Search Results

Search found 14260 results on 571 pages for 'regex group'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 172/571 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • how do you group select_tag and text_field_tag?

    - by Eytan
    I'm trying to build a form where a user can select an existing category, or define their own. My form looks something like this... <%= f.select :category, category_options, prompt: "Select"> <%= f.text_field :category %> However, this UI is confusing. The user can select something in the select box, and type in a custom category. In this case, the final result is not obvious. Do you guys have any recommendations on how to handle this situation?

    Read the article

  • Need help Linq query join + count + group by

    - by user233540
    I have two table First table BID Town 1 ABC 2 ABC2 3 ABC Second Table PID BID AmountFirst AmountSecond AmountThird Minority 1__ 1___ 1000_____ 1000________ 1000_____ SC 2__ 2___ 2000_____ 1000_______ 2000_____ ST 3__ 3___ 1000____ 1000_______ 1000_______ SC BID is foreign key in Second table. I want sum AmountFirst + AmountSecond +AmountThird for individualTown e.g for ABC town answer should be : 6000 (summation of PID 1 and PID 2) I want Linq query for this..Please help

    Read the article

  • How to move many files in multiple different directories (on Linux)

    - by user1335982
    My problem is that I have too many files in single directory. I cannot "ls" the directory, cos is too large. I need to move all files in better directory structure. I'm using the last 3 digits from ID as folders in reverse way. For example ID 2018972 will gotta go in /2/7/9/img_2018972.jpg. I've created the directories, but now I need help with bash script. I know the IDs, there are in range 1,300,000 - 2,000,000. But I can't handle regular expressions. I wan't to move all files like this: /images/folder/img_2018972.jpg -> /images/2/7/9/img_2018972.jpg I will appreciate any help on this subject. Thanks!

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • Some pro regular expressions help needed here

    - by Camran
    I need a special regular expression, have no experience in them whatsoever so I am turning to you guys on this one: I need to validate a classifieds title field so it doesn't have any special characters in it, almost. Only letters and numbers should be allowed, and also the swedish three letters å, ä, ö, and also not case sensitive. Besides the above, these should also be allowed: The "&" sign. Parenthesis sign "()" Mathematical signs "-", "+", "%", "/", "*" Dollar and Euro signs Accent sign or whatever it's called, for example in "coupé" the apostrophe above the "e". Double quote and singel quote signs. The comma "," and point "." signs Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • extracting multiple fields from a text file using php

    - by Dave
    Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

    Read the article

  • Find multiple patterns with a single preg_match_all in PHP

    - by Mark
    Using PHP and preg_match_all I'm trying to get all the HTML content between the following tags (and the tags also): <p>paragraph text</p> don't take this <ul><li>item 1</li><li>item 2</li></ul> don't take this <table><tr><td>table content</td></tr></table> I can get one of them just fine: preg_match_all("(<p>(.*)</p>)siU", $content, $matches, PREG_SET_ORDER); Is there a way to get all the <p></p> <ul></ul> <table></table> content with a single preg_match_all? I need them to come out in the order they were found so I can echo the content and it will make sense. So if I did a preg_match_all on the above content then iterated through the $matches array it would echo: <p>paragraph text</p> <ul><li>item 1</li><li>item 2</li></ul> <table><tr><td>table content</td></tr></table>

    Read the article

  • Group multiple or statements within an IF in javascript

    - by nick
    The following code works: $(".valClear").each(function () { if ($(this).val().indexOf(".png") == -1) { $(this).val(''); } }); However this doesn't (the value is removed even if it contains .png or .jpeg), what am I doing wrong? $(".valClear").each(function () { if (($(this).val().indexOf(".png") == -1) || ($(this).val().indexOf(".jpeg") == -1)) { $(this).val(''); } });

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Get all text between tags with preg_match_all() or better function?

    - by kylex
    2010-June-11 <remove>2010-June-2</remove> <remove>2010-June-3</remove> 2010-June-15 2010-June-16 2010-June-17 2010-June-3 2010-June-2 2010-June-1 I'm trying to find all instances that are between the <remove> tags This is what I have: $pattern = "/<remove>(.*?)<\/remove>/"; preg_match_all($pattern, $_POST['exclude'], $matches); foreach($matches as $deselect){ foreach ($deselect as $display){ echo $display."<br />"; } } This is what it returns: 2010-June-2 2010-June-3 2010-June-2 2010-June-3 Why is it doubling up, and how do I prevent that?

    Read the article

  • jQuery: Replace strings with .each()

    - by Warrantica
    I want a function that replace each li with an image. This is my code: $(document).ready(function(){ var tmphref; var tmpname; var str = '<a href="' + tmphref + '"><img src="http://www.somesite.com/a/' + tmpname[1] + '/avatar-small.jpg /></a>'; $('#somediv li a').each(function(){ tmphref = $(this).attr("href"); tmpname = /http\:\/\/(\w+)\.somesite\.com\//.exec(tmphref); $(this).parent().replaceWith(str); }); }); The image is in this specific path: www.somesite.com/a/username/avatar-small.jpg The code above doesn't work. Any ideas? Thank you in advance.

    Read the article

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • Not allow a href tags in form textarea

    - by saquib
    Hello friends, How can i prevent user to enter any url or link in contact form text area, i have tried it with this but its not working - if (!isset($_POST['submit']) && preg_match_all('/<a.*>.*<\/a>/', $_POST['query'])) { echo "<h1 style='color:red;'>HTML Tag Not allowed </h1>"; } else { //sendmail } Please help me

    Read the article

  • Perl regular expression question

    - by user368311
    Suppose I have variables $x1 = 'XX a b XX c d XX'; $x2 = 'XX a b XX c d XX e f XX'; I want a regular expression that will find each instance of letters between XX. I'm looking for a general solution, because I don't know how many XX's there are. I tried using /XX(.*?)XX/g but this only matches "a b" for x1 and "a b", "e f" for x2 because once the first match is found, the engine has already read the second "XX". Thanks for any help.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >