Search Results

Search found 4650 results on 186 pages for 'perfect hash'.

Page 171/186 | < Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >

  • 8bpp Bitmap format on the Compact Framework

    - by Kieran
    Hi friends. I am messing around with Conway's Game of Life - http://en.wikipedia.org/wiki/Conway's_Game_of_Life I started out coding algorithmns for winforms and now want to port my work onto windows mobile 6.1 (compact framework). I came across an article by Jon Skeet where he compared several different algorithmns for calculating next generations in the game. He used an array of bytes to store a cells state (alive or dead) and then he would copy this array to an 8bpp bitmap. For each new generation, he works out the state of each byte, then copies the array to a bitmap, then draws that bitmap to a picturebox. void CreateInitialImage() { bitmap = new Bitmap(Width, Height, PixelFormat.Format8bppIndexed); ColorPalette palette = bitmap.Palette; palette.Entries[0] = Color.Black; palette.Entries[1] = Color.White; bitmap.Palette = palette; } public Image Render() { Rectangle rect = new Rectangle(0, 0, Width, Height); BitmapData bmpData = bitmap.LockBits(rect, ImageLockMode.ReadWrite, bitmap.PixelFormat); Marshal.Copy(Data, 0, bmpData.Scan0, Data.Length); bitmap.UnlockBits(bmpData); return bitmap; } His code above is beautifully simple and very fast to render. Jon is using Windows Forms but now I want to port my own version of this onto Windows Mobile 6.1 (Compact Framework) but . . . .there is no way to format a bitmap to 8bpp in the cf. Can anyone suggest a way of rendering an array of bytes to a drawable image in the CF. This array is created in code on the fly (it is NOT loaded from an image file on disk). I basically need to store an array of cells represented by bytes, they are either alive or dead and I then need to draw that array as an image. The game is particularly slow on the CF so I need to implement clever optimised algoritmns but also need to render as fast as possible and the above solution would be pretty dam perfect if only it was available on the compact framework. Many thanks for any help Any suggestions?

    Read the article

  • Sending HTML email from PHP

    - by KevinM
    I am trying to send a simple HTML e-mail from PHP. The code below simply results in a blank e-mail in GMail. It also has an empty attachment called 'noname', which is not at all what I want; though that might just be a symptom of it not working. The code I am using is: <?php //define the receiver of the email $to = '[email protected]'; //define the subject of the email $subject = 'Test HTML email'; //create a boundary string. It must be unique //so we use the MD5 algorithm to generate a random hash $random_hash = md5(date('r', time())); //define the headers we want passed. Note that they are separated with \r\n $headers = "From: [email protected]\r\nReply-To: [email protected]"; //add boundary string and mime type specification $headers .= "\r\nContent-Type: multipart/alternative; boundary=\"PHP-alt-".$random_hash."\""; //define the body of the message. ob_start(); //Turn on output buffering ?> --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Hello World!!! This is simple text email message. --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: 7bit <h2>Hello World!</h2> <p>This is something with <b>HTML</b>formatting.</p> --PHP-alt-<?php echo $random_hash; ?>-- <? //copy current buffer contents into $message variable and delete current output buffer $message = ob_get_clean(); //send the email $mail_sent = @mail( $to, $subject, $message, $headers ); //if the message is sent successfully print "Mail sent". Otherwise print "Mail failed" echo $mail_sent ? "Mail sent" : "Mail failed";

    Read the article

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • Performance of SHA-1 Checksum from Android 2.2 to 2.3 and Higher

    - by sbrichards
    In testing the performance of: package com.srichards.sha; import android.app.Activity; import android.os.Bundle; import android.widget.TextView; import java.io.IOException; import java.io.InputStream; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import com.srichards.sha.R; public class SHAHashActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); TextView tv = new TextView(this); String shaVal = this.getString(R.string.sha); long systimeBefore = System.currentTimeMillis(); String result = shaCheck(shaVal); long systimeResult = System.currentTimeMillis() - systimeBefore; tv.setText("\nRunTime: " + systimeResult + "\nHas been modified? | Hash Value: " + result); setContentView(tv); } public String shaCheck(String shaVal){ try{ String resultant = "null"; MessageDigest digest = MessageDigest.getInstance("SHA1"); ZipFile zf = null; try { zf = new ZipFile("/data/app/com.blah.android-1.apk"); // /data/app/com.blah.android-2.apk } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } ZipEntry ze = zf.getEntry("classes.dex"); InputStream file = zf.getInputStream(ze); byte[] dataBytes = new byte[32768]; //65536 32768 int nread = 0; while ((nread = file.read(dataBytes)) != -1) { digest.update(dataBytes, 0, nread); } byte [] rbytes = digest.digest(); StringBuffer sb = new StringBuffer(""); for (int i = 0; i< rbytes.length; i++) { sb.append(Integer.toString((rbytes[i] & 0xff) + 0x100, 16).substring(1)); } if (shaVal.equals(sb.toString())) { resultant = ("\nFalse : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } else { resultant = ("\nTrue : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } return resultant; } catch (IOException e) { e.printStackTrace(); } catch (NoSuchAlgorithmException e) { e.printStackTrace(); } return null; } } On a 2.2 Device I get average runtime of ~350ms, while on newer devices I get runtimes of 26-50ms which is substantially lower. I'm keeping in mind these devices are newer and have better hardware but am also wondering if the platform and the implementation affect performance much and if there is anything that could reduce runtimes on 2.2 devices. Note, the classes.dex of the .apk being accessed is roughly 4MB. Thanks!

    Read the article

  • How is "clean" testing done on the Macintosh without virtualization?

    - by Schnapple
    One of the things I've run across on Windows is when a web browser plugin or program you're developing makes an assumption that something is installed that, by default, isn't always present on Windows. A perfect example would be .NET - a whole lot of people running Windows XP have never installed any versions of .NET and so the installer needs to detect and remedy this if necessary. The way I've been testing this in Windows is to have a virtual machine with a snapshot of a clean, patched, but otherwise untouched install of XP or Vista or 7 or whatever. When I'm done testing I just discard any changes since the snapshot. Works great. I'm now developing something for the Macintosh, a platform which is very new to me, and I'm seeing that virtualization does not appear to be an option. It's explicitly forbidden in the EULA of Mac OS X, it's only allowed from Mac OS X Server, which seeing as how I'm targeting an end product is of no use to me, and the one program I see which can virtualize it - VirtualBox - only supports the server and actively nukes any discussion of running the consumer/client version of Mac OS X. And the only instructions I find anywhere on the topic seem to involve the use of "hacking" programs which is very much incompatible with the full-time gig I'm trying to do this for. So it looks like virtualization is out, but at various points I'm going to want or need to simulate what it's like to install and run this software on a "clean" Macintosh. How do people usually do this? Just buy multiple Macintoshes and use Time Machine? Am I thinking about this all wrong and everything Just Works? To be clear I'm not trying to run Mac OS X on a Windows machine. I have a Macintosh, I'm fine with virtualizing Mac OS X on Apple hardware, I'm just not seeing a route to making the non-Server version do this. I'm aware that Mac OS X Server can be virtualized but that's not what I'm going for. I'm aware that there are unsanctioned/unsupported methods of making Mac OS X run in virtualization programs like VirtualBox but for legal reasons I am not interested in those. My question is not "how can I do this?" but rather "so this thing I do on Windows seems to not be possible, generally, on the Macintosh, so what do people do to achieve what I'm going for?"

    Read the article

  • How can I have a Makefile automatically rebuild source files that include a modified header file? (I

    - by Nicholas Flynt
    I have the following makefile that I use to build a program (a kernel, actually) that I'm working on. Its from scratch and I'm learning about the process, so its not perfect, but I think its powerful enough at this point for my level of experience writing makefiles. AS = nasm CC = gcc LD = ld TARGET = core BUILD = build SOURCES = source INCLUDE = include ASM = assembly VPATH = $(SOURCES) CFLAGS = -Wall -O -fstrength-reduce -fomit-frame-pointer -finline-functions \ -nostdinc -fno-builtin -I $(INCLUDE) ASFLAGS = -f elf #CFILES = core.c consoleio.c system.c CFILES = $(foreach dir,$(SOURCES),$(notdir $(wildcard $(dir)/*.c))) SFILES = assembly/start.asm SOBJS = $(SFILES:.asm=.o) COBJS = $(CFILES:.c=.o) OBJS = $(SOBJS) $(COBJS) build : $(TARGET).img $(TARGET).img : $(TARGET).elf c:/python26/python.exe concat.py stage1 stage2 pad.bin core.elf floppy.img $(TARGET).elf : $(OBJS) $(LD) -T link.ld -o $@ $^ $(SOBJS) : $(SFILES) $(AS) $(ASFLAGS) $< -o $@ %.o: %.c @echo Compiling $<... $(CC) $(CFLAGS) -c -o $@ $< #Clean Script - Should clear out all .o files everywhere and all that. clean: -del *.img -del *.o -del assembly\*.o -del core.elf My main issue with this makefile is that when I modify a header file that one or more C files include, the C files aren't rebuilt. I can fix this quite easily by having all of my header files be dependencies for all of my C files, but that would effectively cause a complete rebuild of the project any time I changed/added a header file, which would not be very graceful. What I want is for only the C files that include the header file I change to be rebuilt, and for the entire project to be linked again. I can do the linking by causing all header files to be dependencies of the target, but I cannot figure out how to make the C files be invalidated when their included header files are newer. I've heard that GCC has some commands to make this possible (so the makefile can somehow figure out which files need to be rebuilt) but I can't for the life of me find an actual implementation example to look at. Can someone post a solution that will enable this behavior in a makefile? EDIT: I should clarify, I'm familiar with the concept of putting the individual targets in and having each target.o require the header files. That requires me to be editing the makefile every time I include a header file somewhere, which is a bit of a pain. I'm looking for a solution that can derive the header file dependencies on its own, which I'm fairly certain I've seen in other projects.

    Read the article

  • Using Constants in Perl

    - by David W.
    I am trying to define constants in Perl using the use Constant pragma: use Constant { FOO => "bar", BAR => "foo" }; I'm running into a bit of trouble, and hoping there's a standard way of handling it. First of all... I am defining a hook script for Subversion. To make things simple, I want to have a single file where the class (package) I'm using is in the same file as my actual script. Most of this package will have constants involved in it: print "This is my program"; package "MyClass"; use constant { FOO => "bar" }; sub new { yaddah, yaddah, yaddah. I would like my constant FOO to be accessible to my main program. I would like to do this without having to refer to it as MyClass::FOO. Normally, when the package is a separate file, I could do this in my main program: use MyClass qw(FOO); but, since my class and program are a single file, I can't do that. What would be the best way for my main program to be able to access my constants defined in my class? The second issue... I would like to use the constant values as hash keys: $myHash{FOO} = "bar"; The problem is that %myHash has the literal string FOO as the key and not the value of the constant. This causes problems when I do things like this: if (defined($myHash{FOO})) { print "Key " . FOO . " does exist!\n"; } I could force the context: if (defined("" . FOO . "")) { I could add parentheses: if (defined(FOO())) { Or, I could use a temporary variable: my $foo = FOO; if (defined($foo)) { None of these are really nice ways of handling this issue. So, what is the best way? Is there one way I'm missing? By the way, I don't want to use Readonly::Scalar because it is 1). slow, and 2). not part of the standard Perl package. I want to define my hook not to require additional Perl packages and to be as simple as possible to work.

    Read the article

  • Cannot export a fusionchart with 'Embedding Charts Using <OBJECT>/<EMBED> Tags'

    - by zoom_pat277
    I am trying to export a fusion chart created using 'Embedding Charts Using / Tags'. Export works just perfect with the right click (on the chart) and chose a pdf to export. But I am not able to make this work via javascript. I have a button outside the chart which upon clicking calls the function below function myexport() { var object = getChartFromId('myChartid'); if( object.hasRendered() ) object.exportChart({exportFormat: 'PDF'}); } the object above returned is null and this fails on the next line here is the full prototype <html> <head> <title>My Chart</title> <script type="text/javascript" src="fusionCharts.debug.js"></script> <script type="text/javascript" src="fusionChartsExportComponent.js"></script> <script type="text/javascript"> function ExportMyChart() { var cObject = getChartFromId('Column3D'); if( cObject.hasRendered() ) cObject.exportChart({exportFormat: 'PDF'}); } </script> </head> <body> <object width="400" height="400" id="Column3D" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=8,0,0,0" > <param name="testname" value="Column3D.swf" /> <param name="FlashVars" value="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0"> <param name="quality" value="high" /> <embed src="Column3D.swf" flashVars="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0" width="400" height="300" name="Column3D" quality="high" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /> </object> <!-- We also create a DIV to contain the FusionCharts client-side exporter component --> <div id="holderDiv" align="center">FusionCharts Export Handler Component</div> <script type="text/javascript"> var myExportComponent = new FusionChartsExportObject("testExporter1", "FCExporter.swf"); //Render the exporter SWF in our DIV fcexpDiv myExportComponent.Render("holderDiv"); </script> <input type="button" value="Export My Chart" onclick="ExportMyChart()" />

    Read the article

  • help Implementing Object Oriented ansi-C approach??

    - by No Money
    Hey there, I am an Intermediate programmer in Java and know some of the basics in C++. I recently started to scam over "C language" [please note that i emphasized on C language and want to stick with C as i found it to be a perfect tool, so no need for suggestions focusing on why should i move back to C++ or Java]. Moving on, I code an Object Oriented approach in C but kindda scramble with the pointers part. Please understand that I am just a noob trying to extend my knowledge beyond what i learned in High School. Here is my code..... #include <stdio.h> typedef struct per{ int privateint; char *privateString; struct per (*New) (); void (*deleteperOBJ) (struct t_person *); void (*setperNumber) ((struct*) t_person,int); void (*setperString) ((struct*) t_person,char *); void (*dumpperState) ((struct*) t_person); }t_person; void setperNumber(t_person *const per,int num){ if(per==NULL) return; per->privateint=num; } void setperString(t_person *const per,char *string){ if(per==NULL) return; per->privateString=string; } void dumpperState(t_person *const per){ if(per==NULL) return; printf("value of private int==%d\n", per->privateint); printf("value of private string==%s\n", per->privateString); } void deleteperOBJ(struct t_person *const per){ free((void*)t_person->per); t_person ->per = NULL; } main(){ t_person *const per = (struct*) malloc(sizeof(t_person)); per = t_person -> struct per -> New(); per -> setperNumber (t_person *per, 123); per -> setperString(t_person *per, "No money"); dumpperState(t_person *per); deleteperOBJ(t_person *per); } Just to warn you, this program has several errors and since I am a beginner I couldn't help except to post this thread as a question. I am looking forward for assistance. Thanks in advance.

    Read the article

  • Calculating rotation and translation matrices between two odometry positions for monocular linear triangulation

    - by user1298891
    Recently I've been trying to implement a system to identify and triangulate the 3D position of an object in a robotic system. The general outline of the process goes as follows: Identify the object using SURF matching, from a set of "training" images to the actual live feed from the camera Move/rotate the robot a certain amount Identify the object using SURF again in this new view Now I have: a set of corresponding 2D points (same object from the two different views), two odometry locations (position + orientation), and camera intrinsics (focal length, principal point, etc.) since it's been calibrated beforehand, so I should be able to create the 2 projection matrices and triangulate using a basic linear triangulation method as in Hartley & Zissermann's book Multiple View Geometry, pg. 312. Solve the AX = 0 equation for each of the corresponding 2D points, then take the average In practice, the triangulation only works when there's almost no change in rotation; if the robot even rotates a slight bit while moving (due to e.g. wheel slippage) then the estimate is way off. This also applies for simulation. Since I can only post two hyperlinks, here's a link to a page with images from the simulation (on the map, the red square is simulated robot position and orientation, and the yellow square is estimated position of the object using linear triangulation.) So you can see that the estimate is thrown way off even by a little rotation, as in Position 2 on that page (that was 15 degrees; if I rotate it any more then the estimate is completely off the map), even in a simulated environment where a perfect calibration matrix is known. In a real environment when I actually move around with the robot, it's worse. There aren't any problems with obtaining point correspondences, nor with actually solving the AX = 0 equation once I compute the A matrix, so I figure it probably has to do with how I'm setting up the two camera projection matrices, specifically how I'm calculating the translation and rotation matrices from the position/orientation info I have relative to the world frame. How I'm doing that right now is: Rotation matrix is composed by creating a 1x3 matrix [0, (change in orientation angle), 0] and then converting that to a 3x3 one using OpenCV's Rodrigues function Translation matrix is composed by rotating the two points (start angle) degrees and then subtracting the final position from the initial position, in order to get the robot's straight and lateral movement relative to its starting orientation Which results in the first projection matrix being K [I | 0] and the second being K [R | T], with R and T calculated as described above. Is there anything I'm doing really wrong here? Or could it possibly be some other problem? Any help would be greatly appreciated.

    Read the article

  • Setting up Netbeans/Eclipse for Linux Kernel Development

    - by red.october
    Hi: I'm doing some Linux kernel development, and I'm trying to use Netbeans. Despite declared support for Make-based C projects, I cannot create a fully functional Netbeans project. This is despite compiling having Netbeans analyze a kernel binary that was compiled with full debugging information. Problems include: files are wrongly excluded: Some files are incorrectly greyed out in the project, which means Netbeans does not believe they should be included in the project, when in fact they are compiled into the kernel. The main problem is that Netbeans will miss any definitions that exist in these files, such as data structures and functions, but also miss macro definitions. cannot find definitions: Pretty self-explanatory - often times, Netbeans cannot find the definition of something. This is partly a result of the above problem. can't find header files: self-explanatory I'm wondering if anyone has had success with setting up Netbeans for Linux kernel development, and if so, what settings they used. Ultimately, I'm looking for Netbeans to be able to either parse the Makefile (preferred) or extract the debug information from the binary (less desirable, since this can significantly slow down compilation), and automatically determine which files are actually compiled and which macros are actually defined. Then, based on this, I would like to be able to find the definitions of any data structure, variable, function, etc. and have complete auto-completion. Let me preface this question with some points: I'm not interested in solutions involving Vim/Emacs. I know some people like them, but I'm not one of them. As the title suggest, I would be also happy to know how to set-up Eclipse to do what I need While I would prefer perfect coverage, something that only misses one in a million definitions is obviously fine SO's useful "Related Questions" feature has informed me that the following question is related: http://stackoverflow.com/questions/149321/what-ide-would-be-good-for-linux-kernel-driver-development. Upon reading it, the question is more of a comparison between IDE's, whereas I'm looking for how to set-up a particular IDE. Even so, the user Wade Mealing seems to have some expertise in working with Eclipse on this kind of development, so I would certainly appreciate his (and of course all of your) answers. Cheers

    Read the article

  • AngularJS: download pdf file from the server

    - by Bartosz Bialecki
    I want to download a pdf file from the web server using $http. I use this code which works great, my file only is save as a html file, but when I open it it is opened as pdf but in the browser. I tested it on Chrome 36, Firefox 31 and Opera 23. This is my angularjs code (based on this code): UserService.downloadInvoice(hash).success(function (data, status, headers) { var filename, octetStreamMime = "application/octet-stream", contentType; // Get the headers headers = headers(); if (!filename) { filename = headers["x-filename"] || 'invoice.pdf'; } // Determine the content type from the header or default to "application/octet-stream" contentType = headers["content-type"] || octetStreamMime; if (navigator.msSaveBlob) { var blob = new Blob([data], { type: contentType }); navigator.msSaveBlob(blob, filename); } else { var urlCreator = window.URL || window.webkitURL || window.mozURL || window.msURL; if (urlCreator) { // Try to use a download link var link = document.createElement("a"); if ("download" in link) { // Prepare a blob URL var blob = new Blob([data], { type: contentType }); var url = urlCreator.createObjectURL(blob); $window.saveAs(blob, filename); return; link.setAttribute("href", url); link.setAttribute("download", filename); // Simulate clicking the download link var event = document.createEvent('MouseEvents'); event.initMouseEvent('click', true, true, window, 1, 0, 0, 0, 0, false, false, false, false, 0, null); link.dispatchEvent(event); } else { // Prepare a blob URL // Use application/octet-stream when using window.location to force download var blob = new Blob([data], { type: octetStreamMime }); var url = urlCreator.createObjectURL(blob); $window.location = url; } } } }).error(function (response) { $log.debug(response); }); On my server I use Laravel and this is my response: $headers = array( 'Content-Type' => $contentType, 'Content-Length' => strlen($data), 'Content-Disposition' => $contentDisposition ); return Response::make($data, 200, $headers); where $contentType is application/pdf and $contentDisposition is attachment; filename=" . basename($fileName) . '"' $filename - e.g. 59005-57123123.PDF My response headers: Cache-Control:no-cache Connection:Keep-Alive Content-Disposition:attachment; filename="159005-57123123.PDF" Content-Length:249403 Content-Type:application/pdf Date:Mon, 25 Aug 2014 15:56:43 GMT Keep-Alive:timeout=3, max=1 What am I doing wrong?

    Read the article

  • Ruby: Parse, replace, and evaluate a string formula

    - by Swartz
    I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

    Read the article

  • Need help converting Ruby code to php code

    - by newprog
    Yesterday I posted this queston. Today I found the code which I need but written in Ruby. Some parts of code I have understood (I don't know Ruby) but there is one part that I can't. I think people who know ruby and php can help me understand this code. def do_create(image) # Clear any old info in case of a re-submit FIELDS_TO_CLEAR.each { |field| image.send(field+'=', nil) } image.save # Compose request vm_params = Hash.new # Submitting a file in ruby requires opening it and then reading the contents into the post body file = File.open(image.filename_in, "rb") # Populate the parameters and compute the signature # Normally you would do this in a subroutine - for maximum clarity all # parameters are explicitly spelled out here. vm_params["image"] = file # Contents will be read by the multipart object created below vm_params["image_checksum"] = image.image_checksum vm_params["start_job"] = 'vectorize' vm_params["image_type"] = image.image_type if image.image_type != 'none' vm_params["image_complexity"] = image.image_complexity if image.image_complexity != 'none' vm_params["image_num_colors"] = image.image_num_colors if image.image_num_colors != '' vm_params["image_colors"] = image.image_colors if image.image_colors != '' vm_params["expire_at"] = image.expire_at if image.expire_at != '' vm_params["licensee_id"] = DEVELOPER_ID #in php it's like this $vm_params["sequence_number"] = -rand(100000000);????? vm_params["sequence_number"] = Kernel.rand(1000000000) # Use a negative value to force an error when calling the test server vm_params["timestamp"] = Time.new.utc.httpdate string_to_sign = CREATE_URL + # Start out with the URL being called... #vm_params["image"].to_s + # ... don't include the file per se - use the checksum instead vm_params["image_checksum"].to_s + # ... then include all regular parameters vm_params["start_job"].to_s + vm_params["image_type"].to_s + vm_params["image_complexity"].to_s + # (nil.to_s => '', so this is fine for vm_params we don't use) vm_params["image_num_colors"].to_s + vm_params["image_colors"].to_s + vm_params["expire_at"].to_s + vm_params["licensee_id"].to_s + # ... then do all the security parameters vm_params["sequence_number"].to_s + vm_params["timestamp"].to_s vm_params["signature"] = sign(string_to_sign) #no problem # Workaround class for handling multipart posts mp = Multipart::MultipartPost.new query, headers = mp.prepare_query(vm_params) # Handles the file parameter in a special way (see /lib/multipart.rb) file.close # mp has read the contents, we can close the file now response = post_form(URI.parse(CREATE_URL), query, headers) logger.info(response.body) response_hash = ActiveSupport::JSON.decode(response.body) # Decode the JSON response string ##I have understood below def sign(string_to_sign) #logger.info("String to sign: '#{string_to_sign}'") Base64.encode64(HMAC::SHA1.digest(DEVELOPER_KEY, string_to_sign)) end # Within Multipart modul I have this: class MultipartPost BOUNDARY = 'tarsiers-rule0000' HEADER = {"Content-type" => "multipart/form-data, boundary=" + BOUNDARY + " "} def prepare_query (params) fp = [] params.each {|k,v| if v.respond_to?(:read) fp.push(FileParam.new(k, v.path, v.read)) else fp.push(Param.new(k,v)) end } query = fp.collect {|p| "--" + BOUNDARY + "\r\n" + p.to_multipart }.join("") + "--" + BOUNDARY + "--" return query, HEADER end end end Thanks for your help.

    Read the article

  • Is there a way to split a widescreen monitor in to two or more virtual monitors?

    - by Mike Thompson
    Like most developers I have grown to love dual monitors. I won't go into all the reasons for their goodness; just take it as a given. However, they are not perfect. You can never seem to line them up "just right". You always end up with the monitors at slight funny angles. And of course the bezel always gets in the way. And this is with identical monitors. The problem is much worse with different monitors -- VMWare's multi monitor feature won't even work with monitors of differnt resolutions. When you use multiple monnitors, one of them becomes your primary monitor of focus. Your focus may flip from one monitor to the other, but at any point in time you are usually focusing on only one monitor. There are exceptions to this (WinDiff, Excel), but this is generally the case. I suggest that having a single large monitor with all the benefits of multiple smaller monitors would be a better solution. Wide screen monitors are fantastic, but it is hard to use all the space efficiently. If you are writing code you are generally working on the left-hand side of the window. If you maximize an editor on a wide-screen monitor the right-hand side of the window will be a sea of white. Programs like WinSplit Revolution will help to organise your windows, but this is really just addressing the symptom, not the problem. Even with WinSplit Revolution, when you maximise a window it will take up the whole screen. You can't lock a window into a specific section of the screen. This is where virtual monitors comes in. What would be really nice is a video driver that sits on top of the existing driver, but allows a single monitor to be virtualised into multiple monitors. Control Panel would see your single physical monitor as two or more virtual monitors. The software could even support a virtual bezel to emphasise what is happening, or you could opt for seamless mode. Programs like WinSplit Revolution and UltraMon would still work. This virtual video driver would allow you to slice & dice your physical monitor into as many virtual monitors as you want. Does anybody know if such software exists? If not, are there any budding Windows display driver guru's out there willing to take up the challenge? I am not after the myriad of virtual desktop/window manager programs that are available. I get frustrated with these programs. They seem good at first but they usually have some strange behaviour and don't work well with other programs (such as WinSplit Revolution). I want the real thing!

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • Asp.net web service: Problems accessing without www

    - by MysterM
    I have a Asp.net web service running on www.domain.com/Service.svc that I connect to using jQuery from my asp.net website. Everything works perfect if the user access my website with www.domain.com. But if the user uses only domain.com I get error: There was no channel actively listening at 'http://domain.com/Service.svc/get?date=2010-10-09'. This is often caused by an incorrect address URI. Ensure that the address to which the message is sent matches an address on which a service is listening. In my web.config I use the serviceHostingEnvironment tag to get the service running on my webhost (it doesn't work otherwise). Maybe this is what causes the error? Here is my system.serviceModel in web.config (I had some problems setting up the web service so that's why my web.config might be a bit messy: <system.serviceModel> <behaviors> <endpointBehaviors> <behavior name="ServiceAspNetAjaxBehavior"> <enableWebScript /> </behavior> </endpointBehaviors> <serviceBehaviors> <behavior name="ServiceBehavior"> <serviceDebug includeExceptionDetailInFaults="true" /> </behavior> </serviceBehaviors> </behaviors> <serviceHostingEnvironment aspNetCompatibilityEnabled="true"> <baseAddressPrefixFilters> <add prefix="http://www.domain.com"/> </baseAddressPrefixFilters> </serviceHostingEnvironment> <services> <service behaviorConfiguration="ServiceBehavior" name="Service"> <endpoint address="" behaviorConfiguration="ServiceAspNetAjaxBehavior" binding="webHttpBinding" bindingConfiguration="ServiceBinding" contract="Service" /> </service> </services> <bindings> <webHttpBinding> <binding name="ServiceBinding" maxBufferPoolSize="1000000" maxReceivedMessageSize="1000000"> <readerQuotas maxDepth="1000000" maxStringContentLength="1000000" maxArrayLength="1000000" maxBytesPerRead="1000000" maxNameTableCharCount="1000000" /> </binding> </webHttpBinding> </bindings> </system.serviceModel> How can I make it possible for my users to access my webservice also when using only domain.com?

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 167 168 169 170 171 172 173 174 175 176 177 178  | Next Page >