Search Results

Search found 10556 results on 423 pages for 'practical approach'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 172/423 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • How to cutomize a modelform widget in django 1.1?

    - by muudscope
    I'm trying to modify a django form to use a textarea instead of a normal input for the "address" field in my house form. The docs seem to imply this changed from django 1.1 (which I'm using) to 1.2. But neither approach is working for me. Here's what I've tried: class HouseForm(forms.ModelForm): address = forms.Textarea() # Should work with django 1.1, but doesn't class Meta: model = House #widgets = { 'address': forms.Textarea() } # 1.2 style - doesn't work either.

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • Linq to SQL - Returning two values with one query

    - by Sir Psycho
    Hi, Is it possible to return a single value and an enumerable collection using LINQ to SQL? The problem is, I'm trying to do paging across a large recordset. I only want to return 10 rows at a time so I'm using .Skip(20).Take(10) approach. However I need to know the total number of records so I can show an appropriate page x of y. Trying to avoid two separate queries. Thanks

    Read the article

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • How to get width of button in DateTimePicker-Control/Controls in general?

    - by Inno
    Hello everybody, I implemented a custom DateTimePicker. On the DateTimePicker there is a button. In the examples I've found it's width is set to 16. This is working but I would like to have a dynamic approach. So, is there a way to get the size of this button or is there a general way to get information about .Net-Control sub elements like size etc.? Trying DateTimePicker.Controls didn't help me (it's empty).

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Creating content input form with custom theme (Drupal)

    - by AndrewSmith
    I'm creating a site which I want to place content input form in custom themed template. I opted to do this because I wanted the whole site to be looked uniform. That said, I'm not sure as to what is the best approach to do this. Is it proper to invoke hook_insert/delete/update and hook_perm/hook_access by myself or is there anyway I can still use my custom theme and write a code in a way that drupal would take care of invoking appropriate hooks accordingly? Thanks in advance PS : I'm on drupal 6.x

    Read the article

  • How to allow users to transfer files to other users on linux

    - by Jon Bringhurst
    We have an environment of a few thousand users running applications on about 40 clusters ranging in size from 20 compute nodes to 98,000 compute nodes. Users on these systems generate massive files (sometimes 1PB) controlled by traditional unix permissions (ACLs usually aren't available or practical due to the specialized nature of the filesystem). We currently have a program called "give", which is a suid-root program that allows a user to "give" a file to another user when group permissions are insufficient. So, a user would type something like the following to give a file to another user: > give username-to-give-to filename-to-give ... The receiving user can then use a command called "take" (part of the give program) to receive the file: > take filename-to-receive The permissions of the file are then effectively transferred over to the receiving user. This program has been around for years and we'd like to revisit things from a security and functional point of view. Our current plan of action is to remove the bit rot in our current implementation of "give" and package it up as an open source app before we redeploy it into production. Does anyone have another method they use to transfer extremely large files between users when only traditional unix permissions are available?

    Read the article

  • Entity Framework 4 POCO with Dictionary

    - by Eric J.
    I have a POCO (Plain Old CLR Object) public Foo { public virtual int Id { get; set; } public virtual Dictionary<string, string> Stuff { get; set; } public virtual string More { get; set; } } Using the model first approach (i.e. I don't have a data model yet), how would I handle persisting Stuff (Dictionary)?

    Read the article

  • IBOutlet on properties and exposition of the class

    - by Espuz
    Apple, for memory management issues, recommend defining outlets on properties, not in the attribute declaration. But, as far as I know, declaring properties exposes the class to external classes, so this could be dangerous. On UIViewController we have the main view definition and the logic, so MVC is slightly cheated in this cases. What is the beteer approach, Apples's recommendation for memory-management or armored classes?

    Read the article

  • Asp.net: Implementing Auto-Logout functionality

    - by renegadeMind
    Hi, I have to implement auto-logout functionality in one of my projects and i just cant figure out where to start looking for ideas but SO. What i need is for the application to redirect the user to the login page if the user session has expired. Please tell me as to what should be my approach to tackle this requirement. Problem Statement: If the user leaves the system for more than n minutes in any given log-in instance, the system should automatically log them off.

    Read the article

  • How to pass operators as parameters

    - by Rodion Ingles
    I have to load an array of doubles from a file, multiply each element by a value in a table (different values for different elements), do some work on it, invert the multiplication (that is, divide) and then save the data back to file. Currently I implement the multiplication and division process in two separate methods. Now there is some extra work behind the scenes but apart from the specific statements where the multiplication/division occurs, the rest of the code is identical. As you can imagine, with this approach you have to be very careful making any changes. The surrounding code is not trivial, so its either a case of manually editing each method or copying changes from one method to the other and remembering to change the * and / operators. After too many close calls I am fed up of this and would like to make a common function which implements the common logic and two wrapper functions which pass which operator to use as a parameter. My initial approach was to use function pointers: MultiplyData(double data) { TransformData(data, &(operator *)); } DivideData(double data) { TransformData(data, &(operator /)); } TransformData(double data, double (*func)(double op1, double op2)) { /* Do stuff here... */ } However, I can't pass the operators as pointers (is this because it is an operator on a native type?), so I tried to use function objects. Initially I thought that multiplies and divides functors in <functional> would be ideal: MultiplyData(double data) { std::multiplies<double> multFunct; TransformData(data, &multFunct); } DivideData(double data) { std::divides<double> divFunct; TransformData(data, &divFunct); } TransformData(double data, std::binary_function<double, double, double> *funct) { /* Do stuff here... */ } As you can see I was trying to use a base class pointer to pass the functor polymorphically. The problem is that std::binary_function does not declare an operator() member for the child classes to implement. Is there something I am missing, or is the solution to implement my own functor heirarchy (which really seems more trouble than it is worth)?

    Read the article

  • Can I assigin value dynamically like this?

    - by kumar
    <input type="text" id="Date-<%=Model.ID%>" value= " + <%=Html.DisplayFor(model=>model.Date)%> + " /> is this right? i am trying to display value in input box dynamically? can anyone advice me is this corect approach? but still I am getting here only + + in input box? thanks

    Read the article

  • play background music continuously

    - by Ashish Rajan
    I am playing a background on my webpage by using miniswfloopplayer, now I want the music to play continuously throughout the website, currently the music starts all over again when a page loads which is quite obvious. I am looking for a approach where I can avoid the above situation. I know similar questions have been posted here, but they are inactive from a long time.

    Read the article

  • How to improve variable overriding/overwriting in XSL?

    - by ChrisBenyamin
    I want to do the following: Declare a variable Go into a if-statement Overwrite the variable XSL says I can't declare a variable twice, so what can I do to improve this step? Another approach was to check if a variable is set at all. I did this, because i skipped the first step and declared the variable in the if-statement. In another if-statement I wanted to check if the variable exists at all.

    Read the article

  • How to create a horizontal scrollable list?

    - by Thomas Joos
    hi all, I am wondering what the best approach is for creating a horizontal list with custom buttons. I read there is no native control for that: I am considering a UIView with a scroll view inside. On this scrollview I visualize my array of button objects. Any thoughts?

    Read the article

  • URL Controller Mapping Strategies (PHP)

    - by sunwukung
    This is kind of an academic question, so feel free to exit now. I've had a dig through Stack for threads pertaining to URL/Controller mapping in MVC frameworks - in particular this one: http://stackoverflow.com/questions/125677/php-application-url-routing So far, I can ascertain two practices: 1: dynamic mapping through parsing the URL string (exploded on '/') 2: pattern matching matching url to config file containing available routes I wanted to get some feedback (or links to some other threads/articles) from folks regarding their views on how best to approach this task.

    Read the article

  • Asp.net deployment with remote desktop

    - by Efe Kaptan
    Hi, i have a production server that does not have ftp access. Possible way to deploy files is connecting with remote desktop client and send files. As you know this approach is highly hard and time inefficient. Could you please provide me best practices to deploy in a more fast way? Thanks

    Read the article

  • Concatinating Multiple Rows in SQL

    - by Dave C
    Hello, I have a table structure that looks like this: ID String ----------- 1 A 1 Test 1 String 2 Dear 2 Person I need the final output to look like this: ID FullString -------------------- 1 A, Test, String 2 Dear, Person I am really lost on how to approach this... I looked on a couple examples online but they seemed to be VERY complex... this seems like it should be a real easy problem to solve in sql. Thank you for all assistance!

    Read the article

  • C# 4.0 Named Parameters - should they always be used when calling non-Framework methods?

    - by David Neale
    I really this is a hugely subjective topic but here is my current take: When calling methods which do not form part of the .NET BCL named parameters should always be used as the method signatures may well change, especially during the development cycle of my own applications. Although they might appear more verbose they are also far clearer. Is the above a reasonable approach to calling methods or have I overlooked something fundamental?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >