Search Results

Search found 5313 results on 213 pages for 'steve care'.

Page 174/213 | < Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >

  • Why calling Process.killProcess(Process.myPid()) is a bad idea?

    - by Tal Kanel
    I've read some posts saying using this method is "not good", shouldn't been use, it's not the right way to "close" the application and it's not how android works... I understand and accept the fact that Android OS knows better then me when it's the right time to terminate the process, but I didn't heard yet a good explanation why it's wrong using the killProcess() method?. after all - it's part of the android API... what I do know is that calling this method while other threads doing in potential an important work (operations on files, writing to DB, HTTP requests, running services..) can be terminated in the middle, and it's clearly not good. also I know I can benefit from the fact that "re-open" the application will be faster, cause the system maybe still "holds" in memory state from last time been used, and killProcess() prevents that. beside this reason, in assumption I don't have such operations, and I don't care my application will load from scratch each run, there are other reasons why not using the killProcess() method? I know about finish() method to close an Activity, so don't write me about that please.. finish() is only for Activity. not to all application, and I think I know exactly why and when to use it... and another thing - I'm developing also games with the Unity3D framework, and exporting the project to android. when I decompiled the generated apk, I was very suprised to find out that the java source code created from unity - implementing Unity's - Application.quit() method, with Process.killProcess(Process.myPid()). Application.quit() is suppose to be the right way to close game according to Unity3d guides (is it really?? maybe I'm wrong, and missed something), so how it happens that the Unity's framework developers which doing a very good work as it seems implemented this in native android to killProcess()? anyway - I wish to have a "list of reasons" why not using the killProcess() method, so please write down your answer - if you have something interesting to say about that. TIA

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Converting John Resig's JavaScript Templating Engine to work with PHP Templates

    - by Serhiy
    I'm trying to convert the John Resig's Templating Engine to work with PHP. Essentially what I would like to achieve is the ability to use certain Kohana Views via a JavaScript templating engine, that way I can use the same views for both a standard PHP request and a jQuery AJAX request. I'm starting with the basics and would like to be able to convert http://github.com/nje/jquery-tmpl/blob/master/jquery.tmpl.js To work with php like so... ### From This ### <li><a href="{%= link %}">{%= title %}</a> - {%= description %}</li> ### Into This ### <li><a href="<?= $link ?>"><?= $title ?></a> - <?= description ?></li> The RexEx in it is a bit over my head and it's apparently not as easy as changing the %} to ? in lines 148 to 158. Any help would be highly appreciated. I'm also not sure of how to take care of the $ difference that PHP variables have. Thanks, Serhiy

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • Are SharePoint site templates really less performant than site definitions?

    - by Jim
    So, it seems in the SharePoint blogosphere that everybody just copies and pastes the same bullet points from other blogs. One bullet point I've seen is that SharePoint site templates are less performant than site definitions because site definitions are stored on the file system. Is that true? It seems odd that site templates would be less performant. It's my understanding that all site content lives in a database, whether you use a site template or a site definition. A site template is applied once to the database, and from then on the site should not care if the content was created using a site template or not. So, does anybody have an architectural reason why a site template would be less performant than a site definition? Edit: Links to the blogs that say there is a performance difference: From MSDN: Because it is slow to store templates in and retrieve them from the database, site templates can result in slower performance. From DevX: However, user templates in SharePoint can lead to performance problems and may not be the best approach if you're trying to create a set of reusable templates for an entire organization. From IT Footprint: Because it is slow to store templates in and retrieve them from the database, site templates can result in slower performance. Templates in the database are compiled and executed every time a page is rendered. From Branding SharePoint:Custom site definitions hold the following advantages over custom templates: Data is stored directly on the Web servers, so performance is typically better. At a minimum, I think the above articles are incomplete, and I think several are misleading based on what I know of SharePoints architecture. I read another blog post that argued against the performance differences, but I can't find the link.

    Read the article

  • Regex to extract portions of file name

    - by jakesankey
    I have text files formatted as such: R156484COMP_004A7001_20100104_065119.txt I need to consistently extract the R****COMP, the 004A7001 number, 20100104 (date), and don't care about the 065119 number. the problem is that not ALL of the files being parsed have the exact naming convention. some may be like this: R168166CRIT_156B2075_SU2_20091223_123456.txt or R285476COMP_SU1_125A6025_20100407_123456.txt So how could I use regex instead of split to ensure I am always getting that serial (ex. 004A7001), the date (ex. 20100104), and the R****COMP (or CRIT)??? Here is what I do now but it only gets the files formatted like my first example. if (file.Count(c => c == '_') != 3) continue; and further down in the code I have: string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); UPDATE: This is now where I am at -- I get an error to parse RNumberDate to an actual date format. "Cannot implicitly convert type 'RegularExpressions.Match' to 'string' string RNumber = Path.GetFileNameWithoutExtension(file); Match RNumberE = Regex.Match(RNumber, @"^(R|L)\d{6}(COMP|CRIT|TEST|SU[1-9])(?=_)", RegexOptions.IgnoreCase); Match RNumberD = Regex.Match(RNumber, @"(?<=_)\d{3}[A-Z]\d{4}(?=_)", RegexOptions.IgnoreCase); Match RNumberDate = Regex.Match(RNumber, @"(?<=_)\d{8}(?=_)", RegexOptions.IgnoreCase); DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy")

    Read the article

  • how to write this typical mysql query( ho to use subquery column into main query)

    - by I Like PHP
    I HAVE TWO TABLES shown below table_joining id join_id(PK) transfer_id(FK) unit_id transfer_date joining_date 1 j_1 t_1 u_1 2010-06-05 2010-03-05 2 j_2 t_2 u_3 2010-05-10 2010-03-10 3 j_3 t_3 u_6 2010-04-10 2010-01-01 4 j_5 NULL u_3 NULL 2010-06-05 5 j_6 NULL u_4 NULL 2010-05-05 table_transfer id transfer_id(PK) pastUnitId futureUnitId effective_transfer_date 1 t_1 u_3 u_1 2010-06-05 2 t_2 u_6 u_1 2010-05-10 3 t_3 u_5 u_3 2010-04-10 now i want to know total employee detalis( using join_id) which are currently working on unit u_3 . means i want only join_id j_1 (has transfered but effective_transfer_date is future date, right now in u_3) j_2 ( tansfered and right now in `u_3` bcoz effective_transfer_date has been passed) j_6 ( right now in `u_3` and never transfered) what i need to take care of below steps( as far as i know ) <1> first need to check from table_joining whether transfer_id is NULL or not <2> if transfer_id= is NULL then see unit_id=u_3 where joining_date <=CURDATE() ( means that person already joined u_3) <3> if transfer_id is NOT NULL then go to table_transfer using transfer_id (foreign key reference) <4> now see the effective_transfer_date regrading that transfer_id whether effective_transfer_date<=CURDATE() <5> if transfer date has been passed(means transfer has been done) then return futureUnitID otherwise return pastUnitID i used two separate query but don't know how to join those query?? for step <1 ans <2 SELECT unit_id FROM table_joining WHERE joining_date<=CURDATE() AND transfer_id IS NULL AND unit_id='u_3' for step<5 SELECT IF(effective_transfer_date <= CURDATE(),futureUnitId,pastUnitId) AS currentUnitID FROM table_transfer // here how do we select only those rows which have currentUnitID='u_3' ?? please guide me the process?? i m just confused with JOINS. i think using LEFT JOIN can return the data i need, but i m not getting how to implement ...please help me. Thanks for helping me alwayz

    Read the article

  • PCA extended face recognition

    - by cMinor
    The state of the art says that we can use PCA to perform face recognition. like this, this or this I am working with a project that involves training a classifier to detect a person who is wearing glasess or hats or even a mustache. The purpose of doing this is to detect when a person that has robbed a bank, store, or have commeted some sort of crime(s) (we have their image in a database), enters a certain place ( historically we know these guys have robbed, so we should take care to avoid problems). We came first to have a distributed database with all images of criminals, then I thought to have a layer of them clasifying these criminals using accesories like hats, mustache or anything that hides their face etc... Then, to apply that knowledge to detect when a particular or a suspect person enters a comercial place. ( In practice when someone is going to rob not all the times they are using an accesorie...) What do you think about this idea of doing PCA to first detect principal components of the face and then the components of an accesory. I was thinking that maybe a probabilistic approach is better so we can compute the probability the criminal is the person that entered a place and call the respective authorities.

    Read the article

  • Linq to SQL with INSTEAD OF Trigger and an Identity Column

    - by Bob Horn
    I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

    Read the article

  • GAE modeling relationship options

    - by Sway
    Hi there, I need to model the following situation and I can't seem to find a consistent example on how to do it "correctly" for the google app engine. Suppose I've got a simple situation like the following: [Company] 1 ----- M [Stare] A company has one to many stores. Each store has an address made up of a address line 1, city, state, country, postcode etc. Ok. Lets say we need to create say an "Audit". An Audit is for a company and can be across one to many stares. So something like: [Audit] 1 ------ 1 [Company] 1 ------ M [Store] Now we need to query all of the "audits" based on the Store "addresses" in order to send the "Auditors" to the right locations. There seem to be numerous articles like this one: http://code.google.com/appengine/articles/modeling.html Which give examples of creating a "ContactCompany" model class. However they also say that you should use this kind of relationship only when you "really need to" and with "care" for performance. I've also read - frequently - that you should denormalize as much as possible thereby moving all of the "query-able" data into the Audit class. So what would you suggest as the best way to solve this? I've seen that there is an Expando class but I'm not sure if that is the "best" option for this. Any help or thoughts on this would be totally appreciated. Thanks in advance, Matt

    Read the article

  • reconstructing a tree from its preorder and postorder lists.

    - by NomeN
    Consider the situation where you have two lists of nodes of which all you know is that one is a representation of a preorder traversal of some tree and the other a representation of a postorder traversal of the same tree. I believe it is possible to reconstruct the tree exactly from these two lists, and I think I have an algorithm to do it, but have not proven it. As this will be a part of a masters project I need to be absolutely certain that it is possible and correct (Mathematically proven). However it will not be the focus of the project, so I was wondering if there is a source out there (i.e. paper or book) I could quote for the proof. (Maybe in TAOCP? anybody know the section possibly?) In short, I need a proven algorithm in a quotable resource that reconstructs a tree from its pre and post order traversals. Note: The tree in question will probably not be binary, or balanced, or anything that would make it too easy. Note2: Using only the preorder or the postorder list would be even better, but I do not think it is possible. Note3: A node can have any amount of children. Note4: I only care about the order of siblings. Left or right does not matter when there is only one child.

    Read the article

  • Exporting/Importing events to Outlook 2007 calendar - problem

    - by iandisme
    I work on a web app that involves scheduling. A user can view his schedule, and then download a meeting request file for a particular event. In Outlook 2003, simply opening this event would cause a meeting request to pop up and the user could accept, which would either add or update the event in their calendar. However, in Outlook 2007, the meeting request Accept function is disabled, and the reason given is that the user is the organizer and can't accept his own event request. The ICS file clearly shows that this is not the case. Has anyone experienced this same problem? Does anyone know how to work around it? (Using Outlook's import function is scarcely an option because it causes duplicate events to be created; the import function doesn't seem to care that the events have the same UID) Here is the ICS file: BEGIN:VCALENDAR PRODID:#{my app} VERSION:2.0 CALSCALE:GREGORIAN METHOD:REQUEST BEGIN:VEVENT DTSTAMP:20100324T150236Z UID:eeb639a1-f8e5-4eab-ab3c-232ad91364c6 SEQUENCE:2 ORGANIZER:#{myApp}.#{myDomain}.com DESCRIPTION: DTSTART;TZID=Europe/London:20110620T120010 DTEND;TZID=Europe/London:20110620T133010 SUMMARY:BREAK:Breakfast LOCATION:Room 101 END:VEVENT BEGIN:VTIMEZONE //Timezone info edited for brevity END:VTIMEZONE END:VCALENDAR

    Read the article

  • Scrolling down to next element via keypress & scrollTo plugin - jQuery

    - by lyrae
    I am using jQuery's scrollTo plugin to scroll up and down my page, using UP arrow and DOWN arrow. i have a bunch of div with class "screen", as so: <div class="screen-wrapper">...</div> What I am trying to do is, when i press UP or DOWN, the window scrolls to the next, or previous div with class of "screen". I have the keypresses taken care of. According to the plugin docs, to scroll a window, you use $.scrollTo(...); Here's the code I have: $(document).keypress(function(e){ switch (e.keyCode) { case 40: // down n = $('.screen-wrapper').next() $.scrollTo( n, 800 ); break; case 38: // up break; case 37: // left break; case 39: // right break; } }); And if it helps, here's the HTML div. I have a few of these on the page, and essentially, am trying to scroll to next one by pressing down arrow: <div class='screen-wrapper'> <div class='screen'> <div class="sections"> <ul> <li><img src="images/portfolio/sushii-1.png " /></li> <li><img src="images/portfolio/sushii-2.png" /></li> <li><img src="images/portfolio/sushii-3.png" /></li> </ul> </div> <div class="next"></div> <div class="prev"></div> </div> And also if it needed, I can provide a link where this is being used if it'll help someone get a better idea. edit And, i forgot to mention what the real question here is. The question/problem is that it won't scroll down past the first element, as seth mentioned.

    Read the article

  • perl dynamic path given to 'use lib'

    - by Ed Hyer
    So, my code (Perl scripts and Perl modules) sits in a tree like this: trunk/ util/ process/ scripts/ The 'util' directory has, well, utilities, that things in the 'process/' dir need. They get access like this: use FindBin; use lib "$FindBin::Bin/../util"; use UtilityModule qw(all); That construct doesn't care where you start, as long as you're at the same level in the tree as "util/". But I decided that 'scripts/' was getting too crowded, so I created scripts/scripts1 scripts/scripts2 Now I see that this doesn't work. If I run a script 'trunk/scripts/scripts1/call_script.pl', and it calls '/trunk/process/process_script.pl', then 'process_script.pl' will fail trying to get the routines from UtilityModule(), because the path that FindBin returns is the path of the top-level calling script. The first ten ways I thought of to solve this all involved something like: use lib $path_that_came_from_elsewhere; but that seems to be something Perl doesn't like to do, except via that FindBin trick. I tried some things involving BEGIN{} blocks, but i don't really know what I'm doing there, and will likely just end up refactoring. But if someone has some clever insight into this type of problem, this would be a good chance to earn some points!

    Read the article

  • iphone webview dynamic font support

    - by Kiran
    Friends, I am trying to build a simple iphone application to view a local webpage that uses dynamic fonts. The url is www.eenadu.net. I have just a single view based application and inserted a webview into the view and implementing the webviewdelegate in viewcontroller. The site uses ttf/eot fonts that are dynamically downloadable by browser from http://www.eenadu.net/eenadu.ttf or http://www.eenadu.net/EENADU0.eot. Here is what I am doing in the code by doing some research: Code: ( void ) loadFont { NSString *fontPath = [[NSBundle mainBundle] pathForResource:@"eenadu" ofType:@"ttf"]; CGDataProviderRef fontDataProvider = CGDataProviderCreateWithFilename([fontPath UTF8String]); // Create the font with the data provider, then release the data provider. customFont = CGFontCreateWithDataProvider(fontDataProvider); CGDataProviderRelease(fontDataProvider); fontPath = [[NSBundle mainBundle] pathForResource:@"eenadu" ofType:@"eot"]; fontDataProvider = CGDataProviderCreateWithFilename([fontPath UTF8String]); // Create the font with the data provider, then release the data provider. customFont = CGFontCreateWithDataProvider(fontDataProvider); CGDataProviderRelease(fontDataProvider); } (void) viewDidLoad { [super viewDidLoad]; [self loadFont]; [webView setBackgroundColor:[UIColor whiteColor]]; NSString *urlAddress = @"http://www.eenadu.net/"; NSURL *url = [NSURL URLWithString:urlAddress]; NSURLRequest *requestObj = [NSURLRequest requestWithURL:url]; [webView loadRequest:requestObj]; } I see that the page loads however doesn't display the font. Please help. Also, For loadFont, I have included the fonts in the build with right names and took care of the case as well.

    Read the article

  • Alternative Python standard library reference

    - by Ender
    I love Python; I absolutely despise its official documentation. Tutorials do not count as library references, but that appears to be what they're attempting. What I really want is the ability to find a class in the standard library and view documentation for all of its properties and methods. Actionscript, MSDN, and Java all do this just fine (although each with their odd quirks). Where is this for python? For example, I wanted to sort a list. mylist.sort(). Awesome. But what if I wanted it sorted in descending order? Official documentation is not - much - help. Or what if I wanted to specify a key function? That's also supported: mylist.sort(key=lamba item: item.customVar)- but documented...where? I understand that Python's approach to OOP may not be equivalent to Java et. al. Maybe list isn't actually a class - maybe it's just a function that returns an iterable when the tachyon beams are set to glorious and the unboxed hyper enumeration is quantized, but...I don't care. I just want to know how to sort lists. (Apologies for the angst - too much caffeine today)

    Read the article

  • "User Friendly" .net compatible Regex/Text matching tools?

    - by Binary Worrier
    Currently in our software we provide a hook where we call a DLL built by our clients to parse information out of documents we are processing (the DLL takes in some text (or a file) and returns a list of name/value pairs). e.g. We're given a Word doc or Text file to Archive. We do various things to the file, and call a DLL that will return "pertinent" information about the file. Among other things we store that "pertinent" data for posterity. What is considered "pertinent" depends on the client and the type of the document, we don't care, we get it and store it. I've been asked to develop a user friendly "something" that will allow a non-programmer user to "configure" how to get this data from a plain text document (<humor>The user story ends with the helpful suggestion/query "We could use regex for this?"</humor>) It's safe to assume that a list of regex's isn't going to cut this, I've written some of these parsers for customers, the regex's to do these would be hedious and some of them can't be done by regex's. Also one of the requirements above is "user friendly" which negates anything that has users seeing or editing regex expressions. As you can guess, I don't have a fortune of time to do this, and am wondering is there anything out there that I can plug in to our app that has a nice front end and does exactly what I need? :) No? Whadda mean no! . . . sigh Ok then failing that, anything out there that "visually" builds regex's and/or other pattern matching expressions, and then allows one to run those expressions against some text? The MS BRE will do what I want, but I need something prettier that looks less like code. Thanks guys,

    Read the article

  • How to implement properly plugins in C#?

    - by MartyIX
    I'm trying to add plugins to my game and what I'm trying to implement is this: Plugins will be either mine or 3rd party's so I would like a solution where crashing of the plugin would not mean crashing of the main application. Methods of plugins are called very often (for example because of drawing of game objects). What I've found so far: 1) http://www.codeproject.com/KB/cs/pluginsincsharp.aspx - simple concept that seems like it should work nicely. Since plugins are used in my game for every round I would suffice to add the Restart() method and if a plugin is no longer needed Unload() method + GC should take care of that. 2) http://mef.codeplex.com/Wikipage - Managed Extensibility Framework - my program should work on .NET 3.5 and I don't want to add any other framework separately I want to write my plugin system myself. Therefore this solution is out of question. 3) Microsoft provides: http://msdn.microsoft.com/en-us/library/system.addin.aspx but according to a few articles I've read it is very complex. 4) Different AppDomains for plugins. According to Marc Gravell ( http://stackoverflow.com/questions/665668/usage-of-appdomain-in-c ) different AppDomains allow isolation. Unloading of plugins would be easy. What would the performance load be? I need to call methods of plugins very often (to draw objects for example). Using Application Domains - http://msdn.microsoft.com/en-us/library/yb506139.aspx A few tutorials on java2s.com Could you please comment on my findings? New approaches are also welcomed! Thanks!

    Read the article

  • Is there a way to effect user defined data types in MySQL?

    - by Dancrumb
    I have a database which stores (among other things), the following pieces of information: Hardware IDs BIGINTs Storage Capacities BIGINTs Hardware Names VARCHARs World Wide Port Names VARCHARs I'd like to be able to capture a more refined definition of these datatypes. For instance, the hardware IDs have no numerical significance, so I don't care how they are formatted when displayed. The Storage Capacities, however, are cardinal numbers and, at a user's request, I'd like to present them with thousands and decimal separators, e.g. 123,456.789. Thus, I'd like to refine BIGINT into, say ID_NUMBER and CARDINAL. The same with Hardware Names, which are simple text and WWPNs, which are hexstrings, e.g. 24:68:AC:E0. Thus, I'd like to refine VARCHAR into ENGLISH_WORD and HEXSTRING. The specific datatypes I made up are just for illustrative purposes. I'd like to keep all this information in one place and I'm wondering if anybody knows of a good way to hold this all in my MySQL table definitions. I could use the Comment field of the table definition, but that smells fishy to me. One approach would be to define the data structure elsewhere and use that definition to generate my CREATE TABLEs, but that would be a major rework of the code that I currently have, so I'm looking for alternatives. Any suggestions? The application language in use is Perl, if that helps.

    Read the article

  • Seperation of game- and rendering logic

    - by Qua
    What is the best way to seperate rendering code from the actually game engine/logic code? And is it even a good idea to seperate those? Let's assume we have a game object called Knight. The Knight has to be rendered on the screen for the user to see. We're now left with two choices. Either we give the Knight a Render/Draw method that we can call, or we create a renderer class that takes care of rendering all knights. In the scenario where the two is seperated the Knight should the knight still contain all the information needed to render him, or should this be seperated as well? In the last project we created we decided to let all the information required to render an object be stored inside the object itself, but we had a seperate component to actually read those informations and render the objects. The object would contain information such as size, rotation, scale, and which animation was currently playing and based on this the renderer object would compose the screen. Frameworks such as XNA seem to think joining the object and rendering is a good idea, but we're afraid to get tied up to a specific rendering framework, whereas building a seperate rendering component gives us more freedom to change framework at any given time.

    Read the article

  • R + Bioconductor : combining probesets in an ExpressionSet

    - by Mike Dewar
    Hi, First off, this may be the wrong Forum for this question, as it's pretty darn R+Bioconductor specific. Here's what I have: library('GEOquery') GDS = getGEO('GDS785') cd4T = GDS2eSet(GDS) cd4T <- cd4T[!fData(cd4T)$symbol == "",] Now cd4T is an ExpressionSet object which wraps a big matrix with 19794 rows (probesets) and 15 columns (samples). The final line gets rid of all probesets that do not have corresponding gene symbols. Now the trouble is that most genes in this set are assigned to more than one probeset. You can see this by doing gene_symbols = factor(fData(cd4T)$Gene.symbol) length(gene_symbols)-length(levels(gene_symbols)) [1] 6897 So only 6897 of my 19794 probesets have unique probeset - gene mappings. I'd like to somehow combine the expression levels of each probeset associated with each gene. I don't care much about the actual probe id for each probe. I'd like very much to end up with an ExpressionSet containing the merged information as all of my downstream analysis is designed to work with this class. I think I can write some code that will do this by hand, and make a new expression set from scratch. However, I'm assuming this can't be a new problem and that code exists to do it, using a statistically sound method to combine the gene expression levels. I'm guessing there's a proper name for this also but my googles aren't showing up much of use. Can anyone help?

    Read the article

  • Filtering Wikipedia's XML dump: error on some accents

    - by streetpc
    I'm trying to index Wikpedia dumps. My SAX parser make Article objects for the XML with only the fields I care about, then send it to my ArticleSink, which produces Lucene Documents. I want to filter special/meta pages like those prefixed with Category: or Wikipedia:, so I made an array of those prefixes and test the title of each page against this array in my ArticleSink, using article.getTitle.startsWith(prefix). In English, everything works fine, I get a Lucene index with all the pages except for the matching prefixes. In French, the prefixes with no accent also work (i.e. filter the corresponding pages), some of the accented prefixes don't work at all (like Catégorie:), and some work most of the time but fail on some pages (like Wikipédia:) but I cannot see any difference between the corresponding lines (in less). I can't really inspect all the differences in the file because of its size (5 GB), but it looks like a correct UTF-8 XML. If I take a portion of the file using grep or head, the accents are correct (even on the incriminated pages, the <title>Catégorie:something</title> is correctly displayed by grep). On the other hand, when I rectreate a wiki XML by tail/head-cutting the original file, the same page (here Catégorie:Rock par ville) gets filtered in the small file, not in the original… Any idea ? Alternatives I tried: Getting the file (commented lines were tried wihtout success): FileInputStream fis = new FileInputStream(new File(xmlFileName)); //ReaderInputStream ris = ReaderInputStream.forceEncodingInputStream(fis, "UTF-8" ); //(custom function opening the stream, reading it as UFT-8 into a Reader and returning another byte stream) //InputSource is = new InputSource( fis ); is.setEncoding("UTF-8"); parser.parse(fis, handler); Filtered prefixes: ignoredPrefix = new String[] {"Catégorie:", "Modèle:", "Wikipédia:", "Cat\uFFFDgorie:", "Mod\uFFFDle:", "Wikip\uFFFDdia:", //invalid char "Catégorie:", "Modèle:", "Wikipédia:", // UTF-8 as ISO-8859-1 "Image:", "Portail:", "Fichier:", "Aide:", "Projet:"}; // those last always work

    Read the article

  • WPF Sizing of Panels

    - by Mystagogue
    I'm looking for an article or overview of WPF Panel types, that explains the sizing characters of each. For example, here are the panel types: http://msdn.microsoft.com/en-us/library/ms754152.aspx#Panels_derived_elements I've learned (by experiment) that UniformGrid can be given a fixed height, or it can be "auto" where it expands to fit available space. That is great, but what I wanted was for Uniform Grid to shrink to fit its internal content (particularly content that is provided dynamically, at run-time). I don't think it has that ability. So I'd like to know either what other Panel I could use for that purpose, or what Panel I should nest the UniformGrid inside of. But I don't just want an answer to that specific question. I want the sizing dynamics and capabilities of all the Panel types, in summary form, so I can make all these choices as needed. Online I find articles that cover only half the Panel types, and don't give as much information about sizing as I'm describing. Anyone know the link (or book) that has the info I'm seeking? p.s. Since I want the UniformGrid to shrink to the dynamic content I'm providing, I could just keep track of the total height of controls placed within, and then set the height of the UniformGrid. But it would be nice if WPF took care of this for me.

    Read the article

  • application packaging

    - by user285825
    The application packaging (software deliverables) is a vague concept to me. I worked in web application before so all I know how to prepare the deliverables ie WAR and then put them into the servlet container and rest of this being taken care of. But when considering other java or c++-based application (.exe or .class) how to prepare the package? What should be considered for preparation of the package and deployment of the application? Like I understand there should be some entries made into the windows registry or some libraries to be put in /usr/bin directory and so on. And during the development phase the execution and testing is done in more informal manner like writing some shell script or so on. But the deployment scenario is a more formal thing. As I said I have only the idea of deploying web applications I am not much knowledgeable in the other areas. Are there any kind of conventions like there are conventions for documentations like javadoc or doxygen/man pages? Application packaging is not that sort of a thing that there are much discussion on books or online materials. This is very disappointing.

    Read the article

  • Frameset isn't working in IE

    - by Cameroon
    First of all, why use a frame set in the first place you ask? answer: Because my boss told me. That been said, I have 2 files. Index.html and Head.html. Contents of index.html: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Frameset//EN" "http://www.w3.org/TR/1999/REC-html401-19991224/frameset.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1" /> <title>Site Title</title> </head> <frameset rows="122,*" FRAMEBORDER=NO FRAMESPACING=2 BORDER=0> <frame name="t" src="head.html" scrolling="no" marginheight="0" marginwidth="0"> <frame name="b" src="http://www.website.com"> </frameset> <noframes> <p>You have frames turned off on your browser, please turn it on and reload this page.</p> </noframes> </html> Contents of head.html: <div style="border-bottom:2px solid #000;height:120px"> <center>This is the frame head.</center> </div> The code works fine in all browsers except Internet Explorer 7 and 8 (I don't care about 6). Is there anything I am doing wrong, and if not then can the same effect be achieved without frames and if so how?

    Read the article

< Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >