Search Results

Search found 22894 results on 916 pages for 'search and replace'.

Page 172/916 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • Website/App on Dotcloud is down

    - by user1576866
    The website is nhslhs.tk . The last time I edited something was four days ago. I tried to get a calendar on the Django datable, but deleted it all and never actually pushed it to the Dotcloud server. Also, few hours before that I was able to update HTML files, push them, and see the edits on the website. The link should take you to a log-in page (this is available when you google "nhslhs.tk" and click cache view) but it takes you to a search magnified advertisement-esque page. On a few sites, people claimed the error was due to a Trojan horse virus or server being down. Do you know how to fix this? Thanks!

    Read the article

  • [AS 3.0] How to use the string.match method to find multiple occurrences of the same word in a strin

    - by Steven
    In Actionscript and Adobe Flex, I'm using a pattern and regexp (with the global flag) with the string.match method and it works how I'd like except when the match returns multiple occurrences of the same word in the text. In that case, all the matches for that word point only to the index for the first occurrence of that word. For example, if the text is "cat dog cat cat cow" and the pattern is a search for cat*, the match method returns an array of three occurrences of "cat", however, they all point to only the index of the first occurrence of cat when i use indexOf on a loop through the array. I'm assuming this is just how the string.match method is (although please let me know if i'm doing something wrong or missing something!). I want to find the specific indices of every occurrence of a match, even if it is of a word that was already previously matched. I'm wondering if that is just how the string.match method is and if so, if anyone has any idea what the best way to do this would be. Thanks.

    Read the article

  • case insensitive highlighting in php

    - by fusion
    i'm using this function to highlight the results from mysql query: function highlightWords($string, $word) { $string = str_replace($word, "<span class='highlight'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } .... $cQuote = highlightWords(htmlspecialchars($row['cQuotes']), $search_result); the problem is, if i type in 'good', it will only show my search results with a lower-case 'g'ood and not 'Good'. how do i rectify this?

    Read the article

  • Nested for-loop, searching files

    - by user2961510
    I have two files: filetest.txt ============ SSISPACKAGE1.dtsx SSISPACKAGE2.dtsx SSISPACKAGE3.dtsx SSISPACKAGE4.dtsx SSISPACKAGE5.dtsx SSISPACKAGE6.dtsx SSISPACKAGE7.dtsx SSISPACKAGE8.dtsx filetest2.txt ============= \\central_test_server\SSIS_Packages\Daily.bat \\central_test_server\SSIS_Packages\Weekly.bat \\central_test_server\SSIS_Packages\Monthly.bat \\central_test_server\SSIS_Packages\Quarterly.bat \\central_test_server\SSIS_Packages\SemiAnnually.bat \\central_test_server\SSIS_Packages\Annually.bat What I need is to cycle through filetest.txt, then search the files identified in filetest2.txt for the filename and output to a file the results. I am trying to identify in well over 100 bat files where each of about 100 SSIS Packages are running. I'm doing this in Windows batch, have tried about 20 various approaches without success - any help would be greatly appreciated.

    Read the article

  • Sphinx without using an auto_increment id

    - by squeeks
    I am current in planning on creating a big database (2+ million rows) with a variety of data from separate sources. I would like to avoid structuring the database around auto_increment ids to help prevent against sync issues with replication, and also because each item inserted will have a alphanumeric product code that is guaranteed to be unique - it seems to me more sense to use that instead. I am looking at a search engine to index this database with Sphinx looking rather appealing due to its design around indexing relational databases. However, looking at various tutorials and documentation seems to show database designs being dependent on an auto_increment field in one form or another and a rather bold statement in the documentation saying that document ids must be 32/64bit integers only or things break. Is there a way to have a database indexed by Sphinx without auto_increment fields as the id?

    Read the article

  • SQL Server FTS: possible to get information how/why rows were matched?

    - by jimmy_keen
    Is it possible to get the information why/how given row returned by FTS query was matched (or which substring caused row to match)? For example, consider simpliest table with id and text columns, with FTS index on the later one. SELECT * FROM Example WHERE CONTAINS(text, 'FORMSOF(INFLECTIONAL, jump)'); This examplary query could return, say row {1, 'Jumping Jack'}. Now, is it possible to somehow get information that this very row was matched because of 'Jumping' word? It doesn't even have to be exact information, more of a which substring caused row to match. Why I'm asking - I got C# app that builds up those queries basing on user input (keywords to search for), and I need the very basic information why/how row was matched back, to use further in C# code. If it's not possible, any alternatives?

    Read the article

  • Java-Counting occurrence of word from huge textfile

    - by Naveen
    I have a text file of size 115MB. It consists of about 20 million words. I have to use the file as a word collection, and use it to search the occurrence of each user-given words from the collection. I am using this process as a small part in my project. I need a method for finding out the number of occurrence of given words in a faster and correct manner since i may use it in iterations. I am in need of suggestion about any API that i can make use or some other way that performs the task in a quicker manner. Any recommendations are appreciated.

    Read the article

  • Fulltext search for django : Mysql not so bad ? (vs sphinx, xapian)

    - by Eric
    I am studying fulltext search engines for django. It must be simple to install, fast indexing, fast index update, not blocking while indexing, fast search. After reading many web pages, I put in short list : Mysql MYISAM fulltext, djapian/python-xapian, and django-sphinx I did not choose lucene because it seems complex, nor haystack as it has less features than djapian/django-sphinx (like fields weighting). Then I made some benchmarks, to do so, I collected many free books on the net to generate a database table with 1 485 000 records (id,title,body), each record is about 600 bytes long. From the database, I also generated a list of 100 000 existing words and shuffled them to create a search list. For the tests, I made 2 runs on my laptop (4Go RAM, Dual core 2.0Ghz): the first one, just after a server reboot to clear all caches, the second is done juste after in order to test how good are cached results. Here are the "home made" benchmark results : 1485000 records with Title (150 bytes) and body (450 bytes) Mysql 5.0.75/Ubuntu 9.04 Fulltext : ========================================================================== Full indexing : 7m14.146s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:11.553524 next run : 0:00:00.168508 Mysql 5.5.4 m3/Ubuntu 9.04 Fulltext : ========================================================================== Full indexing : 6m08.154s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:11.553524 next run : 0:00:00.168508 1 thread, 100000 searchs with single word randomly taken from database : First run : 9m09s next run : 5m38s 1 thread, 10000 random strings (random strings should not be found in database) : just after the 100000 search test : 0:00:15.007353 1 thread, boolean search : 1000 x (+word1 +word2) First run : 0:00:21.205404 next run : 0:00:00.145098 Djapian Fulltext : ========================================================================== Full indexing : 84m7.601s 1 thread, 1000 searchs with single word randomly taken from database with prefetch : First run : 0:02:28.085680 next run : 0:00:14.300236 python-xapian Fulltext : ========================================================================== 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:26.402084 next run : 0:00:00.695092 django-sphinx Fulltext : ========================================================================== Full indexing : 1m25.957s 1 thread, 1000 searchs with single word randomly taken from database : First run : 0:01:30.073001 next run : 0:00:05.203294 1 thread, 100000 searchs with single word randomly taken from database : First run : 12m48s next run : 9m45s 1 thread, 10000 random strings (random strings should not be found in database) : just after the 100000 search test : 0:00:23.535319 1 thread, boolean search : 1000 x (word1 word2) First run : 0:00:20.856486 next run : 0:00:03.005416 As you can see, Mysql is not so bad at all for fulltext search. In addition, its query cache is very efficient. Mysql seems to me a good choice as there is nothing to install (I need just to write a small script to synchronize an Innodb production table to a MyISAM search table) and as I do not really need advanced search feature like stemming etc... Here is the question : What do you think about Mysql fulltext search engine vs sphinx and xapian ?

    Read the article

  • search a collection for a specific keyword

    - by icelated
    What i want to do is search a hashset with a keyword.. I have 3 classes... main() Library Item(CD, DVD,Book classes) In library i am trying to do my search of the items in the hashsets.. In Item class is where i have the getKeywords function.. here is the Items class... import java.io.PrintStream; import java.util.Collection; import java.util.*; class Item { private String title; private String [] keywords; public String toString() { String line1 = "title: " + title + "\n" + "keywords: " + Arrays.toString(keywords); return line1; } public void print() { System.out.println(toString()); } public Item() { } public Item(String theTitle, String... theKeyword) { this.title = theTitle; this.keywords = theKeyword; } public String getTitle() { return title; } public String [] getKeywords() { return keywords; } } class CD extends Item { private String artist; private String [] members; // private String [] keywords; private int number; public CD(String theTitle, String theBand, int Snumber, String... keywords) { super(theTitle, keywords); this.artist = theBand; this.number = Snumber; // this.keywords = keywords; } public void addband(String... member) { this.members = member; } public String getArtist() { return artist; } public String [] getMembers() { return members; } // public String [] getKeywords() // { // return keywords; //} public String toString() { return "-Music-" + "\n" + "band: " + artist + "\n" + "# songs: " + number + "\n" + "members: " + Arrays.toString(members) + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } public void print() { System.out.println(toString()); } } class DVD extends Item { private String director; private String [] cast; private int scenes; // private String [] keywords; public DVD(String theTitle, String theDirector, int nScenes, String... keywords) { super(theTitle, keywords); this.director = theDirector; this.scenes = nScenes; // this.keywords = keywords; } public void addmoviecast(String... members) { this.cast = members; } public String [] getCast() { return cast; } public String getDirector() { return director; } // public String [] getKeywords() // { // return keywords; // } public String toString() { return "-Movie-" + "\n" + "director: " + director + "\n" + "# scenes: " + scenes + "\n" + "cast: " + Arrays.toString(cast) + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } public void print() { System.out.println(toString()); } } class Book extends Item { private String author; private int pages; public Book(String theTitle, String theAuthor, int nPages, String... keywords) { super(theTitle, keywords); this.author = theAuthor; this.pages = nPages; // this.keywords = keywords; } public String getAuthor() { return author; } //public String [] getKeywords() // { // return keywords; //} public void print() { System.out.println(toString()); } public String toString() { return "-Book-" + "\n" + "Author: " + author + "\n" + "# pages " + pages + "\n" + super.toString() // + "keywords: " + Arrays.toString(keywords) + "\n" + "\n" ; } } I hope i didnt confuse you? I need help with the itemsForKeyword(String keyword) function.. the first keyword being passed in is "science fiction" and i want to search the keywords in the sets and return the matches.. What am i doing so wrong? Thank you

    Read the article

  • Setting value for autocomplete search field linked to Google Places API

    - by user1653350
    I have a web page where people will be able to enter multiple destinations. When they state they want to enter a new destination, the current field values are stored in arrays. If they choose to go back to a previous destination, the relevant values are reinserted into the form fields. I am using the search field linked to autocomplete as the visible display of the destination. When I attempt to put a value into the linked search field, the value is presented as if it is a placeholder instead of a value. Enter the field and the value is removed by the onFocus() event of the Google Places autocomplete add-in. How can I reinsert the value and have it recognised as a value instead of placeholder. field definition in the form <label for="GoogleDestSrch" class="inputText">Destination: <span id="DestinationDisplay2">1</span> <span class="required"><font size="5"> * </font></span></label> <input id="GoogleDestSrch" type="text" size="50" placeholder="Please enter your destination" /> initialise code for Google Places API listener var input = document.getElementById('GoogleDestSrch'); var autocomplete = new google.maps.places.Autocomplete(input); google.maps.event.addListener(autocomplete, 'place_changed', function() { fillInAddress(); }); attempting to reinsert value into search field when prior destination reloaded form.GoogleDestSrch.value = GoogleDestSrch[index]; Issue With Google Places <script language="JavaScript" type="text/javascript"> function GotoDestination(index) { var domove = true; if (index == 0) { index = lastIndex + 1; } else { if (index == -1) { index = lastIndex - 1; if (index == 0) { index = 1; domove = false; } } } if (domove) { if (index != lastIndex) { var doc = window.document; var pdbutton = doc.getElementById("pdbutton"); var pdbutton1 = doc.getElementById("pdbutton1"); if ((index > lastIndex)) { // move to next destination saveDataF(lastIndex); loadDataF(index); lastIndex = index; } else if (index <= lastIndex) { // move to previous destination saveDataF(lastIndex); loadDataF(index); lastIndex = index; } } } } var input; var autocomplete; // fill in the Google metadata when a destination is selected function fillInAddress() { var strFullValue = ''; var strFullGeoValue = ''; var place = autocomplete.getPlace(); document.getElementById("GoogleType").value = place.types[0]; } function saveDataF(index) { var fieldValue; var blankSearch = "Please enter"; // placeholder text for Google Places fieldValue = document.getElementById("GoogleDestSrch").value; if (fieldValue.indexOf(blankSearch) > -1) { fieldValue = ""; } GoogleDestSrch[index] = fieldValue; } function loadDataF(index) { if ((GoogleDestSrch[index] + "") == "undefined") { document.getElementById("GoogleDestSrch").value = ""; } else { document.getElementById("GoogleDestSrch").value = GoogleDestSrch[index]; } } // -- Destination: 1 * Type of place // input = document.getElementById('GoogleDestSrch'); autocomplete = new google.maps.places.Autocomplete(input); google.maps.event.addListener(autocomplete, 'place_changed', function () { fillInAddress(); }); //]]

    Read the article

  • Choosing a type for search results in C#

    - by Chris M
    I have a result set that will never exceed 500; the results that come back from the web-service are assigned to a search results object. The data from the webservice is about 2mb; the bit I want to use is about a third of each record, so this allows me to cache and quickly manipulate it. I want to be able to sort and filter the results with the least amount of overhead and as fast as possible so I used the VCSKICKS timing class to measure their performance Average Total (10,000) Type Create Sort Create Sort HashSet 0.1579 0.0003 1579 3 IList 0.0633 0.0002 633 2 IQueryable 0.0072 0.0432 72 432 Measured in Seconds using http://www.vcskicks.com/algorithm-performance.php I created the hashset through a for loop over the web-service response (adding to the hashset). The List & IQueryable were created using LINQ. Question I can understand why HashSet takes longer to create (the foreach loop vs linq); but why would IQueryable take longer to sort than the other two; and finally is there a better way to assign the HashSet. Thanks Actual Program public class Program { private static AuthenticationHeader _authHeader; private static OPSoapClient _opSession; private static AccommodationSearchResponse _searchResults; private static HashSet<SearchResults> _myHash; private static IList<SearchResults> _myList; private static IQueryable<SearchResults> _myIQuery; static void Main(string[] args) { #region Setup WebService _authHeader = new AuthenticationHeader { UserName = "xx", Password = "xx" }; _opSession = new OPSoapClient(); #region Setup Search Results _searchResults = _opgSession.SearchCR(_authHeader, "ENG", "GBP", "GBR"); #endregion Setup Search Results #endregion Setup WebService // HASHSET SpeedTester hashTest = new SpeedTester(TestHashSet); hashTest.RunTest(); Console.WriteLine("- Hash Test \nAverage Running Time: {0}; Total Time: {1}", hashTest.AverageRunningTime, hashTest.TotalRunningTime); SpeedTester hashSortTest = new SpeedTester(TestSortingHashSet); hashSortTest.RunTest(); Console.WriteLine("- Hash Sort Test \nAverage Running Time: {0}; Total Time: {1}", hashSortTest.AverageRunningTime, hashSortTest.TotalRunningTime); // ILIST SpeedTester listTest = new SpeedTester(TestList); listTest.RunTest(); Console.WriteLine("- List Test \nAverage Running Time: {0}; Total Time: {1}", listTest.AverageRunningTime, listTest.TotalRunningTime); SpeedTester listSortTest = new SpeedTester(TestSortingList); listSortTest.RunTest(); Console.WriteLine("- List Sort Test \nAverage Running Time: {0}; Total Time: {1}", listSortTest.AverageRunningTime, listSortTest.TotalRunningTime); // IQUERIABLE SpeedTester iqueryTest = new SpeedTester(TestIQueriable); iqueryTest.RunTest(); Console.WriteLine("- iquery Test \nAverage Running Time: {0}; Total Time: {1}", iqueryTest.AverageRunningTime, iqueryTest.TotalRunningTime); SpeedTester iquerySortTest = new SpeedTester(TestSortableIQueriable); iquerySortTest.RunTest(); Console.WriteLine("- iquery Sort Test \nAverage Running Time: {0}; Total Time: {1}", iquerySortTest.AverageRunningTime, iquerySortTest.TotalRunningTime); } static void TestHashSet() { var test = _searchResults.Items; _myHash = new HashSet<SearchResults>(); foreach(var x in test) { _myHash.Add(new SearchResults { Ref = x.Ref, Price = x.StandardPrice }); } } static void TestSortingHashSet() { var sorted = _myHash.OrderBy(s => s.Price); } static void TestList() { var test = _searchResults.Items; _myList = (from x in test select new SearchResults { Ref = x.Ref, Price = x.StandardPrice }).ToList(); } static void TestSortingList() { var sorted = _myList.OrderBy(s => s.Price); } static void TestIQueriable() { var test = _searchResults.Items; _myIQuery = (from x in test select new SearchResults { Ref = x.Ref, Price = x.StandardPrice }).AsQueryable(); } static void TestSortableIQueriable() { var sorted = _myIQuery.OrderBy(s => s.Price); } }

    Read the article

  • java.lang.NullPointerException exception in my controller file (using Spring Hibernate Maven)

    - by mrjayviper
    The problem doesn't seemed to have anything to do with Hibernate. As I've commented the Hibernate stuff but I'm still getting it. If I comment out this line message = staffDAO.searchForStaff(search); in my controller file, it goes through ok. But I don't see anything wrong with searchForStaff function. It's a very simple function that just returns the string "test" and run system.out.println("test"). Can you please help? thanks But this is the error that I'm getting: SEVERE: Servlet.service() for servlet [spring] in context with path [/directorymaven] threw exception [Request processing failed; nested exception is java.lang.NullPointerException] with root cause java.lang.NullPointerException at org.flinders.staffdirectory.controllers.SearchController.showSearchResults(SearchController.java:25) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at org.springframework.web.method.support.InvocableHandlerMethod.invoke(InvocableHandlerMethod.java:219) at org.springframework.web.method.support.InvocableHandlerMethod.invokeForRequest(InvocableHandlerMethod.java:132) at org.springframework.web.servlet.mvc.method.annotation.ServletInvocableHandlerMethod.invokeAndHandle(ServletInvocableHandlerMethod.java:100) at org.springframework.web.servlet.mvc.method.annotation.RequestMappingHandlerAdapter.invokeHandlerMethod(RequestMappingHandlerAdapter.java:604) at org.springframework.web.servlet.mvc.method.annotation.RequestMappingHandlerAdapter.handleInternal(RequestMappingHandlerAdapter.java:565) at org.springframework.web.servlet.mvc.method.AbstractHandlerMethodAdapter.handle(AbstractHandlerMethodAdapter.java:80) at org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:923) at org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:852) at org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:882) at org.springframework.web.servlet.FrameworkServlet.doGet(FrameworkServlet.java:778) at javax.servlet.http.HttpServlet.service(HttpServlet.java:621) at javax.servlet.http.HttpServlet.service(HttpServlet.java:728) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:305) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:210) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:222) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:123) at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:472) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:171) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:99) at org.apache.catalina.valves.AccessLogValve.invoke(AccessLogValve.java:931) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:118) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:407) at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1004) at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:589) at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:310) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603) at java.lang.Thread.run(Thread.java:722) My spring-servlet xml <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:context="http://www.springframework.org/schema/context" xmlns:mvc="http://www.springframework.org/schema/mvc" xmlns:p="http://www.springframework.org/schema/p" xmlns:tx="http://www.springframework.org/schema/tx" xsi:schemaLocation=" http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context.xsd http://www.springframework.org/schema/mvc http://www.springframework.org/schema/mvc/spring-mvc.xsd http://www.springframework.org/schema/tx http://www.springframework.org/schema/tx/spring-tx.xsd"> <context:component-scan base-package="org.flinders.staffdirectory.controllers" /> <mvc:annotation-driven /> <mvc:resources mapping="/resources/**" location="/resources/" /> <tx:annotation-driven /> <bean id="propertyConfigurer" class="org.springframework.beans.factory.config.PropertyPlaceholderConfigurer" p:location="/WEB-INF/spring.properties" /> <bean id="dataSource" class="org.apache.commons.dbcp.BasicDataSource" destroy-method="close" p:driverClassName="${jdbc.driverClassName}" p:url="${jdbc.databaseurl}" p:username="${jdbc.username}" p:password="${jdbc.password}" /> <bean id="sessionFactory" class="org.springframework.orm.hibernate4.LocalSessionFactoryBean" p:dataSource-ref="dataSource" p:configLocation="${hibernate.config}" p:packagesToScan="org.flinders.staffdirectory"/> <bean id="transactionManager" class="org.springframework.orm.hibernate4.HibernateTransactionManager" p:sessionFactory-ref="sessionFactory" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver" p:viewClass="org.springframework.web.servlet.view.tiles2.TilesView" /> <bean id="tilesConfigurer" class="org.springframework.web.servlet.view.tiles2.TilesConfigurer" p:definitions="/WEB-INF/tiles.xml" /> <bean id="staffDAO" class="org.flinders.staffdirectory.dao.StaffDAO" p:sessionFactory-ref="sessionFactory" /> <!-- <bean id="staffService" class="org.flinders.staffdirectory.services.StaffServiceImpl" p:staffDAO-ref="staffDAO" />--> </beans> This is my controller file package org.flinders.staffdirectory.controllers; import java.util.List; //import org.flinders.staffdirectory.models.database.SearchResult; import org.flinders.staffdirectory.models.misc.Search; import org.flinders.staffdirectory.dao.StaffDAO; //import org.springframework.beans.factory.annotation.Autowired; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.ModelAttribute; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class SearchController { //@Autowired private StaffDAO staffDAO; private String message; @RequestMapping("/SearchStaff") public ModelAndView showSearchResults(@ModelAttribute Search search) { //List<SearchResult> searchResults = message = staffDAO.searchForStaff(search); //System.out.println(search.getSurname()); return new ModelAndView("search/SearchForm", "Search", new Search()); //return new ModelAndView("search/SearchResults", "searchResults", searchResults); } @RequestMapping("/SearchForm") public ModelAndView showSearchForm() { return new ModelAndView("search/SearchForm", "search", new Search()); } } my dao class package org.flinders.staffdirectory.dao; import java.util.List; import org.hibernate.SessionFactory; //import org.springframework.beans.factory.annotation.Autowired; import org.flinders.staffdirectory.models.database.SearchResult; import org.flinders.staffdirectory.models.misc.Search; public class StaffDAO { //@Autowired private SessionFactory sessionFactory; public void setSessionFactory(SessionFactory sessionFactory) { this.sessionFactory = sessionFactory; } public String searchForStaff(Search search) { /*String SQL = "select distinct telsumm_id as id, telsumm_parent_id as parentId, telsumm_name_title as title, (case when substr(telsumm_surname, length(telsumm_surname) - 1, 1) = ',' then substr(telsumm_surname, 1, length(telsumm_surname) - 1) else telsumm_surname end) as surname, telsumm_preferred_name as firstname, nvl(telsumm_tele_number, '-') as telephoneNumber, nvl(telsumm_role, '-') as role, telsumm_display_department as department, lower(telsumm_entity_type) as entityType from teldirt.teld_summary where (telsumm_search_surname is not null) and not (nvl(telsumm_tele_directory,'xxx') IN ('N','S','D')) and not (telsumm_tele_number IS NULL AND telsumm_alias IS NULL) and (telsumm_alias_list = 'Y' OR (telsumm_tele_directory IN ('A','B'))) and ((nvl(telsumm_system_id_end,sysdate+1) > SYSDATE and telsumm_entity_type = 'P') or (telsumm_entity_type = 'N')) and (telsumm_search_department NOT like 'SPONSOR%')"; if (search.getSurname().length() > 0) { SQL += " and (telsumm_search_surname like '" + search.getSurname().toUpperCase() + "%')"; } if (search.getSurnameLike().length() > 0) { SQL += " and (telsumm_search_soundex like soundex(('%" + search.getSurnameLike().toUpperCase() + "%'))"; } if (search.getFirstname().length() > 0) { SQL += " and (telsumm_search_preferred_name like '" + search.getFirstname().toUpperCase() + "%' or telsumm_search_first_name like '" + search.getFirstname() + "%')"; } if (search.getTelephoneNumber().length() > 0) { SQL += " and (telsumm_tele_number like '" + search.getTelephoneNumber() + "%')"; } if (search.getDepartment().length() > 0) { SQL += " and (telsumm_search_department like '" + search.getDepartment().toUpperCase() + "%')"; } if (search.getRole().length() > 0) { SQL += " and (telsumm_search_role like '" + search.getRole().toUpperCase() + "%')"; } SQL += " order by surname, firstname"; List<Object[]> list = (List<Object[]>) sessionFactory.getCurrentSession().createQuery(SQL).list(); for(int j=0;j<list.size();j++){ Object [] obj= (Object[])list.get(j); for(int i=0;i<obj.length;i++) System.out.println(obj[i]); }*/ System.out.println("test"); return "test"; } }

    Read the article

  • Add Scheduled Task to reset search indexes for Exchange 2007

    - by Samosa
    I simply want to run a ResetSearchIndex -force on a schedule. What is the correct usage for the command in the Scheduled Task properties? It seems I would first need to start Powershell, then load the console file or snap-in for Exchange, which one of these is the closest: C:\WINDOWS\system32\WINDOW~2\v1.0\POWERS~1.EXE -"D:\Program Files\Microsoft\Exchange Server\Scripts" ResetSearchIndex.ps1 -force dbname or C:\WINDOWS\system32\WINDOW~2\v1.0\POWERS~1.EXE -PSConsoleFile "D:\Program Files\Microsoft\Exchange Server\bin\exshell.psc1" -noexit -command ".'D:\Program Files\Microsoft\Exchange Server\Scripts' ResetSearchIndex.ps1 -force dbname or C:\WINDOWS\system32\WINDOW~2\v1.0\POWERS~1.EXE -PSConsoleFile "D:\Program Files\Microsoft\Exchange Server\bin\exshell.psc1" -noexit -command ".'D:\Program Files\Microsoft\Exchange Server\Scripts\ResetSearchIndex.ps1' -force dbname

    Read the article

  • Lucene.NET 2.9 and BitArray/DocIdSet

    - by Paul Knopf
    I found a great example on grabbing facet counts on a base query. It stores the bitarray of the base query to improve the performance each time the a facet gets counted. var genreQuery = new TermQuery(new Term("genre", genre)); var genreQueryFilter = new QueryFilter(genreQuery); BitArray genreBitArray = genreQueryFilter.Bits(searcher.GetIndexReader()); Console.WriteLine("There are " + GetCardinality(genreBitArray) + " document with the genre " + genre); // Next perform a regular search and get its BitArray result Query searchQuery = MultiFieldQueryParser.Parse(term, new[] {"title", "description"}, new[] {BooleanClause.Occur.SHOULD, BooleanClause.Occur.SHOULD}, new StandardAnalyzer()); var searchQueryFilter = new QueryFilter(searchQuery); BitArray searchBitArray = searchQueryFilter.Bits(searcher.GetIndexReader()); Console.WriteLine("There are " + GetCardinality(searchBitArray) + " document containing the term " + term); The only problem is that I am using a newer version of Lucene.NET (2.9) and Filter.Bits is obsolete. We are told to use DocIdSet instead (rather than BitArray). I cannot found out how to do the bitArray.And(bitArray) with a docIdSet. I looked in reflector and found OpenIdSet which has And operations. Not sure if OpenIdSet is the route to go, I'm just stating. Thanks in advance!

    Read the article

  • Getting Facebook Posts Permalink from Facebook Graph API Search

    - by Alexia
    I want to use the Facebook Graph API to search the public status updates concerning a keyword. For example, this works great: http://graph.facebook.com/search?q=obama&type=post It shows me all the posts with the word "obama" in it. If the post is a picture, it actually returns a field called "link" which is the permalink to the picture on the actual Facebook website, in the user's profile. Which is exactly what I want, but for pictures. But if the post in question is just a status update, i.e. just text, all it returns is the 3 fields: message, created_time, and updated_time. How do I view this actual status update on www.facebook.com? I realize I can view it on graph.facebook.com in JSON format, but I want to actually be able to show the permalink to the status update, or post. The final result I would like to retrieve might look something like this: http://www.facebook.com/[user id]/posts/[post id] With the [user id] and [post id] fields swapped out with the actual IDs, obviously. TIA!

    Read the article

  • In search of a network file system with extended caching to speed up file access

    - by Brecht Machiels
    I'm running a small home server that stores my documents. The disks in this server are in a RAID 1 configuration (using Linux md) and it's also periodically being backup up to an external hard drive to make sure I don't lose them. However, I'm always accessing the files from other computers on the home network using an SMB share, and this results in a considerable speed penalty (especially when connected over WLAN). This is quite annoying when editing large files, such as digital camera RAWs, for example. I've been looking for a solution to this problem. It would have to offer some kind of local caching to speed up the file access. The client would preferably not keep a copy of all data on the server, as it consists of a very large collection of photographs, most of which I will not access frequently. Instead, it should only cache the accessed files and sync the changes back in the background. Ideally, it would also do some smart read-ahead (cache the files that are in the same directory as the currently opened file, for examples), but I suppose that's asking a bit much. Synchronization should be automatic (on file change). Conflicting file changes (at the same time on different clients) are unlikely to happen in my use case, but I would prefer if they are handled properly (notification to the user). I've come across the following options, so far: something similar to Dropbox. iFolder seems to be the only thing that comes close, but its reputation (stability) and requirements put me off. A distributed file system such as OpenAFS. I'm not sure this will speed up file access. It is probably overkill for what I need. Maybe NFS or even Samba offer these possibilities. I read a bit about Windows' Offline Files, but its operation seems limited (at least on Windows XP). As this is just for personal use, I'm not willing to spend a lot of money. A free solution would be preferred. Also, the server needs to run on Linux, and I need a client for at least Windows.

    Read the article

  • Unexpected result in C algebra for search algorithm.

    - by Rhys
    Hi, I've implemented this search algorithm for an ordered array of integers. It works fine for the first data set I feed it (500 integers), but fails on longer searches. However, all of the sets work perfectly with the other four search algorithms I've implemented for the assignment. This is the function that returns a seg fault on line 178 (due to an unexpected negative m value). Any help would be greatly appreciated. CODE: 155 /* perform Algortihm 'InterPolationSearch' on the set 156 * and if 'key' is found in the set return it's index 157 * otherwise return -1 */ 158 int 159 interpolation_search(int *set, int len, int key) 160 { 161 int l = 0; 162 int r = len - 1; 163 int m; 164 165 while (set[l] < key && set[r] >= key) 166 { 167 168 printf ("m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l])\n"); 169 170 printf ("m = %d + ((%d - %d) * (%d - %d)) / (%d - %d);\n", l, key, set[l], r, l, set[r], set[l]); 171 m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]); 172 printf ("m = %d\n", m); 173 174 #ifdef COUNT_COMPARES 175 g_compares++; 176 #endif 177 178 if (set[m] < key) 179 l = m + 1; 180 else if (set[m] > key) 181 r = m - 1; 182 else 183 return m; 184 } 185 186 if (set[l] == key) 187 return l; 188 else 189 return -1; 190 } OUTPUT: m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]) m = 0 + ((68816 - 0) * (100000 - 0)) / (114836 - 0); m = -14876 Thankyou! Rhys

    Read the article

  • How do I use .htaccess conditional redirects for multiple domains?

    - by John
    I'm managing about 15 or so domains for a particular promotion. Each domain has specific redirects in place, as shown below. Rather than make 15 different .htaccess files that I would later have to manage separately, I'd like to use a single .htaccess file and use a symbolic link into each website's directory. The trouble is that, I can't figure out how to make the rules apply only for a specific domain. Every time I visit www.redirectsite2.com, it sends me to www.targetsite.com/search.html?state=PA&id=75, when it should instead be sending me to www.targetsite.com/search.html?state=NJ&id=68. How exactly do I make multiple RewriteRules apply for a given domain and only that domain? Is this even possible to do within a single .htaccess file? Options +FollowSymlinks # redirectsite1.com RewriteEngine On RewriteBase / # start processing rules for www.redirectsite1.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite1\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,L] RewriteRule ^PGN$ http://targetsite.com/search.html?state=PA&id=26 [QSA,R,NC,L] RewriteRule ^NS$ http://targetsite.com/search.html?state=PA&id=27 [QSA,R,NC,L] RewriteRule ^INQ$ http://targetsite.com/search.html?state=PA&id=28 [QSA,R,NC,L] RewriteRule ^AA$ http://targetsite.com/search.html?state=PA&id=29 [QSA,R,NC,L] RewriteRule ^PI$ http://targetsite.com/search.html?state=PA&id=30 [QSA,R,NC,L] RewriteRule ^GV$ http://targetsite.com/search.html?state=PA&id=31 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,NC,L] # end processing rules for www.redirectsite1.com # begin rules for redirectsite2.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite2\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,L] RewriteRule ^SL$ http://targetsite.com/search.html?state=NJ&id=6 [QSA,R,NC,L] RewriteRule ^APP$ http://targetsite.com/search.html?state=NJ&id=8 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,NC,L] Thanks for any help you may be able to provide!

    Read the article

  • How do I do an exact whois search?

    - by brianegge
    When I execute the following whois command on my Ubuntu server, I get all sorts of other domains which contain google.com in the name, but clearly aren't owned by google. As this appears to be some sort of spam, I won't paste the output here. I'd like to check for exactly the name I typed in. I thought the following would work, but it doesn't. What is the proper way to do an exact match? whois -Hx google.com

    Read the article

  • search data from FileReader in Java

    - by maya
    hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >