Search Results

Search found 10556 results on 423 pages for 'practical approach'.

Page 172/423 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • Replace between 2 items in observableArray - knockout

    - by Yojik
    im tring to Replace between 2 items in observableArray with knockout but something is wrong.. after the replace of the items ,i will change and send the displayOrder property (in both itmems) to the server (or should i take other approach for this) rankDownMessage: function () { console.log("ranking down msg"); var currentItemindex = viewModel.messages.indexOf(this); var nextItemIndex = currentItemindex + 1; viewModel.messages.replace( viewModel.messages()[nextItemIndex], viewModel.messages()[currentItemindex] ); } only the first item changed to the second item but the second item doesnt become the first one

    Read the article

  • OpenGL: Implementing transformation matrix stack

    - by Jakub M.
    In a newer OpenGL there is no matrix stack. I am working on a simple display engine, and I am going to implement the transformation stack. What is a common strategy here? Should I build a push/pop stack, and use it with a tree representing my model? I suppose this is the "old" approach, that was deprecated in the newer OpenGL versions. Maybe then it is not the best solution (it was removed for some reason)

    Read the article

  • Linq to SQL - Returning two values with one query

    - by Sir Psycho
    Hi, Is it possible to return a single value and an enumerable collection using LINQ to SQL? The problem is, I'm trying to do paging across a large recordset. I only want to return 10 rows at a time so I'm using .Skip(20).Take(10) approach. However I need to know the total number of records so I can show an appropriate page x of y. Trying to avoid two separate queries. Thanks

    Read the article

  • How to use another type of EditingControl in a single C# 3.5 DataGridView column ?

    - by too
    Is this possible to have two (or more) different kinds of cells to be displayed interchangeably in single column of C# .Net 3.5 DataGridView? I know one column has specified single EditingControl type, yet I think grid is flexible enough to do some tricks, I may think of only: Adding as many invisible columns to grid as required types of cells and on CellBeginEdit somehow exchange current cell with other column's cell Create custom column and custom cell with possibility of changing EditingControl for single cell Which approach is better, are there any examples ?

    Read the article

  • Creating content input form with custom theme (Drupal)

    - by AndrewSmith
    I'm creating a site which I want to place content input form in custom themed template. I opted to do this because I wanted the whole site to be looked uniform. That said, I'm not sure as to what is the best approach to do this. Is it proper to invoke hook_insert/delete/update and hook_perm/hook_access by myself or is there anyway I can still use my custom theme and write a code in a way that drupal would take care of invoking appropriate hooks accordingly? Thanks in advance PS : I'm on drupal 6.x

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • IBOutlet on properties and exposition of the class

    - by Espuz
    Apple, for memory management issues, recommend defining outlets on properties, not in the attribute declaration. But, as far as I know, declaring properties exposes the class to external classes, so this could be dangerous. On UIViewController we have the main view definition and the logic, so MVC is slightly cheated in this cases. What is the beteer approach, Apples's recommendation for memory-management or armored classes?

    Read the article

  • How to improve variable overriding/overwriting in XSL?

    - by ChrisBenyamin
    I want to do the following: Declare a variable Go into a if-statement Overwrite the variable XSL says I can't declare a variable twice, so what can I do to improve this step? Another approach was to check if a variable is set at all. I did this, because i skipped the first step and declared the variable in the if-statement. In another if-statement I wanted to check if the variable exists at all.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Entity Framework 4 POCO with Dictionary

    - by Eric J.
    I have a POCO (Plain Old CLR Object) public Foo { public virtual int Id { get; set; } public virtual Dictionary<string, string> Stuff { get; set; } public virtual string More { get; set; } } Using the model first approach (i.e. I don't have a data model yet), how would I handle persisting Stuff (Dictionary)?

    Read the article

  • How to get width of button in DateTimePicker-Control/Controls in general?

    - by Inno
    Hello everybody, I implemented a custom DateTimePicker. On the DateTimePicker there is a button. In the examples I've found it's width is set to 16. This is working but I would like to have a dynamic approach. So, is there a way to get the size of this button or is there a general way to get information about .Net-Control sub elements like size etc.? Trying DateTimePicker.Controls didn't help me (it's empty).

    Read the article

  • How to pass operators as parameters

    - by Rodion Ingles
    I have to load an array of doubles from a file, multiply each element by a value in a table (different values for different elements), do some work on it, invert the multiplication (that is, divide) and then save the data back to file. Currently I implement the multiplication and division process in two separate methods. Now there is some extra work behind the scenes but apart from the specific statements where the multiplication/division occurs, the rest of the code is identical. As you can imagine, with this approach you have to be very careful making any changes. The surrounding code is not trivial, so its either a case of manually editing each method or copying changes from one method to the other and remembering to change the * and / operators. After too many close calls I am fed up of this and would like to make a common function which implements the common logic and two wrapper functions which pass which operator to use as a parameter. My initial approach was to use function pointers: MultiplyData(double data) { TransformData(data, &(operator *)); } DivideData(double data) { TransformData(data, &(operator /)); } TransformData(double data, double (*func)(double op1, double op2)) { /* Do stuff here... */ } However, I can't pass the operators as pointers (is this because it is an operator on a native type?), so I tried to use function objects. Initially I thought that multiplies and divides functors in <functional> would be ideal: MultiplyData(double data) { std::multiplies<double> multFunct; TransformData(data, &multFunct); } DivideData(double data) { std::divides<double> divFunct; TransformData(data, &divFunct); } TransformData(double data, std::binary_function<double, double, double> *funct) { /* Do stuff here... */ } As you can see I was trying to use a base class pointer to pass the functor polymorphically. The problem is that std::binary_function does not declare an operator() member for the child classes to implement. Is there something I am missing, or is the solution to implement my own functor heirarchy (which really seems more trouble than it is worth)?

    Read the article

  • How to create a horizontal scrollable list?

    - by Thomas Joos
    hi all, I am wondering what the best approach is for creating a horizontal list with custom buttons. I read there is no native control for that: I am considering a UIView with a scroll view inside. On this scrollview I visualize my array of button objects. Any thoughts?

    Read the article

  • Can I assigin value dynamically like this?

    - by kumar
    <input type="text" id="Date-<%=Model.ID%>" value= " + <%=Html.DisplayFor(model=>model.Date)%> + " /> is this right? i am trying to display value in input box dynamically? can anyone advice me is this corect approach? but still I am getting here only + + in input box? thanks

    Read the article

  • C# 4.0 Named Parameters - should they always be used when calling non-Framework methods?

    - by David Neale
    I really this is a hugely subjective topic but here is my current take: When calling methods which do not form part of the .NET BCL named parameters should always be used as the method signatures may well change, especially during the development cycle of my own applications. Although they might appear more verbose they are also far clearer. Is the above a reasonable approach to calling methods or have I overlooked something fundamental?

    Read the article

  • play background music continuously

    - by Ashish Rajan
    I am playing a background on my webpage by using miniswfloopplayer, now I want the music to play continuously throughout the website, currently the music starts all over again when a page loads which is quite obvious. I am looking for a approach where I can avoid the above situation. I know similar questions have been posted here, but they are inactive from a long time.

    Read the article

  • if else within CTE ?

    - by stackoverflowuser
    I want to execute select statement within CTE based on a codition. something like below ;with CTE_AorB ( if(condition) select * from table_A else select * from table_B ), CTE_C as ( select * from CTE_AorB // processing is removed ) But i get error on this. Is it possible to have if else within CTEs? If not is there a work around Or a better approach. Thanks.

    Read the article

  • Reactive Extensions for Java

    - by Timo Westkämper
    Is there any equivalent of Reactive Extensions (.NET) for Java? About Rx (Reactive Extensions) Rx is a library for composing asynchronous and event-based programs using observable collections. I am aware of rule engines such as Drools from JBOSS, but is there some other way that is closer to the Microsoft .NET approach?

    Read the article

  • Asp.net: Implementing Auto-Logout functionality

    - by renegadeMind
    Hi, I have to implement auto-logout functionality in one of my projects and i just cant figure out where to start looking for ideas but SO. What i need is for the application to redirect the user to the login page if the user session has expired. Please tell me as to what should be my approach to tackle this requirement. Problem Statement: If the user leaves the system for more than n minutes in any given log-in instance, the system should automatically log them off.

    Read the article

  • URL Controller Mapping Strategies (PHP)

    - by sunwukung
    This is kind of an academic question, so feel free to exit now. I've had a dig through Stack for threads pertaining to URL/Controller mapping in MVC frameworks - in particular this one: http://stackoverflow.com/questions/125677/php-application-url-routing So far, I can ascertain two practices: 1: dynamic mapping through parsing the URL string (exploded on '/') 2: pattern matching matching url to config file containing available routes I wanted to get some feedback (or links to some other threads/articles) from folks regarding their views on how best to approach this task.

    Read the article

  • Minimalist array creation in c#

    - by sipwiz
    I've always wanted to be able to use the line below but the C# compiler won't let me. To me it seems obvious and unambiguos as to what I want. myString.Trim({'[', ']'}); I can acheive my goal using: myString.Trim(new char[]{'[', ']'}); So I don't die wondering is there any other way to do it that is closer to the first approach?

    Read the article

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >