Search Results

Search found 5313 results on 213 pages for 'steve care'.

Page 173/213 | < Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >

  • cleaning up noise in an edge detection algoritum

    - by Faken
    I recently wrote an extremely basic edge detection algorithm that works on an array of chars. The program was meant to detect the edges of blobs of a single particular value on the array and worked by simply looking left, right, up and down on the array element and checking if one of those values is not the same as the value it was currently looking at. The goal was not to produce a mathematical line but rather a set of ordered points that represented a descritized closed loop edge. The algorithm works perfectly fine, except that my data contained a bit of noise hence would randomly produce edges where there should be no edges. This in turn wreaked havoc on some of my other programs down the line. There is two types of noise that the data contains. The first type is fairly sparse and somewhat random. The second type is a semi continuous straight line on the x=y axis. I know the source of the first type of noise, its a feature of the data and there is nothing i can do about it. As for the second type, i know it's my program's fault for causing it...though i haven't a hot clue exactly what is causing it. My question is: How should I go about removing the noise completely? I know that the correct data has points that are always beside each other and is very compact and ordered (with no gaps) and is a closed loop or multiple loops. The first type of noise is usually sparse and random, that could be easily taken care of by checking if any edges is next that noise point is also counted as an edge. If not, then the point is most defiantly noise and should be removed. However, the second type of noise, where we have a semi continuous line about x=y poses more of a problem. The line is sometimes continuous for random lengths (the longest was it went half way across my entire array unbroken). It is even possible for it to intersect the actual edge. Any ideas on how to do this?

    Read the article

  • Cache efficient code

    - by goldenmean
    This could sound a subjective question, but what i am looking for is specific instances which you would have encountered related to this. 1) How to make a code, cache effective-cache friendly? (More cache hits, as less cahce misses as possible). from both perspectives, data cache & program cache(instruction cache). i.e. What all things in one's code, related to data structures, code constructs one should take care of to make it cache effective. 2) Are there any particular data structures one must use, must avoid,or particular way of accessing the memers of that structure etc.. to make code cache effective. 3) Are there any program constructs(if, for, switch, break, goto,...), code-flow(for inside a if, if inside a for, etc...) one should follow/avoid in this matter? I am looking forward to hear individual experiences related to making a cache efficient code in general. It can be any programming language(C,C++,ASsembly,...), any hardware target(ARM,Intel,PowerPC,...), any OS(Windows,Linux,Symbian,...) etc.. More the variety, it will help better to understand it deeply.

    Read the article

  • Accounting System for Winforms / SQL Server applications

    - by Craig L
    If you were going to write a vertical market C# / WinForms / SQL Server application and needed an accounting "engine" for it, what software package would you chose ? By vertical market, I mean the application is intended to solve a particular set of business problems, not be a generic accounting application. Thus the value add of the program is the 70% of non-accounting related functionality present in the finished product. The 30% of accounting functionality is merely to enable the basic accounting needs of the business. I said all that to lead up to this: The accounting engine needs to be a royalty-free runtime license and not super expensive. I've found a couple C#/SQL Server accounting apps that can be had with source code and a royalty free run time for $150k+ and that would be fine for greenfield development funded by a large bankroll, but for smaller apps, that sort of capital outlay isn't feasible. Something along the lines of $5k to $15k for a royalty-free runtime would be more reasonable. Open-source would be even better. By accounting engine, I mean something that takes care of at a minimum: General Ledger Invoices Statements Accounts Receivable Payments / Credits Basically, an accounting engine should be something that lets the developer concentrate on the value added (industry specific business best practices / processes) part of the solution and not have to worry about how to implement the low level details of a double entry accounting system. Ideally, the accounting engine would be something that is licensed on a royalty free run-time basis. Suggestions, please ?

    Read the article

  • How important is PhD research topic to getting a job?

    - by thornate
    EDIT: This has been closed and I realise that I may not have been specific enough with the original title. I ask two questions here: The general one (Does a PhD help get a job?) which has been asked elsewhere, and the specific one (Is it possible to get work outside of the specific research field?). Assume I've already decided going to do the phd. I'm just stressing about the research topic. Well, I'm one year out of university (Mechatronics engineering and Software Eng double bachelors), worked for a few months then got retrenched (yay economy!). It's looking less and less likely that I'll get a job worth having with the job market as it is, so I'm thinking about going back to uni to do a PhD. I figure that by the time I'm done, the job market will have improved and hopefully I'll have something on my resume that is more attractive than spending three years doing customer support for accounting software. So, my question is to people who've done PhD's. Would you say that they were worth the effort? How important is the research topic to future job-seeking success? The idea I have is a computer-sciencey/neural-networks/data-mining thing which I think is very interesting, but not a field I want to be in forever. My potential supervisor claims that employers don't care so much about the topic of the research but rather the peripheral skills that are developed through a PhD; time managment, self-restraint, planning and whatnot. How does this mesh with people's real world experience? I'd appreciate any advice before signing my life on the line for the next three years. See also: Should developers go to grad school? Best reason not to hire a PhD? How to find an entry-level job after you already have a graduate degree?

    Read the article

  • Using cellUpdateEvent with YUI DataTable and JSON DataSource

    - by Rob Hruska
    I'm working with a UI that has a (YUI2) JSON DataSource that's being used to populate a DataTable. What I would like to do is, when a value in the table gets updated, perform a simple animation on the cell whose value changed. Here are some relevant snippets of code: var columns = [ {key: 'foo'}, {key: 'bar'}, {key: 'baz'} ]; var dataSource = new YAHOO.util.DataSource('/someUrl'); dataSource.responseType = YAHOO.util.DataSource.TYPE_JSON; dataSource.connXhrMode = 'queueRequests'; dataSource.responseSchema = { resultsList: 'results', fields: [ {key: 'foo'}, {key: 'bar'}, {key: 'baz'} ] }; var dataTable = new YAHOO.widget.DataTable('container', columns, dataSource); var callback = function() { success: dataTable.onDataReturnReplaceRows, failure: function() { // error handling code }, scope: dataTable }; dataSource.setInterval(1000, null, callback); And here's what I'd like to do with it: dataTable.subscribe('cellUpdateEvent', function(record, column, oldData) { var td = dataTable.getTdEl({record: record, column: column}); YAHOO.util.Dom.setStyle(td, 'backgroundColor', '#ffff00'); var animation = new YAHOO.util.ColorAnim(td, { backgroundColor: { to: '#ffffff'; } }); animation.animate(); }; However, it doesn't seem like using cellUpdateEvent works. Does a cell that's updated as a result of the setInterval callback even fire a cellUpdateEvent? It may be that I don't fully understand what's going on under the hood with DataTable. Perhaps the whole table is being redrawn every time the data is queried, so it doesn't know or care about changes to individual cells?. Is the solution to write my own specific function to replace onDataReturnReplaceRows? Could someone enlighten me on how I might go about accomplishing this? Edit: After digging through datatable-debug.js, it looks like onDataReturnReplaceRows won't fire the cellUpdateEvent. It calls reset() on the RecordSet that's backing the DataTable, which deletes all of the rows; it then re-populates the table with fresh data. I tried changing it to use onDataReturnUpdateRows, but that doesn't seem to work either.

    Read the article

  • How can I prevent 'objects you are adding to the designer use a different data connection...'?

    - by Timothy Khouri
    I am using Visual Studio 2010, and I have a LINQ-to-SQL DBML file that my colleagues and I are using for this project. We have a connection string in the web.config file that the DBML is using. However, when I drag a new table from my "Server Explorer" onto the DBML file... I get presented with a dialog that demands that do one of these two options: Allow visual studio to change the connection string to match the one in my solution explorer. Cancel the operation (meaning, I don't get my table). I don't really care too much about the debate as why the PMs/devs who made this tool didn't allow a third option - "Create the object anyway - don't worry, I'm a developer!" What I am thinking would be a good solution is if I can create a connection in the Server Explorer - WITHOUT A WIZARD. If I can just paste a connection string, that would be awesome! Because then the DBML designer won't freak out on me :O) If anyone knows the answer to this question, or how to do the above, please lemme know!

    Read the article

  • How do you determine subtype of an entity using Inheritance with Entity Framework 4?

    - by KallDrexx
    I am just starting to use the Entity Framework 4 for the first time ever. So far I am liking it but I am a bit confused on how to correctly do inheritance. I am doing a model-first approach, and I have my Person entity with two subtype entities, Employee and Client. EF is correctly using the table per type approach, however I can't seem to figure out how to determine what type of a Person a specific object is. For example, if I do something like var people = from p in entities.Person select p; return people.ToList<Person>(); In my list that I form from this, all I care about is the Id field so i don't want to actually query all the subtype tables (this is a webpage list with links, so all I need is the name and the Id, all in the Persons table). However, I want to form different lists using this one query, one for each type of person (so one list for Clients and another for Employees). The issue is if I have a Person entity, I can't see any way to determine if that entity is a Client or an Employee without querying the Client or Employee tables directly. How can I easily determine the subtype of an entity without performing a bunch of additional database queries?

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Date since 1600 to NSDate?

    - by Steven Fisher
    I have a date that's stored as a number of days since January 1, 1600 that I need to deal with. This is a legacy date format that I need to read many, many times in my application. Previously, I'd been creating a calendar, empty date components and root date like this: self.gregorian = [[[NSCalendar alloc] initWithCalendarIdentifier: NSGregorianCalendar ] autorelease]; id rootComponents = [[[NSDateComponents alloc] init] autorelease]; [rootComponents setYear: 1600]; [rootComponents setMonth: 1]; [rootComponents setDay: 1]; self.rootDate = [gregorian dateFromComponents: rootComponents]; self.offset = [[[NSDateComponents alloc] init] autorelease]; Then, to convert the integer later to a date, I use this: [offset setDay: theLegacyDate]; id eventDate = [gregorian dateByAddingComponents: offset toDate: rootDate options: 0]; (I never change any values in offset anywhere else.) The problem is I'm getting a different time for rootDate on iOS vs. Mac OS X. On Mac OS X, I'm getting midnight. On iOS, I'm getting 8:12:28. (So far, it seems to be consistent about this.) When I add my number of days later, the weird time stays. OS | legacyDate | rootDate | eventDate ======== | ========== | ==========================|========================== Mac OS X | 143671 | 1600-01-01 00:00:00 -0800 | 1993-05-11 00:00:00 -0700 iOS | 143671 | 1600-01-01 08:12:28 +0000 | 1993-05-11 07:12:28 +0000 In the previous release of my product, I didn't care about the time; now I do. Why the weird time on iOS, and what should I do about it? (I'm assuming the hour difference is DST.) I've tried setting the hour, minute and second of rootComponents to 0. This has no impact. If I set them to something other than 0, it adds them to 8:12:28. I've been wondering if this has something to do with leap seconds or other cumulative clock changes. Or is this entirely the wrong approach to use on iOS?

    Read the article

  • How do I get the User Entered Value in AjaxControlToolkit ComboBox when the enter key is pressed?

    - by Jason
    The Problem: The user entered value is missing in the .Text attribute of the AjaxControlToolkit ComboBox when the enter key pressed. Also the “on change” events events are not called but I am not using postbacks anyway so I do not care. Example: private void BuildFileListDetails(NHibernateDataProvider _providerM) { int resultsPage = Convert.ToInt32(ddlNavPageNumber.Text); const int RESULTS_PAGE_SIZE = 100; // The cbFileName.Text equals "" Not what user entered string searchFileName= cbFileName.Text; var xrfFiles = _providerM.GetXrfFiles(searchFileName, resultsPage, RESULTS_PAGE_SIZE); gvXrfFileList.DataSource = xrfFiles; gvXrfFileList.DataBind(); } My Solution: I needed to access the AjaxToolkit "ComboBox" imbedded TextBox control's .Text to access the value entered by user. private void BuildFileListDetails(NHibernateDataProvider _providerM) { int resultsPage = Convert.ToInt32(ddlNavPageNumber.Text); const int RESULTS_PAGE_SIZE = 100; string searchFileName; //The Solution: Access the AjaxToolkit "ComboBox" imbedded TextBox control's .Text to access the value entered by user. TextBox textBox = cbFileName.FindControl("TextBox") as TextBox; if (textBox != null) { searchFileName = textBox.Text; //textBox.Text = "User Entered Value" } else { searchFileName = cbFileName.Text; } var xrfFiles = _providerM.GetXrfFiles(searchFileName, resultsPage, RESULTS_PAGE_SIZE); gvXrfFileList.DataSource = xrfFiles; gvXrfFileList.DataBind(); }

    Read the article

  • Vote on Pros and Cons of Java HTML to XML cleaners

    - by George Bailey
    I am looking to allow HTML emails (and other HTML uploads) without letting in scripts and stuff. I plan to have a white list of safe tags and attributes as well as a whitelist of CSS tags and value regexes (to prevent automatic return receipt). I asked a question: Parse a badly formatted XML document (like an HTML file) I found there are many many ways to do this. Some systems have built in sanitizers (which I don't care so much about). This page is a very nice listing page but I get kinda lost http://java-source.net/open-source/html-parsers It is very important that the parsers never throw an exception. There should always be best guess results to the parse/clean. It is also very important that the result is valid XML that can be traversed in Java. I posted some product information and said Community Wiki. Please post any other product suggestions you like and say Community Wiki so they can be voted on. Also any comments or wiki edits on what part of a certain product is better and what is not would be greatly appreciated. (for example,, speed vs accuracy..) It seems that we will go with either jsoup (seems more active and up to date) or TagSoup (compatible with JDK4 and been around awhile). A +1 for any of these products would be if they could convert all style sheets into inline style on the elements.

    Read the article

  • ffmpeg(libavcodec). memory leaks in avcodec_encode_video

    - by gavlig
    I'm trying to transcode a video with help of libavcodec. On transcoding big video files(hour or more) i get huge memory leaks in avcodec_encode_video. I have tried to debug it, but with different video files different functions produce leaks, i have got a little bit confused about that :). [Here] (http://stackoverflow.com/questions/4201481/ffmpeg-with-qt-memory-leak) is the same issue that i have, but i have no idea how did that person solve it. QtFFmpegwrapper seems to do the same i do(or i missed something). my method is lower. I took care about aFrame and aPacket outside with av_free and av_free_packet. int Videocut::encode( AVStream *anOutputStream, AVFrame *aFrame, AVPacket *aPacket ) { AVCodecContext *outputCodec = anOutputStream->codec; if (!anOutputStream || !aFrame || !aPacket) { return 1; /* NOTREACHED */ } uint8_t * buffer = (uint8_t *)malloc( sizeof(uint8_t) * _DefaultEncodeBufferSize ); if (NULL == buffer) { return 2; /* NOTREACHED */ } int packetSize = avcodec_encode_video( outputCodec, buffer, _DefaultEncodeBufferSize, aFrame ); if (packetSize < 0) { free(buffer); return 1; /* NOTREACHED */ } aPacket->data = buffer; aPacket->size = packetSize; return 0; }

    Read the article

  • what's the correct way to release a new website?

    - by kk
    so i've been working on a website on and off for about a year now, and i'm finally at a point where it's functional enough to test out in a sort of private beta (not ready for live release). but i never thought about the correct process for doing this and what things i need to take care of. i've never released a public website before. some of the questions/concerns i have in mind: 1) is it against my MSDN license agreement to release a website using the software? 2) how do i protect my "idea"? is it a bad idea to find random people you don't know to test out your site? can you make them digitally sign some sort of NDA? 3) i'm using some open source code - any proper way to release open source code to live production? 4) how much traffic can a place like discountasp.net handle anyway? can hosting sites generally handle large volume of traffic? any comments/suggestions regarding the proper/safe way to release a public website would be appreciated. i've been working on this for a while and never actually sat down to think about the right way to move from a personal side project to a live production website.

    Read the article

  • How to do Basic Authentication using FireWatir on Ubuntu Linux?

    - by lotharsmash
    Hi, I'm trying to use FireWatir (1.6.5) to access a site using Basic Authentication and I've been unable to find a solution that works on Firefox in Linux. Does FireWatir 1.6.5 support Basic Authentication on Linux? I've been searching the web for 2 days and can't get a straight answer anywhere as to how to do this. The only thread I found that seemed helpful was this one ( http://groups.google.com/group/watir-general/browse_thread/thread/d8ab9a177d282ce4/fc1bf2319fb387d8?lnk=gst&q=basic+authentication#fc1bf2319fb387d8). Aedorn Varanis says " Angrez's fork had the solution so I'm using that now. Thanks Angrez, works perfectly!", but he doesn't mention what he did to get things working. Initially I tried to bypass the authentication dialog box by using: browser.goto('http://admin:[email protected]') However, this generates a "Confirm" dialog which says: "You are about to log in to the site "172.20.1.1" with the username "admin"." [Cancel, OK] This dialog blocks, and the goto call won't return until I click "OK". Then I tried adding: browser.startClicker("ok") browser.goto('http://admin:[email protected]') But this ALSO generates the same "Confirm" dialog. I tested out the startClicker functionality using the unit test /var/ lib/gems/1.8/gems/firewatir-1.6.5/unittests/html/JavascriptClick.html and it worked fine, which makes me think that using the startClicker method is NOT the correct way to take care of the Confirm dialog. Anybody else found a way to get Basic Auth to work, or how to click the OK on the confirm dialog? I'm at my wits end...

    Read the article

  • Experience migrating legacy Cobol/PL1 to Java

    - by MadMurf
    ORIGINAL Q: I'm wondering if anyone has had experience of migrating a large Cobol/PL1 codebase to Java? How automated was the process and how maintainable was the output? How did the move from transactional to OO work out? Any lessons learned along the way or resources/white papers that may be of benefit would be appreciated. EDIT 7/7: Certainly the NACA approach is interesting, the ability to continue making your BAU changes to the COBOL code right up to the point of releasing the JAVA version has merit for any organization. The argument for procedural Java in the same layout as the COBOL to give the coders a sense of comfort while familiarizing with the Java language is a valid argument for a large organisation with a large code base. As @Didier points out the $3mil annual saving gives scope for generous padding on any BAU changes going forward to refactor the code on an ongoing basis. As he puts it if you care about your people you find a way to keep them happy while gradually challenging them. The problem as I see it with the suggestion from @duffymo to Best to try and really understand the problem at its roots and re-express it as an object-oriented system is that if you have any BAU changes ongoing then during the LONG project lifetime of coding your new OO system you end up coding & testing changes on the double. That is a major benefit of the NACA approach. I've had some experience of migrating Client-Server applications to a web implementation and this was one of the major issues we encountered, constantly shifting requirements due to BAU changes. It made PM & scheduling a real challenge. Thanks to @hhafez who's experience is nicely put as "similar but slightly different" and has had a reasonably satisfactory experience of an automatic code migration from Ada to Java. Thanks @Didier for contributing, I'm still studying your approach and if I have any Q's I'll drop you a line.

    Read the article

  • Selectively intercepting methods using autofac and dynamicproxy2

    - by Mark Simpson
    I'm currently doing a bit of experimenting using Autofac-1.4.5.676, autofac contrib and castle DynamicProxy2. The goal is to create a coarse-grained profiler that can intercept calls to specific methods of a particular interface. The problem: I have everything working perfectly apart from the selective part. I gather that I need to marry up my interceptor with an IProxyGenerationHook implementation, but I can't figure out how to do this. My code looks something like this: The interface that is to be intercepted & profiled (note that I only care about profiling the Update() method) public interface ISomeSystemToMonitor { void Update(); // this is the one I want to profile void SomeOtherMethodWeDontCareAboutProfiling(); } Now, when I register my systems with the container, I do the following: // Register interceptor gubbins builder.RegisterModule(new FlexibleInterceptionModule()); builder.Register<PerformanceInterceptor>(); // Register systems (just one in this example) builder.Register<AudioSystem>() .As<ISomeSystemToMonitor>) .InterceptedBy(typeof(PerformanceInterceptor)); All ISomeSystemToMonitor instances pulled out of the container are intercepted and profiled as desired, other than the fact that it will intercept all of its methods, not just the Update method. Now, how can I extend this to exclude all methods other than Update()? As I said, I don't understand how I'm meant to say "for the ProfileInterceptor, use this implementation of IProxyHookGenerator". All help appreciated, cheers! Also, please note that I can't upgrade to autofac2.x right now; I'm stuck with 1.

    Read the article

  • IE6 - too much spacing appearing above h3, how do I get rid of it?

    - by codemonkey613
    Example: http://bit.ly/dfjvmT If you take a look at that URL, you will see an <h3> labeled "Send Us Your Resume". Problem is -- in IE6, it has too much space at the top. It's supposed to be margin-top of 16px, but in IE6, it appears more like 24-30px. I have a reset.css file which has zeroed all margins and paddings, so it's not that. Just checked, both CSS and XHTML are valid. And I notice this spacing error only appears when I put a before this <h3>. Currently, I have <div class="top"></div> which appears before this <h3>. That part takes care of rounded corners for the container. When I remove that <div>, the spacing finally matches in both IE6 and Firefox. Of course, I need to use that <div> for rounded corners. So I'm wondering, what exactly is causing this problem, and is there a way to fix it? Thanks

    Read the article

  • Force full garbage collection when memory occupation goes beyond a certain threshold

    - by Silvio Donnini
    I have a server application that, in rare occasions, can allocate large chunks of memory. It's not a memory leak, as these chunks can be claimed back by the garbage collector by executing a full garbage collection. Normal garbage collection frees amounts of memory that are too small: it is not adequate in this context. The garbage collector executes these full GCs when it deems appropriate, namely when the memory footprint of the application nears the allotted maximum specified with -Xmx. That would be ok, if it wasn't for the fact that these problematic memory allocations come in bursts, and can cause OutOfMemoryErrors due to the fact that the jvm is not able to perform a GC quickly enough to free the required memory. If I manually call System.gc() beforehand, I can prevent this situation. Anyway, I'd prefer not having to monitor my jvm's memory allocation myself (or insert memory management into my application's logic); it would be nice if there was a way to run the virtual machine with a memory threshold, over which full GCs would be executed automatically, in order to release very early the memory I'm going to need. Long story short: I need a way (a command line option?) to configure the jvm in order to release early a good amount of memory (i.e. perform a full GC) when memory occupation reaches a certain threshold, I don't care if this slows my application down every once in a while. All I've found till now are ways to modify the size of the generations, but that's not what I need (at least not directly). I'd appreciate your suggestions, Silvio P.S. I'm working on a way to avoid large allocations, but it could require a long time and meanwhile my app needs a little stability

    Read the article

  • Writing to a log4net FileAppender with multiple threads performance problems

    - by Wayne
    TickZoom is a very high performance app which uses it's own parallelization library and multiple O/S threads for smooth utilization of multi-core computers. The app hits a bottleneck where users need to write information to a LogAppender from separate O/S threads. The FileAppender uses the MinimalLock feature so that each thread can lock and write to the file and then release it for the next thread to write. If MinimalLock gets disabled, log4net reports errors about the file being already locked by another process (thread). A better way for log4net to do this would be to have a single thread that takes care of writing to the FileAppender and any other threads simply add their messages to a queue. In that way, MinimalLock could be disabled to greatly improve performance of logging. Additionally, the application does a lot of CPU intensive work so it will also improve performance to use a separate thread for writing to the file so the CPU never waits on the I/O to complete. So the question is, does log4net already offer this feature? If so, how do you do enable threaded writing to a file? Is there another, more advanced appender, perhaps? If not, then since log4net is already wrapped in the platform, that makes it possible to implement a separate thread and queue for this purpose in the TickZoom code. Sincerely, Wayne

    Read the article

  • Getting values from DataGridView back to XDocument (using LINQ-to-XML)

    - by Pretzel
    Learning LINQ has been a lot of fun so far, but despite reading a couple books and a bunch of online resources on the topic, I still feel like a total n00b. Recently, I just learned that if my query returns an Anonymous type, the DataGridView I'm populating will be ReadOnly (because, apparently Anonymous types are ReadOnly.) Right now, I'm trying to figure out the easiest way to: Get a subset of data from an XML file into a DataGridView, Allow the user to edit said data, Stick the changed data back into the XML file. So far I have Steps 1 and 2 figured out: public class Container { public string Id { get; set; } public string Barcode { get; set; } public float Quantity { get; set; } } // For use with the Distinct() operator public class ContainerComparer : IEqualityComparer<Container> { public bool Equals(Container x, Container y) { return x.Id == y.Id; } public int GetHashCode(Container obj) { return obj.Id.GetHashCode(); } } var barcodes = (from src in xmldoc.Descendants("Container") where src.Descendants().Count() > 0 select new Container { Id = (string)src.Element("Id"), Barcode = (string)src.Element("Barcode"), Quantity = float.Parse((string)src.Element("Quantity").Attribute("value")) }).Distinct(new ContainerComparer()); dataGridView1.DataSource = barcodes.ToList(); This works great at getting the data I want from the XML into the DataGridView so that the user has a way to manipulate the values. Upon doing a Step-thru trace of my code, I'm finding that the changes to the values made in DataGridView are not bound to the XDocument object and as such, do not propagate back. How do we take care of Step 3? (getting the data back to the XML) Is it possible to Bind the XML directly to the DataGridView? Or do I have to write another LINQ statement to get the data from the DGV back to the XDocument? Suggstions?

    Read the article

  • Finding distance to the closest point in a point cloud on an uniform grid

    - by erik
    I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

    Read the article

  • Databinding question: DataGridView <=> XDocument (using LINQ-to-XML)

    - by Pretzel
    Learning LINQ has been a lot of fun so far, but despite reading a couple books and a bunch of online resources on the topic, I still feel like a total n00b. Recently, I just learned that if my query returns an Anonymous type, the DataGridView I'm populating will be ReadOnly (because, apparently Anonymous types are ReadOnly.) Right now, I'm trying to figure out the easiest way to: Get a subset of data from an XML file into a DataGridView, Allow the user to edit said data, Stick the changed data back into the XML file. So far I have Steps 1 and 2 figured out: public class Container { public string Id { get; set; } public string Barcode { get; set; } public float Quantity { get; set; } } // For use with the Distinct() operator public class ContainerComparer : IEqualityComparer<Container> { public bool Equals(Container x, Container y) { return x.Id == y.Id; } public int GetHashCode(Container obj) { return obj.Id.GetHashCode(); } } var barcodes = (from src in xmldoc.Descendants("Container") where src.Descendants().Count() > 0 select new Container { Id = (string)src.Element("Id"), Barcode = (string)src.Element("Barcode"), Quantity = float.Parse((string)src.Element("Quantity").Attribute("value")) }).Distinct(new ContainerComparer()); dataGridView1.DataSource = barcodes.ToList(); This works great at getting the data I want from the XML into the DataGridView so that the user has a way to manipulate the values. Upon doing a Step-thru trace of my code, I'm finding that the changes to the values made in DataGridView are not bound to the XDocument object and as such, do not propagate back. How do we take care of Step 3? (getting the data back to the XML) Is it possible to Bind the XML directly to the DataGridView? Or do I have to write another LINQ statement to get the data from the DGV back to the XDocument? Suggstions?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Can NSCollectionView autoresize the width of its subviews to display one column

    - by littlecharva
    Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

    Read the article

  • Converting John Resig's JavaScript Templating Engine to work with PHP Templates

    - by Serhiy
    I'm trying to convert the John Resig's Templating Engine to work with PHP. Essentially what I would like to achieve is the ability to use certain Kohana Views via a JavaScript templating engine, that way I can use the same views for both a standard PHP request and a jQuery AJAX request. I'm starting with the basics and would like to be able to convert http://github.com/nje/jquery-tmpl/blob/master/jquery.tmpl.js To work with php like so... ### From This ### <li><a href="{%= link %}">{%= title %}</a> - {%= description %}</li> ### Into This ### <li><a href="<?= $link ?>"><?= $title ?></a> - <?= description ?></li> The RexEx in it is a bit over my head and it's apparently not as easy as changing the %} to ? in lines 148 to 158. Any help would be highly appreciated. I'm also not sure of how to take care of the $ difference that PHP variables have. Thanks, Serhiy

    Read the article

< Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >