Search Results

Search found 10556 results on 423 pages for 'practical approach'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 169/423 | < Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >

  • Cisco ASA user authentication options - OpenID, public RSA sig, others?

    - by Ryan
    My organization has a Cisco ASA 5510 which I have made act as a firewall/gateway for one of our offices. Most resources a remote user would come looking for exist inside. I've implemented the usual deal - basic inside networks with outbound NAT, one primary outside interface with some secondary public IPs in the PAT pool for public-facing services, a couple site-to-site IPSec links to other branches, etc. - and I'm working now on VPN. I have the WebVPN (clientless SSL VPN) working and even traversing the site-to-site links. At the moment I'm leaving a legacy OpenVPN AS in place for thick client VPN. What I would like to do is standardize on an authentication method for all VPN then switch to the Cisco's IPSec thick VPN server. I'm trying to figure out what's really possible for authentication for these VPN users (thick client and clientless). My organization uses Google Apps and we already use dotnetopenauth to authenticate users for a couple internal services. I'd like to be able to do the same thing for thin and thick VPN. Alternatively a signature-based solution using RSA public keypairs (ssh-keygen type) would be useful to identify user@hardware. I'm trying to get away from legacy username/password auth especially if it's internal to the Cisco (just another password set to manage and for users to forget). I know I can map against an existing LDAP server but we have LDAP accounts created for only about 10% of the user base (mostly developers for Linux shell access). I guess what I'm looking for is a piece of middleware which appears to the Cisco as an LDAP server but will interface with the user's existing OpenID identity. Nothing I've seen in the Cisco suggests it can do this natively. But RSA public keys would be a runner-up, and much much better than standalone or even LDAP auth. What's really practical here?

    Read the article

  • Storing and managing video files

    - by Ajay
    What approach is considered to be the best to store and manage video files? As databases are used for small textual data, are databases good enough to handle huge amounts of video/audio data? Are databases, the formidable solution? Apart from size of hard disk space required for centrally managing video/audio/image content, what are the requirements of hosting such a server?

    Read the article

  • Activation Function, Initializer function, etc, effects on neural networks for face detection

    - by harry
    There's various activation functions: sigmoid, tanh, etc. And there's also a few initializer functions: Nguyen and Widrow, random, normalized, constant, zero, etc. So do these have much effect on the outcome of a neural network specialising in face detection? Right now I'm using the Tanh activation function and just randomising all the weights from -0.5 to 0.5. I have no idea if this is the best approach though, and with 4 hours to train the network each time, I'd rather ask on here than experiment!

    Read the article

  • Texturing Issue when Overlaying images onto Camera preview SurfaceView

    - by Dervis Suleyman
    I am in the process of making an augmented reality application and I have successfully overlaid a 3d cube over a camera surface view. The Issue now is when I add a Texture the cube then flickers(with the texture on it) and disappears leaving the camera preview upon further research i discovered that the cube with the texture was disappearing behind the Camera preview. My Question is has anyone else had this issue and if yes what approach did you take to solve this. Heres another strange Issue when i take a print screen the cube is on-top of the camera Preview

    Read the article

  • Spring Security User

    - by DD
    What is best practise in Spring when creating a new user with custom attributes...to extend org.springframework.security.core.userdetails.User or to create the User in the UserDetailsService (this is the approach taken in the IceFaces tutorial). public UserDetails loadUserByUsername(String username) throws UsernameNotFoundException, DataAccessException { AppUser user = userDAO.findUser(username); if (user == null) throw new UsernameNotFoundException("User not found: " + username); else { return makeUser(user); } } private User makeUser(AppUser user) { return new User(user.getLogin(), user .getPassword(), true, true, true, true, makeGrantedAuthorities(user)); }

    Read the article

  • How to RESTful delete record Asp.Net Mvc 2

    - by Picflight
    I have delete links in my Asp.Net Mvc2 application. /{controller}/Delete/{id} It seems using link to delete has a security risk. Don’t use Delete Links because they create Security Holes I found this Implementing RESTful Routes & Controllers in ASP.NET MVC 2.0 but I am not sure how to implement a simple delete functionality using the new HttpDeleteAttribute class. Are there any examples on deleting, the RESTful approach?

    Read the article

  • round number in JavaScript to N decimal places

    - by Richard
    in JavaScript, the typical way to round a number to N decimal places is something like: function round_number(num, dec) { return Math.round(num * Math.pow(10, dec)) / Math.pow(10, dec); } However this approach will round to a maximum of N decimal places while I want to always round to N decimal places. For example "2.0" would be rounded to "2". Any ideas?

    Read the article

  • Passing arguments to an Rspec SpecTask

    - by Bayard Randel
    Rake allows for the following syntax: task :my_task, :arg1, :arg2 do |t, args| puts "Args were: #{args}" end I'd like to be able to do the same, but with RSpecs SpecTask. The following unfortunately fails: desc "Run example with argument" SpecTask.new('my_task'), :datafile do |t, args| t.spec_files = FileList['cvd*_spec.rb -datafile=#{args}'] t.spec_opts = ["-c -f specdoc"] end Is it possible to achieve this with a SpecTask, or is there an alternative approach?

    Read the article

  • json webservice security

    - by crisgomez
    I have a problem regarding json web service security. I tried to developed a sample web application using json webservice,but the problem is the url was exposed on the client side.So from there,anybody can make a program and call the service for a thousand times. Please take note, that the web service will be using for a registration page, in which checks if the user was exist on the database.So there is no authentication happened on this process. What are the approach to secure the calling of the exposed web service?

    Read the article

  • Free Editable Grid Component For Asp.Net MVC

    - by bplus
    Hi, I've seening quite a few posts on here regarding grids, but nothing specifically asking for a free grid component that supports editing. Has any body come across such a thing? Is there a JQuery pluggin that I could use? If not has anybody got any pointers on a good approach to writing my own (using asp.net mvc2 and/or jquery)? Thanks in advance!

    Read the article

  • How to make disconnected closed curves connected by adding a shortest path using MATLAB?

    - by user198729
    bwlabel can be used to get disconnected objects in an image: [L Ne] = bwlabel(image); I want to make the objects(But my target is only the contours(closed curve) of these objects) connected by adding a shortest path where necessary. How do I approach this? UPDATE Or how to dilate the closed curves so that they get connected? How to calculate the shortest path between two disconnected closed curves?

    Read the article

  • Debugging TestNG configuration failures

    - by Ula Karzelek
    I'm running testng from ant. I'm using my own test listeners. I'm refactoring the code and once a while I got [testng] Total tests run: 7, Failures: 0, Skips: 7 [testng] Configuration Failures: 1, Skips: 2 What will be the best approach to fix configuration failures?

    Read the article

  • How to use an IN clause in iBATIS?

    - by furtelwart
    I'm using iBATIS to create select statements. Now I would like to implement the following SQL statement with iBATIS: SELECT * FROM table WHERE col1 IN ('value1', 'value2'); With the following approach, the statement is not prepared correctly and no result returns: SELECT * FROM table WHERE col1 IN #listOfValues#; iBATIS seems to restructure this list and tries to interpret it as a string. How can I use the IN clause correctly?

    Read the article

  • Encryption messages in a queue between 2 dlls.

    - by scope-creep
    Hi, I'm sending messages between 1 dll and another, effectively posting messages onto the dll input queue and receiving a messages back from the dll output queue. These two dlls are very tightly integrated. DLL 1 is a producer,and DLL2 is the consumer. I want to encrypt the messages before they are sent. What would be the best approach? Any help would be appreciated.

    Read the article

  • Unit testing MVC.net Redirection

    - by Dan
    How do I Unit Test a MVC redirection? public ActionResult Create(Product product) { _productTask.Save(product); return RedirectToAction("Success"); } public ActionResult Success() { return View(); } Is Ayende's approach still the best way to go, with preview 5: public static void RenderView(this Controller self, string action) { typeof(Controller).GetMethod("RenderView").Invoke(self,new object[] { action} ); } Seems odd to have to do this, especially as the MVC team have said they are writing the framework to be testable.

    Read the article

  • Performing application reliability using iis 6/7

    - by Erup
    I have web-services applications, running on Windows Server 2003. These hosts (each of them on separate appPool) contains multiple operations (consulting services). Does exist an approach to perform reliability on these hosts, in terms of appPools? If there is a way to perform it in IIS 7 - or using WCF - I would appreciate the information. Thanks

    Read the article

  • MySQL & PHP: auto connect to DB or to properly way to pass host/db to MySQL methods

    - by SODA
    Hi, does anyone know of a known method in PHP to auto connect to MySQL db/table in case an app is using multiple databases on multiple hosts? Question 1: are there scripts around that allow to auto connect to necessary host/DB based on query? Question 2: if above is not possible, is there a known approach to properly passing host/DB info to make sure app is properly connected before executing the query?

    Read the article

  • Use single static image as map

    - by berve
    I have a single image (a flattened out image of the world map), I want to be able to plot some coordinates in this image without having to create a map server or whatever per se, Idon't know where to begin, whats the easiest approach

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >