Search Results

Search found 57023 results on 2281 pages for 'object to string'.

Page 171/2281 | < Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >

  • JDO, GAE: Load object group by child's key

    - by tiex
    I have owned one-to-many relationship between two objects: @PersistenceCapable(identityType = IdentityType.APPLICATION) public class AccessInfo { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private com.google.appengine.api.datastore.Key keyInternal; ... @Persistent private PollInfo currentState; public AccessInfo(){} public AccessInfo(String key, String voter, PollInfo currentState) { this.voter = voter; this.currentState = currentState; setKey(key); // this key is unique in whole systme } public void setKey(String key) { this.keyInternal = KeyFactory.createKey( AccessInfo.class.getSimpleName(), key); } public String getKey() { return this.keyInternal.getName(); } and @PersistenceCapable(identityType = IdentityType.APPLICATION) public class PollInfo { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private Key key; @Persistent(mappedBy = "currentState") private List<AccessInfo> accesses; ... I created an instance of class PollInfo and make it persistence. It is ok. But then I want to load this group by AccessInfo key, and I am getting exception NucleusObjectNotFoundException. Is it possible to load a group by child's key?

    Read the article

  • CarrierWave and nested forms saving empty image object if photo :title is included in form

    - by Wasabi Developer
    I'm after some advice in regards to handling nested form data and I would be ever so grateful for any insights. The trouble is I'm not 100% sure why I require the following code in my model accepts_nested_attributes_for :holiday_image, allow_destroy: true, :reject_if => lambda { |a| a[:title].blank? } If I don't understand why I require to tact on on my accepts_nested_attributes_for association: :reject_if => lambda { |a| a[:title].blank? } If I remove this :reject_if lambda, it will save a blank holiday photo object in the database. I presume because it takes the :title field from the form as an empty string? I guess my question is, am I doing this right or is there a better way of this this within nested forms if I want to extend my HolidayImage model to include more strings like description, notes? Sorry If I can't be more succinct. My simple holiday app. # holiday.rb class Holiday < ActiveRecord::Base has_many :holiday_image accepts_nested_attributes_for :holiday_image, allow_destroy: true, :reject_if => lambda { |a| a[:title].blank? } attr_accessible :name, :content, :holiday_image_attributes end I'm using CarrierWave for image uploads. # holiday_image.rb class HolidayImage < ActiveRecord::Base belongs_to :holiday attr_accessible :holiday_id, :image, :title mount_uploader :image, ImageUploader end Inside my _form partial there is a field_for block <h3>Photo gallery</h3> <%= f.fields_for :holiday_image do |holiday_image| %> <% if holiday_image.object.new_record? %> <%= holiday_image.label :title, "Image Title" %> <%= holiday_image.text_field :title %> <%= holiday_image.file_field :image %> <% else %> Title: <%= holiday_image.object.title %> <%= image_tag(holiday_image.object.image.url(:thumb)) %> Tick to delete: <%= holiday_image.check_box :_destroy %> <% end %> Thanks again for your patience.

    Read the article

  • How to make a wxFrame behave like a modal wxDialog object

    - by dagorym
    Is is possible to make a wxFrame object behave like a modal dialog box in that the window creating the wxFrame object stops execution until the wxFrame object exits? I'm working on a small game and have run into the following problem. I have a main program window that hosts the main application (strategic portion). Occasionally, I need to transfer control to a second window for resolution of part of the game (tactical portion). While in the second window, I want the processing in the first window to stop and wait for completion of the work being done in the second window. Normally a modal dialog would do the trick but I want the new window to have some functionality that I can't seem to get with a wxDialog, namely a status bar at the bottom and the ability to resize/maximize/minimize the window (this should be possible but doesn't work, see this question How to get the minimize and maximize buttons to appear on a wxDialog object). As an addition note, I want the second window's functionality needs to stay completely decoupled from the primary window as it will be spun off into a separate program eventually. Has anyone done this or have any suggestions?

    Read the article

  • Variable reference problem when loading an object from a file in Java

    - by Snail
    I have a problem with the reference of a variable when loading a saved serialized object from a data file. All the variables referencing to the same object doesn't seem to update on the change. I've made a code snipped below that illustrates the problem. Tournament test1 = new Tournament(); Tournament test2 = test1; try { FileInputStream fis = new FileInputStream("test.out"); ObjectInputStream in = new ObjectInputStream(fis); test1 = (Tournament) in.readObject(); in.close(); } catch (IOException ex){ Logger.getLogger(Frame.class.getName()).log(Level.SEVERE, null, ex); } catch (ClassNotFoundException ex){ Logger.getLogger(Frame.class.getName()).log(Level.SEVERE, null, ex); } System.out.println("test1: " + test1); System.out.println("test2: " + test2); After this code is ran test1 and test2 doesn't reference to the same object anymore. To my knowledge they should do that since in the declaration of test2 makes it a reference to test1. When test1 is updated test2 should reflect the change and return the new object when called in the code. Am I missing something essential here or have I been misstaught about how the variable references in Java works?

    Read the article

  • Remove pointer object whose reference is mantained in three different lists

    - by brainydexter
    I am not sure how to approach this problem: 'Player' class mantains a list of Bullet* objects: class Player { protected: std::list< Bullet* > m_pBullet_list; } When the player fires a Bullet, it is added to this list. Also, inside the constructor of bullet, a reference of the same object is updated in CollisionMgr, where CollisionMgr also mantains a list of Bullet*. Bullet::Bullet(GameGL*a_pGameGL, Player*a_pPlayer) : GameObject( a_pGameGL ) { m_pPlayer = a_pPlayer; m_pGameGL->GetCollisionMgr()->AddBullet(this); } class CollisionMgr { void AddBullet(Bullet* a_pBullet); protected: std::list< Bullet*> m_BulletPList; } In CollisionMgr.Update(); based on some conditions, I populate class Cell which again contain a list of Bullet*. Finally, certain conditions qualify a Bullet to be deleted. Now, these conditions are tested upon while iterating through a Cell's list. So, if I have to delete the Bullet object, from all these places, how should I do it so that there are no more dangling references to it? std::list< Bullet*>::iterator bullet_it; for( bullet_it = (a_pCell->m_BulletPList).begin(); bullet_it != (a_pCell->m_BulletPList).end(); bullet_it++) { bool l_Bullet_trash = false; Bullet* bullet1 = *bullet_it; // conditions would set this to true if ( l_Bullet_Trash ) // TrashBullet( bullet1 ); continue; } Also, I was reading about list::remove, and it mentions that it calls the destructor of the object we are trying to delete. Given this info, if I delete from one list, the object does not exist, but the list would still contain a reference to it..How do I handle all these problems ? Can someone please help me here ? Thanks PS: If you want me to post more code or provide explanation, please do let me know.

    Read the article

  • NHibernate listener/event to replace object before insert/update

    - by vIceBerg
    Hi! I have a Company class which have a collection of Address. Here's my Address class:(written top of my head): public class Address { public string Civic; public string Street; public City City; } This is the City class: public class City { public int Id; public string Name; public string SearchableName{ get { //code } } } Address is persisted in his own table and have a reference to the city's ID. City are also persisted in is own table. The City's SearchableName is used to prevent some mistakes in the city the user type. For example, if the city name is "Montréal", the searchable name will be "montreal". If the city name is "St. John", the searchable name will be "stjohn", etc. It's used mainly to to search and to prevent having multiple cities with a typo in it. When I save an address, I want an listener/event to check if the city is already in the database. If so, cancel the insert and replace the user's city with the database one. I would like the same behavior with updates. I tried this: public bool OnPreInsert(PreInsertEvent @event) { City entity = (@event.Entity as City); if (entity != null) { if (entity.Id == 0) { var city = (from c in @event.Session.Linq<City>() where c.SearchableName == entity.SearchableName select c).SingleOrDefault(); if (city != null) { //don't know what to do here return true; } } } return false; } But if there's already a City in the database, I don't know what to do. @event.Entity is readonly, if I set @event.Entity.Id, I get an "null identifier" exception. I tried to trap insert/update on Address and on Company, but the City if the first one to get inserted (it's logic...) Any thoughts? Thanks

    Read the article

  • Serializing and deserializing a map with key as string

    - by Grace K
    Hi! I am intending to serialize and deserialize a hashmap whose key is a string. From Josh Bloch's Effective Java, I understand the following. P.222 "For example, consider the case of a harsh table. The physical representation is a sequence of hash buckets containing key-value entries. Which bucket an entry is placed in is a function of the hash code of the key, which is not, in general guaranteed to be the same from JVM implementation to JVM implementation. In fact, it isn't even guranteed to be the same from run to run on the same JVM implementation. Therefore accepting the default serialized form for a hash table would constitute a serious bug. Serializing and deserializing the hash table could yield an object whose invariants were seriously corrupt." My questions are: 1) In general, would overriding the equals and hashcode of the key class of the map resolve this issue and the map can be correctly restored? 2) If my key is a String and the String class is already overriding the hashCode() method, would I still have problem described above. (I am seeing a bug which makes me think this is probably still a problem even though the key is String with overriding hashCode.) 3)Previously, I get around this issue by serializing an array of entries (key, value) and when deserializing I would reconstruct the map. I am wondering if there is a better approach. 4) If the answers to question 1 and 2 are that I still can't be guaranteed. Could someone explain why? If the hashCodes are the same would they go to the same buckets across JVMs? Thanks, Grace

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • Setting String as Image Source in C#

    - by Dan
    UPDATE: Okay I've changed my code to this: if (appSettings.Contains("image")) { Uri uri = new Uri( (string)appSettings["image"] + ".jpg", UriKind.Absolute); ImageSource imgSource = new BitmapImage(uri); myImage.Source = imgSource; } else { Uri uriDefault = new Uri("default.jpg", UriKind.Absolute); ImageSource imgSourceDefault = new BitmapImage(uriDefault); myImage.Source = imgSourceDefault; } But now I get "Invalid URI: The format of the URI could not be determined". Well I've looked up several methods to fix this in my Windows Phone 7 app but I can't seem to find anything that works. What confuses me is that I've done something just like this before with no problem, so I'm not sure why it's not working. The code causing me the problem is this: if (appSettings.Contains("image")) { myImage.Source = (string)appSettings["image"]; } else { myImage.Source = "default.jpg"; } The error I get is this "Cannot implicitly convert type 'string' to 'System.Windows.Media.ImageSource". The reason this confuses me is because I did this Twitter app tutorial: http://weblogs.asp.net/scottgu/archive/2010/03/18/building-a-windows-phone-7-twitter-application-using-silverlight.aspx , in which you bind the image source directly to a string. So what can I do to remedy this?

    Read the article

  • javascript: "Object doesn't support this property or method" when ActiveX object called.

    - by agnieszka
    I've got simple html on Login.aspx with an ActiveX object: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html> <head><title></title> <script language="javaScript" type="text/javascript"> function getUserInfo() { var userInfo = MyActiveX.GetInfo(); form1.info.value = userInfo; form1.submit(); } </script> </head> <body onload="javascript:getUserInfo()"> <object id="MyActiveX" name="MyActiveX" codebase="MyActiveX.cab" classid="CLSID:C63E6630-047E-4C31-H457-425C8412JAI25"></object> <form name="form1" method="post" action="Login.aspx"> <input type="hidden" id="info" name="info" value="" /> </form> </body> </html> The code works perfectly fine on my machine (edit: hosted and run), it does't work on the other: there is an error "Object doesn't support this property or method" in the first line of javascript function. The cab file is in the same folder as the page file. I don't know javascript at all and have no idea why is the problem occuring. Googling didn't help. Do you ave any idea? Edit: on both machines IE was used and activex was enabled. Edit2: I also added if (document.MyActiveX) at the beggining of the function and I still get error in the same line of code - I mean it looks like document.MyActiveX is true but calling the method still fails

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Connecting to an RMI object without registry

    - by Mark Probst
    I think I need to connect to a remote RMI object without going through the registry, but I don't know how. My situation is this: I'm implementing a simple job distribution service which consists of one distributor and multiple workers. The distributor has a registered RMI object to which clients connect to send jobs, and workers connect to accept jobs. Unfortunately the distributor and worker hosts are behind a firewall. To get to the distributor host I am tunneling two ports (one for the registry, one for the distributor object) via SSH, so I can get to the registry and the distributor from outside the firewall. To make that work I have to set "-Djava.rmi.server.hostname=localhost" on the distributor JVM so that the clients connect to their local, tunneled port, instead of the port on the actual distributor host, which is blocked. This creates a problem for the workers, though, because they need to connect to the distributor directly, but because of the "localhost" redirection they behave like clients and try to connect to a port on their own host, which is not available, because I'm not tunneling on the workers (it is impractical). Now, if I could connect to a remote object directly by giving the hostname and port, I could do away both with the registry on the distributor and the "localhost" hack, and make the workers connect properly. How do I do that? Or is there a different solution to this problem?

    Read the article

  • WCF: Exposed Object Model - stuck in a loop

    - by Mark
    Hi I'm working on a pretty big WSSF project. I have a normal object model in the business layer. Eg a customer has an orders collection property, when this is accessed then it loads from the data layer (lazy loading). An order has a productCollection property etc etc.. Now the bit I'm finding tricky is exposing this via WCF. I want to export a collection of orders. The client app will also need information about the customers. Using the WSSF data contract designer I have set it up so that customers have a property called "order collection". This is fine if you have a customer object and would like to look at the orders but if you have an order object there is no customer property so it doesn't work going up the hierarchy. I've tried adding a customer property to the orders object but then the code gets stuck in a loop when it loads the data contracts up. This is because it doesn't load on demand like in the business layer. I need to load all properties up before the objects can be sent out via WCF. It ends up loading an order, then the customer for that order, then the orders for that customer, then the customer for that order etc etc... I'm sure I've got all this wrong. Help!!

    Read the article

  • Best way to transfer an Entity Framework object over the web and back via JSON

    - by AVH
    I've got some MVC code that serializes an EF 3.5 object into an anonymous type for return as a JSON result to an AJAX call on my page. The hurdle I have is that when I send the object back to the server via JSON, (and let the ModelBinder deserialize it for me into my EF type), I have to update it in my Entity Framework context manually. Or at least that's what I'm doing now. It has no EntityKey, so attaching it fails. I end up having to look up the old object and update it property by property. Any ideas around this? Is the solution to pass the EntityKey around with my object? Here's what I have: public void Update(Album album) { using (var db = new BandSitesMasterEntities()) { var albumToUpdate = db.Album.First(x => x.ID == album.ID); albumToUpdate.AlbumTitle = album.AlbumTitle; albumToUpdate.Description = album.Description; albumToUpdate.ReleaseYear = album.ReleaseYear; albumToUpdate.ImageURL = album.ImageURL; albumToUpdate.OtherURL = album.OtherURL; db.SaveChanges(); } } And here's what I'd like to do, or something similar: public void Update(Album album) { using (var db = new BandSitesMasterEntities()) { db.Attach(album) db.SaveChanges(); } }

    Read the article

  • Setting Nullable Integer to String Containing Nothing yields 0

    - by Brian MacKay
    I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

    Read the article

  • nHibernate storage of an object with self referencing many children and many parents

    - by AdamC
    I have an object called MyItem that references children in the same item. How do I set up an nhibernate mapping file to store this item. public class MyItem { public virtual string Id {get;set;} public virtual string Name {get;set;} public virtual string Version {get;set;} public virtual IList<MyItem> Children {get;set;} } So roughly the hbm.xml would be: <class name="MyItem" table="tb_myitem"> <id name="Id" column="id" type="String" length="32"> <generator class="uuid.hex" /> </id> <property name="Name" column="name" /> <property name="Version" column="version" /> <bag name="Children" cascade="all-delete-orphan" lazy="false"> <key column="children_id" /> <one-to-many class="MyItem" not-found="ignore"/> </bag> </class> This wouldn't work I don't think. Perhaps I need to create another class, say MyItemChildren and use that as the Children member and then do the mapping in that class? This would mean having two tables. One table holds the MyItem and the other table holds references from my item. NOTE: A child item could have many parents.

    Read the article

  • Cross-platform iteration of Unicode string

    - by kizzx2
    I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

    Read the article

  • Sending a JSON object to an ASP.NET web service using JQUERY ajax function

    - by uzay95
    I want to create object on the client side of aspx page. And i want to add functions to these javascript classes to make easier the life. Actually i can get and use the objects (derived from the server side classes) which returns from the services. When i wanted to send objects from the client by jquery ajax methods, i couldn't do it :) This is my javascript object: function ClassAndMark(_mark, _lesson){ this.Lesson = _lesson; this.Mark = _mark; } function Student(_name, _surname, _classAndMark){ this.Name = _name; this.SurName = _surname; this.ClassAndMark = _classAndMark; } JSClass.prototype.fSaveToDB(){ $.ajax({ type: "POST", contentType: "application/json; charset=utf-8", url: "/WS/SaveObject.asmx/fSaveToDB"), data: ????????????, dataType: "json" }); } Actually i don't know what should be definition of classes and methods on the Server side but i think: class ClassAndMark{ public string Lesson ; public string Mark ; } class Student{ public string Name ; public string SurName ; public ClassAndMark ClassAndMark ; } Web service is below but again i couldn't get what should be instead of the ???? : [WebMethod()] public void fSaveToDB(???? _obj) { // How can i convert input parameter/parameters // of method in the server side object? }

    Read the article

  • "Finding" an object instance of a known class?

    - by Sean C
    My first post here (anywhere for that matter!), re. Cocoa/Obj-C (I'm NOT up to speed on either, please be patient!). I hope I haven't missed the answer already, I did try to find it. I'm an old-school procedural dog (haven't done any programming since the mid 80's, so I probably just can't even learn new tricks), but OOP has my head spinning! My question is: is there any means at all to "discover/find/identify" an instance of an object of a known class, given that some OTHER unknown process instantiated it? eg. somthing that would accomplish this scenario: (id) anObj = [someTarget getMostRecentInstanceOf:[aKnownClass class]]; for that matter, "getAnyInstance" or "getAllInstances" might do the trick too. Background: I'm trying to write a plugin for a commercial application, so much of the heavy lifting is being done by the app, behind the scenes. I have the SDK & header files, I know what class the object is, and what method I need to call (it has only instance methods), I just can't identify the object for targetting. I've spent untold hours and days going over Apples documentation, tutorials and lots of example/sample code on the web (including here at Stack Overflow), and come up empty. Seems that everything requires a known target object to work, and I just don't have one. Since I may not be expressing my problem as clearly as needed, I've put up a web page, with diagram & working sample pages to illustrate: http://www.nulltime.com/svtest/index.html Any help or guidance will be appreciated! Thanks.

    Read the article

  • How to print each object in a collection in a separate page in Silverlight

    - by Ash
    I would like to know if its possible to print each object in a collection in separate pages using Silverlight printing API. Suppose I have a class Label public class Label { public string Address { get; set; } public string Country { get; set; } public string Name { get; set; } public string Town { get; set; } } I can use print API and print like this. private PrintDocument pd; private void PrintButton_Click(object sender, RoutedEventArgs e) { pd.Print("Test Print"); } private void pd_PrintPage(object sender, PrintPageEventArgs e) { Label labelToPrint = new Label() { Name = "Fake Name", Address = "Fake Address", Country = "Fake Country", Town = "Town" }; var printpage = new LabelPrint(); printpage.DataContext = new LabelPrintViewModel(labelToPrint); e.PageVisual = printpage; } LabelPrint Xaml <StackPanel x:Name="LayoutRoot" VerticalAlignment="Center" HorizontalAlignment="Center"> <TextBlock Text="{Binding Name}" /> <TextBlock Text="{Binding Address}" /> <TextBlock Text="{Binding Town}" /> <TextBlock Text="{Binding Country}" /> </StackPanel> Now, say I've a collection of Label objects, List<Label> labels = new List<Label>() { labelToPrint, labelToPrint, labelToPrint, labelToPrint }; How can I print each object in the list in separate pages ? Thanks for any suggestions ..

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • Getting the full-name of the current user, returns an empty string (C#/C++)

    - by Nir
    I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

    Read the article

  • object construct a class of objects in java

    - by Mgccl
    There is a super class, A, and there are many subclasses, B,C,D... people can write more subclasses. Each of the class have the method dostuff(), each is different in some way. I want an object that constructs any object that belong to A or any of it's subclass. For example I can pass the name of the subclass, or a object of that class, and it will construct another object of the class. Of course I can write A construct(A var){ stuff = var.dostuff(); domorestuff(stuff) return new A(stuff); } B construct(B var){ stuff = var.dostuff(); domorestuff(stuff) return new B(stuff); } C construct(C var){ stuff = var.dostuff(); domorestuff(stuff) return new C(stuff); } but this is not efficient. I have to write a few new lines every time I make a new subclass. It seems I can't use generics either. Because I can't use dostuff() on objects not in any of the subclass of A. What should I do in this situation?

    Read the article

  • How to marshal an object and its content (also objects)

    - by Waldo Spek
    I have a question for which I suspect the answer is a bit complex. At this moment I am programming a DLL (class library) in C#. This DLL uses a 3rd party library and therefore deals with 3rd party objects of which I do not have the source code. Now I am planning to create another DLL, which is going to be used in a later stadium in my application. This second DLL should use the 3rd party objects (with corresponding object states) created by the first DLL. Luckily the 3rd party objects extend the MarshalByRefObject class. I can marshal the objects using System.Runtime.Remoting.Marshal(...). I then serialize the objects using a BinaryFormatter and store the objects as a byte[] array. All goes well. I can deserialize and unmarshal in a the opposite way and end up with my original 3rd party objects...so it appears... Nevertheless, when calling methods on my 3rd party deserialized objects I get object internal exceptions. Normally these methods return other 3rd party objects, but (obviously - I guess) now these objects are missing because they weren't serialized. Now my global question: how would I go about marshalling/serializing all the objects which my 3rd party objects reference...and cascade down the "reference tree" to obtain a full and complete serialized object? Right now my guess is to preprocess: obtain all the objects and build my own custom object and serialize it. But I'm hoping there is some other way...

    Read the article

< Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >