Search Results

Search found 15629 results on 626 pages for 'mod python'.

Page 165/626 | < Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >

  • Python decorator question

    - by nsharish
    decorator 1: def dec(f): def wrap(obj, *args, **kwargs): f(obj, *args,**kwargs) return wrap decorator 2: class dec: def __init__(self, f): self.f = f def __call__(self, obj, *args, **kwargs): self.f(obj, *args, **kwargs) A sample class, class Test: @dec def disp(self, *args, **kwargs): print(*args,**kwargs) The follwing code works with decorator 1 but not with decorator 2. a = Test() a.disp("Message") I dont understand why decorator 2 is not working here. Can someone help me with this?

    Read the article

  • Logical python question - handeling directories and files in them

    - by Konstantin
    Hello! I'm using this function to extract files from .zip archive and store it on the server: def unzip_file_into_dir(file, dir): import sys, zipfile, os, os.path os.makedirs(dir, 0777) zfobj = zipfile.ZipFile(file) for name in zfobj.namelist(): if name.endswith('/'): os.mkdir(os.path.join(dir, name)) else: outfile = open(os.path.join(dir, name), 'wb') outfile.write(zfobj.read(name)) outfile.close() And the usage: unzip_file_into_dir('/var/zips/somearchive.zip', '/var/www/extracted_zip') somearchive.zip have this structure: somearchive.zip 1.jpeg 2.jpeg another.jpeg or, somethimes, this one: somearchive.zip somedir/ 1.jpeg 2.jpeg another.jpeg Question is: how do I modify my function, so that my extracted_zip catalog would always contain just images, not images in another subdirectory, even if images are stored in somedir inside an archive.

    Read the article

  • Python problem with resize animate GIF

    - by gigimon
    Hello! I'm want to resize animated GIF with save animate. I'm try use PIL and PythonMagickWand (ImageMagick) and with some GIF's get bad frame. When I'm use PIL, it mar frame in read frame. For test, I'm use this code: from PIL import Image im = Image.open('d:/box_opens_closes.gif') im.seek(im.tell()+1) im.seek(im.tell()+1) im.seek(im.tell()+1) im.show() When I'm use MagickWand with this code: wand = NewMagickWand() MagickReadImage(wand, 'd:/Box_opens_closes.gif') MagickSetLastIterator(wand) length = MagickGetIteratorIndex(wand) MagickSetFirstIterator(wand) for i in range(0, length+1): MagickSetIteratorIndex(wand,i) MagickScaleImage(wand, 87, 58) MagickWriteImages(wand, 'path', 1) My GIF where I'm get bad frame this: test gif In GIF editor software, all freme is ok. Where problem? Thx

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Python: Embed Chaco in PyQt4 Mystery

    - by random guy
    How do i go about adding Chaco to an existing PyQt4 application? Hours of searches yielded little (search for yourself). So far i've figured i need the following lines: import os os.environ['ETS_TOOLKIT']='qt4' i could not find PyQt4-Chaco code anywhere on the internets i would be very grateful to anyone filling in the blanks to show me the simplest line plot possible (with 2 points) from PyQt4 import QtCore, QtGui import sys import os os.environ['ETS_TOOLKIT']='qt4' from enthought <blanks> : : app = QtGui.QApplication(sys.argv) main_window = QtGui.QMainWindow() main_window.setCentralWidget(<blanks>) main_window.show() app.exec_() print('bye') what Chaco/Enthought class inherits from QWidget ?

    Read the article

  • python fdb save huge data from database to file

    - by peter
    I have this script SELECT = """ select coalesce (p.ID,'') as id, coalesce (p.name,'') as name, from TABLE as p """ self.cur.execute(SELECT) for row in self.cur.itermap(): xml +=" <item>\n" xml +=" <id>" + id + "</id>\n" xml +=" <name>" + name + "</name>\n" xml +=" </item>\n\n" #save xml to file here f = open... and I need to save data from huge database to file. There are 10 000s (up to 40000) of items in my database and it takes very long time when script runs (1 hour and more) until finish. How can I take data I need from database and save it to file "at once"? (as quick as possible? I don't need xml output because I can process data from output on my server later. I just need to do it as quickly as possible. Any idea?) Many thanks!

    Read the article

  • Caching result of setUp() using Python unittest

    - by dbr
    I currently have a unittest.TestCase that looks like.. class test_appletrailer(unittest.TestCase): def setup(self): self.all_trailers = Trailers(res = "720", verbose = True) def test_has_trailers(self): self.failUnless(len(self.all_trailers) > 1) # ..more tests.. This works fine, but the Trailers() call takes about 2 seconds to run.. Given that setUp() is called before each test is run, the tests now take almost 10 seconds to run (with only 3 test functions) What is the correct way of caching the self.all_trailers variable between tests? Removing the setUp function, and doing.. class test_appletrailer(unittest.TestCase): all_trailers = Trailers(res = "720", verbose = True) ..works, but then it claims "Ran 3 tests in 0.000s" which is incorrect.. The only other way I could think of is to have a cache_trailers global variable (which works correctly, but is rather horrible): cache_trailers = None class test_appletrailer(unittest.TestCase): def setUp(self): global cache_trailers if cache_trailers is None: cache_trailers = self.all_trailers = all_trailers = Trailers(res = "720", verbose = True) else: self.all_trailers = cache_trailers

    Read the article

  • Global variables in Python

    - by rejinacm
    A global variable created in one function cannot be used in another function directly. Instead I need to store the global variable in a local variable of the function which needs its access. Am I correct? Why is it so?

    Read the article

  • Concatenate String to Evernote Markup Language (ENML) in python

    - by Adam the Mediocre
    I am looking to add a string containing the user's text input to the note.content of my note. After reading, I have found how to add resources, but I don't want the resource to be an attachment, I want it to be the actual text. Here is some of the code: title= self.textEditTitle.text() body= self.textEditBody.text() auth_token = "secret stuff!" client = EvernoteClient(token=auth_token, sandbox=True) note_store = client.get_note_store() nBody = "<?xml version=\"1.0\" encoding=\"UTF-8\"?>" nBody += "<!DOCTYPE en-note SYSTEM \"http://xml.evernote.com/pub/enml2.dtd\">" nBody += "<en-note>%s</en-note>" % body note = Types.Note() note.title = title note.content= nBody Any advice would be great, as I'm just starting out with this api and it looks like it's full of potential once I figure it out! Here is what I have been mostly reading from: http://dev.evernote.com/documentation/cloud/chapters/ENML.php

    Read the article

  • Python: Count lines and differentiate between them

    - by Mister X
    I'm using an application that gives a timed output based on how many times something is done in a minute, and I wish to manually take the output (copy paste) and have my program, and I wish to count how many times each minute it is done. An example output is this: 13:48 An event happened. 13:48 Another event happened. 13:49 A new event happened. 13:49 A random event happened. 13:49 An event happened. So, the program would need to understand that 2 things happened at 13:48, and 3 at 13:49. I'm not sure how the information would be stored, but I need to average them after, to determine an average of how often it happens. Sorry for being so complicated!

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

  • Find&Replace using Python - Binary file

    - by Aaron Hoffman
    Hello, I'm attempting to do a "find and replace" in a file on a Mac OS X computer. Although it appears to work correctly. It seems that the file is somehow altered. The text editor that I use (Text Wrangler) is unable to even open the file once this is completed. Here is the code as I have it: import fileinput for line in fileinput.FileInput("testfile.txt",inplace=1): line = line.replace("newhost",host) print line, When I view the file from the terminal, it does say "testfile" may be a binary file. See it anyway? Is there a chance that this replace is corrupting the file? Do I have another option for this to work? I really appreciate the help. Thank you, Aaron UPDATE: the actual file is NOT a .txt file it is a .plist file which is preference file in Mac OS X if that makes any difference

    Read the article

  • Can't iterate over a list class in Python

    - by Vicky
    I'm trying to write a simple GUI front end for Plurk using pyplurk. I have successfully got it to create the API connection, log in, and retrieve and display a list of friends. Now I'm trying to retrieve and display a list of Plurks. pyplurk provides a GetNewPlurks function as follows: def GetNewPlurks(self, since): '''Get new plurks since the specified time. Args: since: [datetime.datetime] the timestamp criterion. Returns: A PlurkPostList object or None. ''' offset = jsonizer.conv_datetime(since) status_code, result = self._CallAPI('/Polling/getPlurks', offset=offset) return None if status_code != 200 else \ PlurkPostList(result['plurks'], result['plurk_users'].values()) As you can see this returns a PlurkPostList, which in turn is defined as follows: class PlurkPostList: '''A list of plurks and the set of users that posted them.''' def __init__(self, plurk_json_list, user_json_list=[]): self._plurks = [PlurkPost(p) for p in plurk_json_list] self._users = [PlurkUser(u) for u in user_json_list] def __iter__(self): return self._plurks def GetUsers(self): return self._users def __eq__(self, other): if other.__class__ != PlurkPostList: return False if self._plurks != other._plurks: return False if self._users != other._users: return False return True Now I expected to be able to do something like this: api = plurk_api_urllib2.PlurkAPI(open('api.key').read().strip(), debug_level=1) plurkproxy = PlurkProxy(api, json.loads) user = plurkproxy.Login('my_user', 'my_pass') ps = plurkproxy.GetNewPlurks(datetime.datetime(2009, 12, 12, 0, 0, 0)) print ps for p in ps: print str(p) When I run this, what I actually get is: <plurk.PlurkPostList instance at 0x01E8D738> from the "print ps", then: for p in ps: TypeError: __iter__ returned non-iterator of type 'list' I don't understand - surely a list is iterable? Where am I going wrong - how do I access the Plurks in the PlurkPostList?

    Read the article

  • Python: How do sets work

    - by Guy
    I have a list of objects which I want to turn into a set. My objects contain a few fields that some of which are o.id and o.area. I want two objects to be equal if these two fields are the same. ie: o1==o2 if and only if o1.area==o2.area and o1.id==o2.id. I tried over-writing __eq__ and __cmp__ but I get the error: TypeError: unhashable instance. What should I over-write?

    Read the article

  • how can i randomly print an element from a list in python

    - by lm
    So far i have this, which prints out every word in my list, but i am trying to print only one word at random. Any suggestions? def main(): # open a file wordsf = open('words.txt', 'r') word=random.choice('wordsf') words_count=0 for line in wordsf: word= line.rstrip('\n') print(word) words_count+=1 # close the file wordsf.close()

    Read the article

  • Using the AND and NOT Operator in Python

    - by NoahClark
    Here is my custom class that I have that represents a triangle. I'm trying to write code that checks to see if self.a, self.b, and self.c are greater than 0, which would mean that I have Angle, Angle, Angle. Below you will see the code that checks for A and B, however when I use just self.a != 0 then it works fine. I believe I'm not using & correctly. Any ideas? Here is how I am calling it: print myTri.detType() class Triangle: # Angle A To Angle C Connects Side F # Angle C to Angle B Connects Side D # Angle B to Angle A Connects Side E def __init__(self, a, b, c, d, e, f): self.a = a self.b = b self.c = c self.d = d self.e = e self.f = f def detType(self): #Triangle Type AAA if self.a != 0 & self.b != 0: return self.a #If self.a > 10: #return AAA #Triangle Type AAS #elif self.a = 0: #return AAS #Triangle Type ASA #Triangle Type SAS #Triangle Type SSS #else: #return unknown

    Read the article

  • Using __str__ representation for printing objects in containers in Python

    - by BobDobbs
    I've noticed that when an instance with an overloaded str method is passed to the print() function as an argument, it prints as intended. However, when passing a container that contains one of those instances to print(), it uses the repr method instead. That is to say, print(x) displays the correct string representation of x, and print(x, y) works correctly, but print([x]) or print((x, y)) prints the repr representation instead. First off, why does this happen? Secondly, is there a way to correct that behavior of print() in this circumstance?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • I have an Errno 13 Permission denied with subprocess in python

    - by wDroter
    The line with the issue is ret=subprocess.call(shlex.split(cmd)) cmd = /usr/share/java -cp pig-hadoop-conf-Simpsons:lib/pig-0.8.1-cdh3u1-core.jar:lib/hadoop-core-0.20.2-cdh3u1.jar org.apache.pig.Main -param func=cat -param from =foo.txt -x mapreduce fsFunc.pig The error is. File "./run_pig.py", line 157, in process ret=subprocess.call(shlex.split(cmd)) File "/usr/lib/python2.7/subprocess.py", line 493, in call return Popen(*popenargs, **kwargs).wait() File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ errread, errwrite) File "/usr/lib/python2.7/subprocess.py", line 1249, in _execute_child raise child_exception OSError: [Errno 13] Permission denied Let me know if any more info is needed. Any help is appreciated. Thanks.

    Read the article

  • Python - pickling fails for numpy.void objects

    - by I82Much
    >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

    Read the article

  • Python: Created nested dictionary from list of paths

    - by sberry2A
    I have a list of tuples the looks similar to this (simplified here, there are over 14,000 of these tuples with more complicated paths than Obj.part) [ (Obj1.part1, {<SPEC>}), (Obj1.partN, {<SPEC>}), (ObjK.partN, {<SPEC>}) ] Where Obj goes from 1 - 1000, part from 0 - 2000. These "keys" all have a dictionary of specs associated with them which act as a lookup reference for inspecting another binary file. The specs dict contains information such as the bit offset, bit size, and C type of the data pointed to by the path ObjK.partN. For example: Obj4.part500 might have this spec, {'size':32, 'offset':128, 'type':'int'} which would let me know that to access Obj4.part500 in the binary file I must unpack 32 bits from offset 128. So, now I want to take my list of strings and create a nested dictionary which in the simplified case will look like this data = { 'Obj1' : {'part1':{spec}, 'partN':{spec} }, 'ObjK' : {'part1':{spec}, 'partN':{spec} } } To do this I am currently doing two things, 1. I am using a dotdict class to be able to use dot notation for dictionary get / set. That class looks like this: class dotdict(dict): def __getattr__(self, attr): return self.get(attr, None) __setattr__ = dict.__setitem__ __delattr__ = dict.__delitem__ The method for creating the nested "dotdict"s looks like this: def addPath(self, spec, parts, base): if len(parts) > 1: item = base.setdefault(parts[0], dotdict()) self.addPath(spec, parts[1:], item) else: item = base.setdefault(parts[0], spec) return base Then I just do something like: for path, spec in paths: self.lookup = dotdict() self.addPath(spec, path.split("."), self.lookup) So, in the end self.lookup.Obj4.part500 points to the spec. Is there a better (more pythonic) way to do this?

    Read the article

< Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >