input id="ChildCollectionName[1]_ChildPropertyName" ... /> <input id="ChildCollectionName[1]_OtherChildPropertyName" ... /> ... </div> For each entry in the chlid collection. This collection is dynamically created in the form using jQuery, so entries can be added, removed etc. and whenever there's an operation on the collection I need to update the indexes so that it's bound correctly on the server side. What's the best way to replace all the html input id's when I'm updating the index within the child e.g. replace all [*] -- [N] where N is the correct index. using jQuery / JavaScript ? I have something coded now, but its buggy and I think there is a simpler solution. Also, if you have an easier way to identify the child collection I'll take any advice on that as well. Thanx!

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • ASP.NET MVC 2: Linq to SQL entity w/ ForeignKey relationship and Default ModelBinder strangeness

    - by Simon
    Once again I'm having trouble with Linq to Sql and the MVC Model Binder. I have Linq to Sql generated classes, to illustrate them they look similar to this: public class Client { public int ClientID { get; set; } public string Name { get; set; } } public class Site { public int SiteID { get; set; } public string Name { get; set; } } public class User { public int UserID { get; set; } public string Name { get; set; } public int? ClientID { get; set; } public EntityRef<Client> Client { get; set; } public int? SiteID { get; set; } public EntityRef<Site> Site { get; set; } } The 'User' has a relationship with the 'Client' and 'Site . The User class has nullable ClientIDs and SiteIDs because the admin users are not bound to a Client or Site. Now I have a view where a user can edit a 'User' object, the view has fields for all the 'User' properties. When the form is submitted, the appropiate 'Save' action is called in my UserController: public ActionResult Save(User user, FormCollection form) { //form['SiteID'] == 1 //user.SiteID == 1 //form['ClientID'] == 1 //user.ClientID == null } The problem here is that the ClientID is never set, it is always null, even though the value is in the FormCollection. To figure out whats going wrong I set breakpoints for the ClientID and SiteID getters and setters in the Linq to Sql designer generated classes. I noticed the following: SiteID is being set, then ClientID is being set, but then the Client EntityRef property is being set with a null value which in turn is setting the ClientID to null too! I don't know why and what is trying to set the Client property, because the Site property setter is never beeing called, only the Client setter is being called. Manually setting the ClientID from the FormCollection like this: user.ClientID = int.Parse(form["ClientID"].ToString()); throws a 'ForeignKeyReferenceAlreadyHasValueException', because it was already set to null before. The only workaround I have found is to extend the generated partial User class with a custom method: Client = default(EntityRef<Client>) but this is not a satisfying solution. I don't think it should work like this? Please enlighten me someone. So far Linq to Sql is driving me crazy! Best regards

    Read the article

  • Does this incorporate JavaScript closures?

    - by alex
    In trying to learn JavaScript closures, I've confused myself a bit. From what I've gathered over the web, a closure is... Declaring a function within another function, and that inner function has access to its parent function's variables, even after that parent function has returned. Here is a small sample of script from a recent project. It allows text in a div to be scrolled up and down by buttons. var pageScroll = (function() { var $page, $next, $prev, canScroll = true, textHeight, scrollHeight; var init = function() { $page = $('#secondary-page'); // reset text $page.scrollTop(0); textHeight = $page.outerHeight(); scrollHeight = $page.attr('scrollHeight'); if (textHeight === scrollHeight) { // not enough text to scroll return false; }; $page.after('<div id="page-controls"><button id="page-prev">prev</button><button id="page-next">next</button></div>'); $next = $('#page-next'); $prev = $('#page-prev'); $prev.hide(); $next.click(scrollDown); $prev.click(scrollUp); }; var scrollDown = function() { if ( ! canScroll) return; canScroll = false; var scrollTop = $page.scrollTop(); $prev.fadeIn(500); if (scrollTop == textHeight) { // can we scroll any lower? $next.fadeOut(500); } $page.animate({ scrollTop: '+=' + textHeight + 'px'}, 500, function() { canScroll = true; }); }; var scrollUp = function() { $next.fadeIn(500); $prev.fadeOut(500); $page.animate({ scrollTop: 0}, 500); }; $(document).ready(init); }()); Does this example use closures? I know it has functions within functions, but is there a case where the outer variables being preserved is being used? Am I using them without knowing it? Thanks Update Would this make a closure if I placed this beneath the $(document).ready(init); statement? return { scrollDown: scrollDown }; Could it then be, if I wanted to make the text scroll down from anywhere else in JavaScript, I could do pageScroll.scrollDown(); I'm going to have a play around on http://www.jsbin.com and report back

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • In Google Glass, Menu Items are not shown after XE 17.2 Update, any Solutions?

    - by Amalan Dhananjayan
    This worked when the Glass in on XE12, I have opened the solution after about 2 Months and now with XE17 the menu items are not shown when tapped on the Live card, instead the live card is disappearing. I have updated the GDK, I have changed the code to support the latest GDK sneak peek version 2 changes according to this (https://developers.google.com/glass/release-notes#xe12) This is the code public class MenuActivity extends Activity { private static final String TAG = MenuActivity.class.getSimpleName(); private VisionService.VisionBinder mVisionService; private ServiceConnection mConnection = new ServiceConnection() { @Override public void onServiceConnected(ComponentName name, IBinder service) { if (service instanceof VisionService.VisionBinder) { mVisionService = (VisionService.VisionBinder) service; openOptionsMenu(); } // No need to keep the service bound. unbindService(this); } @Override public void onServiceDisconnected(ComponentName name) { } }; private boolean mResumed; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); bindService(new Intent(this, VisionService.class), mConnection, 0); } @Override protected void onResume() { super.onResume(); mResumed = true; openOptionsMenu(); } @Override protected void onPause() { super.onPause(); mResumed = false; } @Override public void openOptionsMenu() { if (mResumed && mConnection != null) { super.openOptionsMenu(); } } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.menu, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { int id = item.getItemId(); if (id == R.id.action_send) { mVisionService.requestWorkOrderCard(); finish(); return true; } else if (id == R.id.action_refresh) { mVisionService.requestTopWorkOrders(); finish(); return true; } else if (id == R.id.action_finish) { stopService(new Intent(this, VisionService.class)); finish(); return true; } else { return super.onOptionsItemSelected(item); } } @Override public void onOptionsMenuClosed(Menu menu) { super.onOptionsMenuClosed(menu); } } It would be great if any body could help on this. Thank You

    Read the article

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • GridView's ItemContainerStyle and selection states

    - by Roberto Casadei
    I'm trying to change the appearance of gridview items when they are selected. (Before, I used a trick with an IsSelected property in the ViewModel object bound to the containing grid and a bool-to-color converter, but I recognize that it is bad) To do so, I do: <GridView ItemContainerStyle="{StaticResource GridViewItemContainerStyle}" ...> ... and <Style x:Key="GridViewItemContainerStyle" TargetType="GridViewItem"> <Setter Property="Background" Value="Red" /> <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="GridViewItem"> <Grid> <VisualStateManager.VisualStateGroups> <VisualStateGroup x:Name="CommonStates"> <VisualState x:Name="Normal"> <Storyboard> <ObjectAnimationUsingKeyFrames Storyboard.TargetProperty="(Grid.Background)" Storyboard.TargetName="itemGrid"> <DiscreteObjectKeyFrame KeyTime="0" Value="Black"/> </ObjectAnimationUsingKeyFrames> </Storyboard> </VisualState> </VisualStateGroup> <VisualStateGroup x:Name="SelectionStates"> <VisualState x:Name="UnselectedSwiping"/> <VisualState x:Name="UnselectedPointerOver"/> <VisualState x:Name="Selecting"/> <VisualState x:Name="Selected"> <Storyboard> <ObjectAnimationUsingKeyFrames Storyboard.TargetProperty="(Grid.Background)" Storyboard.TargetName="itemGrid"> <DiscreteObjectKeyFrame KeyTime="0" Value="White"/> </ObjectAnimationUsingKeyFrames> </Storyboard> </VisualState> <VisualState x:Name="SelectedSwiping"/> <VisualState x:Name="Unselecting"/> <VisualState x:Name="Unselected"/> <VisualState x:Name="SelectedUnfocused"/> </VisualStateGroup> </VisualStateManager.VisualStateGroups> <Grid ... x:Name="itemGrid"> <!-- HERE MY DATA TEMPLATE --> </Grid> </Grid> </ControlTemplate> </Setter.Value> </Setter> </Style> When I run the app, the items are Black (as in the "normal" state). But selecting them does not turn them into White. Where am I wrong? Moreover, it there a way to set "ItemContainerStyle" without having it to "overwrite" the "ItemTemplate" ???

    Read the article

  • Throwing cats out of windows

    - by AndrewF
    Imagine you're in a tall building with a cat. The cat can survive a fall out of a low story window, but will die if thrown from a high floor. How can you figure out the longest drop that the cat can survive, using the least number of attempts? Obviously, if you only have one cat, then you can only search linearly. First throw the cat from the first floor. If it survives, throw it from the second. Eventually, after being thrown from floor f, the cat will die. You then know that floor f-1 was the maximal safe floor. But what if you have more than one cat? You can now try some sort of logarithmic search. Let's say that the build has 100 floors and you have two identical cats. If you throw the first cat out of the 50th floor and it dies, then you only have to search 50 floors linearly. You can do even better if you choose a lower floor for your first attempt. Let's say that you choose to tackle the problem 20 floors at a time and that the first fatal floor is #50. In that case, your first cat will survive flights from floors 20 and 40 before dying from floor 60. You just have to check floors 41 through 49 individually. That's a total of 12 attempts, which is much better than the 50 you would need had you attempted to use binary elimination. In general, what's the best strategy and it's worst-case complexity for an n-storied building with 2 cats? What about for n floors and m cats? Assume that all cats are equivalent: they will all survive or die from a fall from a given window. Also, every attempt is independent: if a cat survives a fall, it is completely unharmed. This isn't homework, although I may have solved it for school assignment once. It's just a whimsical problem that popped into my head today and I don't remember the solution. Bonus points if anyone knows the name of this problem or of the solution algorithm.

    Read the article

  • Debugging a basic OpenGL texture fail? (iphone)

    - by Ben
    Hey all, I have a very basic texture map problem in GL on iPhone, and I'm wondering what strategies there are for debugging this kind of thing. (Frankly, just staring at state machine calls and wondering if any of them is wrong or misordered is no way to live-- are there tools for this?) I have a 512x512 PNG file that I'm loading up from disk (not specially packed), creating a CGBitmapContext, then calling CGContextDrawImage to get bytes out of it. (This code is essentially stolen from an Apple sample.) I'm trying to map the texture to a "quad", with code that looks essentially like this-- all flat 2D stuff, nothing fancy: glEnable(GL_TEXTURE_2D); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glEnableClientState(GL_TEXTURE_COORD_ARRAY); GLfloat vertices[8] = { viewRect.origin.x, viewRect.size.height, viewRect.origin.x, viewRect.origin.y, viewRect.size.width, viewRect.origin.y, viewRect.size.width, viewRect.size.height }; GLfloat texCoords[8] = { 0, 1.0, 0, 0, 1.0, 0, 1.0, 1.0 }; glBindTexture(GL_TEXTURE_2D, myTextureRef); // This was previously bound to glVertexPointer(2, GL_FLOAT , 0, vertices); glTexCoordPointer(2, GL_FLOAT, 0, texCoords); glDrawArrays(GL_TRIANGLE_FAN, 0, 4); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisable(GL_TEXTURE_2D); My supposedly textured area comes out just black. I see no debug output from the CG calls to set up the texture. glGetError reports nothing. If I simplify this code block to just draw the verts, but set up a pure color, the quad area lights up exactly as expected. If I clear the whole context immediately beforehand to red, I don't see the red-- which means something is being rendered there, but not the contents of my PNG. What could I be doing wrong? And more importantly, what are the right tools and techniques for debugging this sort of thing, because running into this kind of problem and not being able to "step through it" in a debugger in any meaningful way is a bummer. Thanks!

    Read the article

  • ASP.NET Repeater and DataBinder.Eval

    - by Fernando
    I've got a <asp:Repeater> in my webpage, which is bound to a programatically created dataset. The purpose of this repeater is to create an index from A-Z, which, when clicked, refreshes the information on the page. The repeater has a link button like so: <asp:LinkButton ID="indexLetter" Text='<%#DataBinder.Eval(Container.DataItem,"letter")%>' runat="server" CssClass='<%#DataBinder.Eval(Container.DataItem, "cssclass")%>' Enabled='<%#DataBinder.Eval(Container.DataItem,"enabled")%>'></asp:LinkButton> The dataset is created the following way: protected DataSet getIndex(String index) { DataSet ds = new DataSet(); ds.Tables.Add("index"); ds.Tables["index"].Columns.Add("letter"); ds.Tables["index"].Columns.Add("cssclass"); ds.Tables["index"].Columns.Add("enabled"); char alphaStart = Char.Parse("A"); char alphaEnd = Char.Parse("Z"); for (char i = alphaStart; i <= alphaEnd; i++) { String cssclass="", enabled="true"; if (index == i.ToString()) { cssclass = "selected"; enabled = "false"; } ds.Tables["index"].Rows.Add(new Object[3] {i.ToString(),cssclass,enabled }); } return ds; } However, when I run the page, a "Specified cast is not valid exception" is thrown in Text='<%#DataBinder.Eval(Container.DataItem,"letter")'. I have no idea why, I have tried manually casting to String with (String), I've tried a ToString() method, I've tried everything. Also, if in the debugger I add a watch for DataBinder.Eval(Container.DataItem,"letter"), the value it returns is "A", which according to me, should be fine for the Text Property. EDIT: Here is the exception: System.InvalidCastException was unhandled by user code Message="Specified cast is not valid." Source="App_Web_cmu9mtyc" StackTrace: at ASP.savecondition_aspx._DataBinding_control7(Object sender, EventArgs e) in e:\Documents and Settings\Fernando\My Documents\Visual Studio 2008\Projects\mediTrack\mediTrack\saveCondition.aspx:line 45 at System.Web.UI.Control.OnDataBinding(EventArgs e) at System.Web.UI.Control.DataBind(Boolean raiseOnDataBinding) at System.Web.UI.Control.DataBind() at System.Web.UI.Control.DataBindChildren() InnerException: Any advice will be greatly appreciated, thank you EDIT 2: Fixed! The problem was not in the Text or CSS tags, but in the Enabled tag, I had to cast it to a Boolean value. The problem was that the exception was signaled at the Text tag, I don't know why

    Read the article

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • Accessing parent-level controls from inside a ComboBox's child controls

    - by eponymous23
    I have XAML similar to this: <ListBox ItemsSource="{Binding SearchCriteria, Source={StaticResource model}}" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel Name="spCriterion" Orientation="Horizontal" Height="20"> <ComboBox Name="cboSearchCriterionType" Width="120" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ComboBox.Items> <ComboBoxItem IsSelected="True" Content="Anagram Match" /> <ComboBoxItem Content="Pattern Match" /> <ComboBoxItem Content="Subanagram Match" /> <ComboBoxItem Content="Length" /> <ComboBoxItem Content="Number of Vowels" /> <ComboBoxItem Content="Number of Anagrams" /> <ComboBoxItem Content="Number of Unique Letters" /> </ComboBox.Items> </ComboBox> <TextBox x:Name="SearchSpec" Text="{Binding SearchSpec}" /> <TextBox x:Name="MinValue" Text="{Binding MinValue}" Visibility="Collapsed" /> <TextBox x:Name="MaxValue" Text="{Binding MaxValue}" Visibility="Collapsed" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> As you can tell from the markup, I have a listbox that is bound to a collection of SearchCriterion objects (collectively contained in a SearchCriteria object). The idea is that the user can add/remove criterion items from the criteria, each criterion is represented by a listbox item. Inside the listbox item I have a combobox and three textboxes. What I'm trying to do is change the visibility of the TextBox controls depending on the item that is selected in the ComboBox. For example, if the user selects "Pattern Match" then I want to show only the first textbox and hide the latter two; conversely, if the user selects "Length" or any of the "Number of..." items, then I want to hide the first TextBox and show the latter two. What is the best way to achieve this? I was hoping to do something simple in the SelectionChanged event handler for the listbox but the textbox controls are presumably out of the SelectionChanged event's scope. Do I have to programmatically traverse the control hierarchy and find the controls?

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • What makes a Winform position initially stale?

    - by msorens
    The code below demonstrates a very simple problem; I am hoping that I am just missing a setting that someone might be able to reveal. Goal (1) Launch main winform (MainForm). (2) Press button to display secondary winform (ShadowForm) that is semi-transparent and should exactly overlay MainForm. What Actually Happens Scenario 1: Launch main winform then press button: ShadowForm displays with correct size but incorrect location, lower and to the right (as if it was cascaded). Press button to close ShadowForm again. Press button once more to reopen ShadowForm and now it is in the correct position, covering MainForm. Scenario 2: Launch main winform, move it around, then press button: ShadowForm displays with correct size but incorrect location (where the MainForm was before moving it). Press button to close; press again to reopen and now ShadowForm is in the correct position. using System; using System.Windows.Forms; namespace LocationTest { static class Program { static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new MainForm()); } } public class MainForm : Form { ShadowForm shadowForm = new ShadowForm(); Button button1 = new Button(); System.ComponentModel.IContainer components = null; public MainForm() { this.SuspendLayout(); this.button1.Location = new System.Drawing.Point(102, 44); this.button1.Size = new System.Drawing.Size(75, 23); this.button1.Text = "button1"; this.button1.Click += new System.EventHandler(this.button1_Click); this.ClientSize = new System.Drawing.Size(292, 266); this.Controls.Add(this.button1); this.ResumeLayout(false); } private void button1_Click(object sender, EventArgs e) { if (shadowForm.Visible) { shadowForm.Hide(); } else { shadowForm.Size = Size; // this always works shadowForm.Location = Location; // this fails first time, but works second time! shadowForm.Show(); } } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } public class ShadowForm : Form { private System.ComponentModel.IContainer components = null; public ShadowForm() { this.SuspendLayout(); this.BackColor = System.Drawing.Color.Black; this.FormBorderStyle = System.Windows.Forms.FormBorderStyle.None; this.Opacity = 0.5; this.Click += new System.EventHandler(this.ShadowForm_Click); this.ResumeLayout(false); } private void ShadowForm_Click(object sender, EventArgs e) { Hide(); } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to assign WPF resources to other resource tags

    - by Tom
    This is quite obscure, I may just be missing something extremely simple. Scenario 1 Lets say I create a gradient brush, like this in my <Window.Resources> section: <LinearGradientBrush x:Key="GridRowSelectedBackBrushGradient" StartPoint="0,0" EndPoint="0,1"> <GradientStop Color="#404040" Offset="0.0" /> <GradientStop Color="#404040" Offset="0.5" /> <GradientStop Color="#000000" Offset="0.6" /> <GradientStop Color="#000000" Offset="1.0" /> </LinearGradientBrush> Then much later on, I want to override the HighlightBrushKey for a DataGrid. I have basically done it like this (horrible); <LinearGradientBrush x:Key="{x:Static SystemColors.HighlightBrushKey}" GradientStops="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=GradientStops}" StartPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=StartPoint}" EndPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=EndPoint}" /> This is obviously not the most slick way of referencing a resource. I also came up with the following problem, which is almost identical. Scenario 2 Say I created two colors in my <Window.Resources> markup, like so: <SolidColorBrush x:Key="DataGridRowBackgroundBrush" Color="#EAF2FB" /> <SolidColorBrush x:Key="DataGridRowBackgroundAltBrush" Color="#FFFFFF" /> Then later on, I want to supply them in an Array, which feeds the ConverterParameter on a Binding so I can supply the custom Converter with my static resource instances: <Setter Property="Background"> <Setter.Value> <Binding RelativeSource="{RelativeSource Mode=Self}" Converter="{StaticResource BackgroundBrushConverter}"> <Binding.ConverterParameter> <x:Array Type="{x:Type Brush}"> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundBrush}, Path=Color}" /> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundAltBrush}, Path=Color}" /> </x:Array> </Binding.ConverterParameter> </Binding> </Setter.Value> </Setter> What I've done is attempt to rereference an existing resource, but in my efforts I've actually recreated the resource, and bound the properties so they match. Again, this is not ideal. Because I've now hit this problem at least twice, is there a better way? Thanks, Tom

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >