Search Results

Search found 62199 results on 2488 pages for 'first order logic'.

Page 180/2488 | < Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >

• Error compiling / linking e text editor on Linux

  - by jckdnk111

  The code compiles without too much complaint, but the last step fails with the error below. There is some discussion about it on the e forum, but still no answer. [LD] e ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x0): multiple definition of `_pcre_OP_lengths' .objs.release/cx_pcre_tables.o:(.rodata+0x0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x70): multiple definition of `_pcre_utf8_table1' .objs.release/cx_pcre_tables.o:(.rodata+0x70): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x88): multiple definition of `_pcre_utf8_table1_size' .objs.release/cx_pcre_tables.o:(.rodata+0x88): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x8c): multiple definition of `_pcre_utf8_table2' .objs.release/cx_pcre_tables.o:(.rodata+0x8c): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xa4): multiple definition of `_pcre_utf8_table3' .objs.release/cx_pcre_tables.o:(.rodata+0xa4): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xc0): multiple definition of `_pcre_utf8_table4' .objs.release/cx_pcre_tables.o:(.rodata+0xc0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x180): multiple definition of `_pcre_utt_names' .objs.release/cx_pcre_tables.o:(.rodata+0x100): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt_names' changed from 657 in .objs.release/cx_pcre_tables.o to 740 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x480): multiple definition of `_pcre_utt' .objs.release/cx_pcre_tables.o:(.rodata+0x3a0): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt' changed from 630 in .objs.release/cx_pcre_tables.o to 696 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x738): multiple definition of `_pcre_utt_size' .objs.release/cx_pcre_tables.o:(.rodata+0x618): first defined here .objs.release/cx_pcre_exec.o: In function `match(doc_byte_iter, unsigned char const*, doc_byte_iter, int, match_data*, unsigned long, eptrblock*, int, unsigned int)': cx_pcre_exec.cpp:(.text+0x1c2a): undefined reference to `_pcre_ord2utf8(int, unsigned char*)' .objs.release/eauibook.o: In function `eAuiNotebook::LoadPerspective(wxString const&)': eauibook.cpp:(.text+0x9ad): undefined reference to `wxTabFrame::SetTabCtrlHeight(int)' .objs.release/PreviewDlg.o: In function `global constructors keyed to _ZN10PreviewDlg13sm_eventTableE': PreviewDlg.cpp:(.text+0x11b2): undefined reference to `wxEVT_WEB_TITLECHANGE' PreviewDlg.cpp:(.text+0x11ee): undefined reference to `wxEVT_WEB_DOMCONTENTLOADED' .objs.release/PreviewDlg.o: In function `PreviewDlg::RefreshBrowser(PreviewDlg::cxUpdateMode)': PreviewDlg.cpp:(.text+0x2a47): undefined reference to `wxWebControl::OpenURI(wxString const&, unsigned int, wxWebPostData*, bool)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnWebDocumentComplete(wxWebEvent&)': PreviewDlg.cpp:(.text+0x3259): undefined reference to `wxWebControl::GetCurrentURI() const' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x4984): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x49c5): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x562f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x68e4): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x6925): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x758f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonForward(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x132): undefined reference to `wxWebControl::GoForward()' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonBack(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x182): undefined reference to `wxWebControl::GoBack()' ../ecore/libecore.so(cxInternal.o): In function `cxInternal::MoveOldSettings(eSettings&)': cxInternal.cpp:(.text+0x4d29): undefined reference to `eSettings::SetPageSettings(unsigned int, wxString const&, doc_id, int, int, wxString const&, std::vector<unsigned int, std::allocator<unsigned int> > const&, std::vector<cxBookmark, std::allocator<cxBookmark> > const&, eSettings::SubPage)' collect2: ld returned 1 exit status make: *** [e] Error 1 EDIT: Forgot the link http://github.com/etexteditor/e

  Read the article

• Create custom rewrite rule for my WordPress plugin

  - by kitsched

  I'm writing a plug-in for WordPress which in fact will be a separate ordering module (it will be placed in an IFRAME on the site I'm developing as well as others) but with its admin tied into WordPress. I wrote the administration part without too much hassle, however I'm having trouble with the front-end. First of all I'd like my script to be accessible via www.mysite.com/order/ and, as per the WordPress codex, I found I need to place the following code into my main plugin file: add_action('init', 'ta_flush_rewrite_rules'); function ta_flush_rewrite_rules() { global $wp_rewrite; $wp_rewrite->flush_rules(); } add_action('generate_rewrite_rules', 'ta_add_rewrite_rules'); function ta_add_rewrite_rules( $wp_rewrite ) { $new_rules = array("order/(.+)" => "/wp-content/plugins/my-plugin/order.php"); $wp_rewrite->rules = $new_rules + $wp_rewrite->rules; } But it doesn't work and I don't really want to get dirty with .htaccess hacking. Furthermore even if this would work, the order.php file is a separate file from my plugin. This means that I'll have to include some WordPress files in order to have access to the database and other helper classes and functions. That brings us to question number 2: is there a way for the URL to call a function of my plugin to render the order page?

  Read the article

• Haskell Parsec Numeration

  - by Martin

  I'm using Text.ParserCombinators.Parsec and Text.XHtml to parse an input like this: - First type A\n -- First type B\n - Second type A\n -- First type B\n --Second type B\n And my output should be: <h11 First type A\n</h1 <h21.1 First type B\n</h2 <h12 Second type A\n</h2 <h22.1 First type B\n</h2 <h22.2 Second type B\n</h2 I have come to this part, but I cannot get any further: title1= do{ ;(count 1 (char '-')) ;s <- many1 anyChar newline ;return (h1 << s) } title2= do{ ;(count 2 (char '--')) ;s <- many1 anyChar newline ;return (h1 << s) } text=do { ;many (choice [try(title1),try(title2)]) } main :: IO () main = do t putStr "Error: " print err Right x - putStrLn $ prettyHtml x This is ok, but it does not include the numbering. Any ideas? Thanks!

  Read the article

• Populating objects in C#

  - by acadia

  Hello, I have Order,OrderDetails and OrderStatus objects as shown below: public class Order { public override int OrderId { get; set; } public string FName { get; set; } public string MName { get; set; } public string LName { get; set; } public string Street { get; set; } public string City { get; set; } public List<OrderDetails> OrderDetails { get; set; }; } public class OrderDetails { public override int OrderdetailsId { get; set; } public int OrderId { get; set; } public int ProductID { get; set; } public int Qty { get; set; } public List<OrderStatus> OrderStat { get; set; }; } public class OrderStatus { public override int OrderdetailsStatusId { get; set; } public int OrderdetailsId { get; set; } public int StatusID { get; set; } } I cannot use LinQ. I want to populate the order object like we do in LinQ. How do I populate all all the properties in Order object: for eg. Order o =new Order(); o.FName="John"; o.LName="abc"; o.Street="TStreet"; o.City="Atlanta"; then o.Orderdetails.Add(orderdetails) How do I do that here in C# when not using LinQ.

  Read the article

• Adding Table Columns to a Group by clause - Ruby on Rails - Postgresql

  - by bgadoci

  I am trying to use Heroku and apparently Postgresql is a lot more strict than SQL for aggregate functions. When I am pushing to Heroku I am getting an error stating the below. On another question I asked I received some guidance that said I should just add the columns to my group by clause and I am not sure how to do that. See the full error below and the PostsControll#index. SELECT posts.*, count(*) as vote_total FROM "posts" INNER JOIN "votes" ON votes.post_id = posts.id GROUP BY votes.post_id ORDER BY created_at DESC LIMIT 5 OFFSET 0): PostsController def index @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @ugtag_counts = Ugtag.count(:group => :ugctag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @vote_counts = Vote.count(:group => :post_title, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes unless(params[:tag_name] || "").empty? conditions = ["tags.tag_name = ? ", params[:tag_name]] joins = [:tags, :votes] end @posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "created_at DESC", :page => params[:page], :per_page => 5) @popular_posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "vote_total DESC", :page => params[:page], :per_page => 3) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.json { render :json => @posts } format.atom end end

  Read the article

• Magento - Authorize.net - Get Payment Update for expired transactions

  - by pspahn

  Magento 1.6.1 I have set up Authorize.net (AIM) for the client's store. Previously they were using saved CC method and entering information manually in Authorize.net's merchant terminal. Most of it is working as expected, however for transactions that are flagged as 'Suspected Fraud' by Authorize.net, if the client does not update the transaction manually before the authorization expires, using 'Get Payment Update' in Magento fails because the transaction is expired (I believe it's five days for an authorize only transaction). For the client, it seems the only way to update this order in Magento is to simply delete the order, as it doesn't appear the Paygate model knows about expired transactions. Performing 'Get Payment Update' simply returns 'There is no update for this payment'. I have already modified the file: /app/code/core/Mage/Paygate/Model/Authorize.net to have the correct API URL as described in issue #27117 ( http://www.magentocommerce.com/bug-tracking/issue?issue=12991 - must be logged in to view ). This resolved the button not working for all other orders; however this does not fix the issue I am describing. Is anyone familiar with Authorize.net's AIM API so that we can update these orders in Magento to something that makes sense (canceled, etc.) without having to delete the order? I am thinking it should be a case of adding a new order status to Magento, checking the update for an 'Expired' status, and setting the order to the newly created order status. -- edit -- I just ran a diff for the file mentioned above and noticed that Magento 1.7.0.2 includes the _isTransactionExpired() method which seems like it would be the fix. Can it be as simple as updating this model with the newer version?

  Read the article

• Specifying a no-indent for a list, with LaTeX

  - by Andreas Grech

  I have the following: This is just normal text... \begin{enumerate} \item First Item ?\\\\ This is the text of the first item \item Second Item ?\\\\ This is the text of the second item \end{enumerate} Which renders the following: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item I want to specify that the text of the items has no indentation. Basically, I want it to be rendered like such: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item How can I specify this form of no indentation?

  Read the article

• DDD: Persisting aggregates

  - by Mosh

  Hello, Let's consider the typical Order and OrderItem example. Assuming that OrderItem is part of the Order Aggregate, it an only be added via Order. So, to add a new OrderItem to an Order, we have to load the entire Aggregate via Repository, add a new item to the Order object and persist the entire Aggregate again. This seems to have a lot of overhead. What if our Order has 10 OrderItems? This way, just to add a new OrderItem, not only do we have to read 10 OrderItems, but we should also re-insert all these 10 OrderItems again. (This is the approach that Jimmy Nillson has taken in his DDD book. Everytime he wants to persists an Aggregate, he clears all the child objects, and then re-inserts them again. This can cause other issues as the ID of the children are changed everytime because of the IDENTITY column in database.) I know some people may suggest to apply Unit of Work pattern at the Aggregate Root so it keeps track of what has been changed and only commit those changes. But this violates Persistence Ignorance (PI) principle because persistence logic is leaking into the Domain Model. Has anyone thought about this before? Mosh

  Read the article

• Is it possible to have anonymous purchases with ubercart without the creation of a new user account?

  - by DKinzer

  I would like to be able to have anonymous users purchase a product but not have a new account created when they purchase it. Unfortunately the creation of a new user seems to be very tightly integrated into ubercart's ordering system. And, because the order module is part of the ubercart core, it's behavior cannot be overridden easily. One possibility for overriding is the creation of a new user account by supplying ubercart with an bogus anonymous account: hook into hook_form_alter at $form_id == 'uc_cart_checkout_review_form' because this is where ubercart first associates the $order to an uid. Add our submit function to the queue: //Find out if the user is anonymous: global $user; if ($user->uid == 0 ) { //Load a previously created anonymous user account $anonymous_user = mymodule_get_anonymous_user(); //create the order and assign our anonymous_user_id to it $order = uc_order_load($_SESSION['cart_order']); $order->uid = $anonymous_user->uid; uc_order_save($order); //Assign the global user our anonymous user uid $user->uid = $anonymous_user->uid; } But what I really need is to be able to have an anonymous purchase without being forced to create a new account, this solution does not work for me. Apart from which, using this technique will automatically login the anonymous_user into our bogus_anonymous_user account. Which is definitely something I don't want. Is there a better non-duct-tape way around the creation of a new user account for anonymous purchases in ubercart?. AND FYI - at this point I'm kind of stuck with ubercart so I cannot use something else. Thanks! D

  Read the article

• Django internationalization for admin pages - translate model name and attributes

  - by geekQ

  Django's internationalization is very nice (gettext based, LocaleMiddleware), but what is the proper way to translate the model name and the attributes for admin pages? I did not find anything about this in the documentation: http://docs.djangoproject.com/en/dev/topics/i18n/internationalization/ http://www.djangobook.com/en/2.0/chapter19/ I would like to have "???????? ????? ??? ?????????" instead of "???????? order ??? ?????????". Note, the 'order' is not translated. First, I defined a model, activated USE_I18N = True in settings.py, run django-admin makemessages -l ru. No entries are created by default for model names and attributes. Grepping in the Django source code I found: $ ack "Select %s to change" contrib/admin/views/main.py 70: self.title = (self.is_popup and ugettext('Select %s') % force_unicode(self.opts.verbose_name) or ugettext('Select %s to change') % force_unicode(self.opts.verbose_name)) So the verbose_name meta property seems to play some role here. Tried to use it: class Order(models.Model): subject = models.CharField(max_length=150) description = models.TextField() class Meta: verbose_name = _('order') Now the updated po file contains msgid 'order' that can be translated. So I put the translation in. Unfortunately running the admin pages show the same mix of "???????? order ??? ?????????". I'm currently using Django 1.1.1. Could somebody point me to the relevant documentation? Because google can not. ;-) In the mean time I'll dig deeper into the django source code...

  Read the article

• PL/SQL - How to pull data from 3 tables based on latest created date

  - by Nancy

  Hello, I'm hoping someone can help me as I've been stuck on this problem for a few days now. Basically I'm trying to pull data from 3 tables in Oracle: 1) Orders Table 2) Vendor Table and 3) Master Data Table. Here's what the 3 tables look like: Table 1: BIZ_DOC2 (Orders table) OBJECTID (Unique key) UNIQUE_DOC_NAME (Document Name i.e. ORD-005) CREATED_AT (Date the order was created) Table 2: UDEF_VENDOR (Vendors Table): PARENT_OBJECT_ID (This matches up to the ObjectId in the Orders table) VENDOR_OBJECT_NAME (This is the name of the vendor i.e. Acme) Table 3: BIZ_UNIT (Master Data table) PARENT_OBJECT_ID (This matches up to the ObjectID in the Orders table) BIZ_UNIT_OBJECT_NAME (This is the name of the business unit i.e. widget A, widget B) Note: The Vendors Table and Master Data do not have a link between them except through the Orders table. I can join all of the data from the tables and it looks something like this: Before selecting latest order date: ORD-005 | Widget A | Acme | 3/14/10 ORD-005 | Widget B | Acme | 3/14/10 ORD-004 | Widget C | Acme | 3/10/10 Ideally I'd like to return the latest order for each vendor. However, each order may contain multiple business units (e.g. types of widgets) so if a Vendor's latest record is ORD-005 and the order contains 2 business units, here's what the result set should look like by the following columns: UNIQUE_DOC_NAME, BIZ_UNIT_OBJECT_NAME, VENDOR_OBJECT_NAME, CREATED_AT After selecting by latest order date: ORD-005 | Widget A | Acme | 3/14/10 ORD-005 | Widget B | Acme | 3/14/10 I tried using Select Max and several variations of sub-queries but I just can't seem to get it working. Any help would be hugely appreciated!

  Read the article

• How to represent and insert into an ordered list in SQL?

  - by Travis

  I want to represent the list "hi", "hello", "goodbye", "good day", "howdy" (with that order), in a SQL table: pk | i | val ------------ 1 | 0 | hi 0 | 2 | hello 2 | 3 | goodbye 3 | 4 | good day 5 | 6 | howdy 'pk' is the primary key column. Disregard its values. 'i' is the "index" that defines that order of the values in the 'val' column. It is only used to establish the order and the values are otherwise unimportant. The problem I'm having is with inserting values into the list while maintaining the order. For example, if I want to insert "hey" and I want it to appear between "hello" and "goodbye", then I have to shift the 'i' values of "goodbye" and "good day" (but preferably not "howdy") to make room for the new entry. So, is there a standard SQL pattern to do the shift operation, but only shift the elements that are necessary? (Note that a simple "UPDATE table SET i=i+1 WHERE i=3" doesn't work, because it violates the uniqueness constraint on 'i', and also it updates the "howdy" row unnecessarily.) Or, is there a better way to represent the ordered list? I suppose you could make 'i' a floating point value and choose values between, but then you have to have a separate rebalancing operation when no such value exists. Or, is there some standard algorithm for generating string values between arbitrary other strings, if I were to make 'i' a varchar? Or should I just represent it as a linked list? I was avoiding that because I'd like to also be able to do a SELECT .. ORDER BY to get all the elements in order.

  Read the article

• nhibernate fluent repository pattern insert problem

  - by voam

  I am trying to use Fluent NHibernate and the repository pattern. I would like my business layer to not be knowledgeable of the data persistence layer. Ideally I would pass in an initialized domain object to the insert method of the repository and all would be well. Where I run into problems is if the object being passed in has a child object. For example say I want to insert an a new order for a customer, and the customer is a property of the order object. I would like to do something like this: Customer c = new Customer; c.CustomerId = 1; Order o = new Order; o.Customer = c; repository.InsertOrder(o); The problem is that using NHiberate the CustomerId field is only privately settable so I can not set it directly like this. so what I have ended up doing is have my repository have an interface of Order InsertOrder(int customerId) where all the foreign keys get passed in as parameters. Somehow this just doesn't seem right. The other approach was to use the NHibernate session variable to load a customer object in my business model and then have the order passed in to the repository but this defeats my persistence ignorance ideal. Should I throw this persistence ignorance out the window or am I missing something here? Thanks

  Read the article

• php compare array keys, not values

  - by user271619

  I am successfully using the array_key_exists(), as described by php.net Example: <?php $search_array = array('first' => 1, 'second' => 4); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> But, take out the values, and it doesn't work. <?php $search_array = array('first', 'second'); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> Not sure how to only compare 2 arrays by their keys only.

  Read the article

• How to access a variable in other class?

  - by Christine

  Hi! I've problem regarding GUI with one Menu and one Order Class. I've created a variable to store how many items have been selected in the Menu Class. private int totalSelected; The var totalSelected is live updated. It can be changed anytime depending on actionPerformed() function.(Exp: totalSelected will add up all the selected items) In the Order Class, how can I access to the live update variable totalSelected in order to retrieve the live update value? When I invoke getTotalSelected() function inside the Menu Class, I will only obtain a 0 value. Thanks for your help ^^! Please allow me to specify my question clearer. public class MenuTab extends JPanel { private JLabel display; private int totalSelected; public MenuTab() { .... } } public getTotalSelected(){ return totalSelected; } private class SelectedListener implements ActionListener { public void actionPerformed() { ....... //Assume that totalSelected has been updated! display = new JLabel("Total: " + totalSelected); // OK to display totalSelected live value here. } } // A new class is the confirmation of order public class OrderConfirmedTab extends JPanel{ private JLabel displayTotal; private MenuTab order = new MenuTab(); public OrderConfirmedTab() { ...... int totalSelected = order.getTotalSelected(); displayTotal = new JLabel("Total: " + totalSelected); // Problem to display totalSelected live value here. // Will obtain 0; // How can I obtain the live updated value from class MenuTab? Thanks! } }

  Read the article

• Jquery load DIV inside another DIV at same page

  - by Sergio

  HTML: <div class="someclass" rel="first">text 1</div> <div class="someclass" rel="second">text 2</div></div></div> <div class="info_ly">here is some text</div> <div class="first" > the first DIV </div> <div class="second" > the second DIV </div> CSS: .first{ display:none} .second{ display:none} Jquery: $(".someclass").click(function() { $(".info_ly").html($(this).attr('rel')); }); I want to call and load the "rel" DIV inside "info_ly" DIV. With this Jquery code I get only text "first" or "second" inside "info_ly" DIV. How can I load the DIV with the class "first" or DIV with the class "second" inside "info_ly" DIV?

  Read the article

• Browser back button broken between hidden div's

  - by Linda

  First of all, these pages will never be on the web but will be in internal memory. They are a group of linked documents---an ebook. http://www.anmldr.com/testdivs When I click on the link in the first div, the second div becomes visible and the first div is hidden. The problem is with the browser's back button. If you then click on the back button, the URL updates but the first div does not show again. How can I correct the back button so that the first div shows? The link from the second div to the first div works fine but it is the browser back button that I do not know how to work with. Thanks, Linda P.S. These are using CSS3 so it is better to use a WebKit based browser.

  Read the article

• How can I improve the performance of LinqToSql queries that use EntitySet properties?

  - by DanM

  I'm using LinqToSql to query a small, simple SQL Server CE database. I've noticed that any operations involving sub-properties are disappointingly slow. For example, if I have a Customer table that is referenced by an Order table, LinqToSql will automatically create an EntitySet<Order> property. This is a nice convenience, allowing me to do things like Customer.Order.Where(o => o.ProductName = "Stopwatch"), but for some reason, SQL Server CE hangs up pretty bad when I try to do stuff like this. One of my queries, which isn't really that complicated takes 3-4 seconds to complete. I can get the speed up to acceptable, even fast, if I just grab the two tables individually and convert them to List<Customer> and List<Order>, then join then manually with my own query, but this is throwing out a lot of what makes LinqToSql so appealing. So, I'm wondering if I can somehow get the whole database into RAM and just query that way, then occasionally save it. Is this possible? How? If not, is there anything else I can do to boost the performance besides resorting to doing all the joins manually? Note: My database in its initial state is about 250K and I don't expect it to grow to more than 1-2Mb. So, loading the data into RAM certainly wouldn't be a problem from a memory point of view. Update Here are the table definitions for the example I used in my question: create table Order ( Id int identity(1, 1) primary key, ProductName ntext null ) create table Customer ( Id int identity(1, 1) primary key, OrderId int null references Order (Id) )

  Read the article

• WCF: Exposed Object Model - stuck in a loop

  - by Mark

  Hi I'm working on a pretty big WSSF project. I have a normal object model in the business layer. Eg a customer has an orders collection property, when this is accessed then it loads from the data layer (lazy loading). An order has a productCollection property etc etc.. Now the bit I'm finding tricky is exposing this via WCF. I want to export a collection of orders. The client app will also need information about the customers. Using the WSSF data contract designer I have set it up so that customers have a property called "order collection". This is fine if you have a customer object and would like to look at the orders but if you have an order object there is no customer property so it doesn't work going up the hierarchy. I've tried adding a customer property to the orders object but then the code gets stuck in a loop when it loads the data contracts up. This is because it doesn't load on demand like in the business layer. I need to load all properties up before the objects can be sent out via WCF. It ends up loading an order, then the customer for that order, then the orders for that customer, then the customer for that order etc etc... I'm sure I've got all this wrong. Help!!

  Read the article

• Help with this reg. exp. in PHP

  - by Jonathan

  Hi, i don't know about regular expressions, I asked here for one that: gets either anything up to the first parenthesis/colon or the first word inside the first parenthesis. This was the answer: preg_match('/(?:^[^(:]+|(?<=^\\()[^\\s)]+)/', $var, $match); I need an improvement, I need to get either anything up to the first parenthesis/colon/quotation marks or the first word inside the first parenthesis. So if I have something like: $var = 'story "The Town in Hell"s Backyard'; // I get this: $match = 'story'; $var = "screenplay (based on)"; // I get this: $match = 'screenplay'; $var = "(play)"; // I get this: $match = 'play'; $var = "original screen"; // I get this: $match = 'original screen'; Thanks!

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Why has my computer started to make noises when I turn it on after I put it into sleep mode for the first time a week ago?

  - by Acid2

  I would usually have my pc on all day and fully shut it down at night time before I went to bed. I decided to put it into sleep mode instead the other day and everything was fine but when I woke it from sleep, I was presented with the blue screen of death and it started with some weird noise that sounded like some spinning part was off balance or possibly hitting something periodically. Sounds like it could be a fan or maybe the HDD. I'm not sure why sleep mode would mess up the hardware. Anyway, now sometimes, randomly, when I turn my computer on from a previous shut down, I still get to hear the noise but the start-up is normal. Sometimes I don't hear anything for the entire duration while I have it on and sometimes it goes away after a few minutes and sometimes it doesn't and I have to restart, like it isn't going away right now. I can hear the noise as I type this. Anyone got possible solutions? I don't want to open the system and mess up other stuff. I'm also not sure if I should take it somewhere to have it fixed - it might not make the noise then and work like normal and nothing would seem like needing to be fixed. Add: I'm running Windows 7, if that's of any relevance.

  Read the article

• DOM class injection in PHP

  - by Adam Kiss

  idea Via jQuery, I was able to mark all :first-child and :last-child elements in document (well, almost all :)) with class first which could I later style (i.e. first li in ul#navigation would be easily adressable as ul#navigation .first). I used following code: var $f = $('*:first-child') $f.addClass('first'); var $l = $('body *:last-child') $l.addClass('last'); question Now, my question is if it's possible to do the same via php, so non-JS users/gadgets could have the same effects and additional styling and also it would be less overkill on browser. So, is it possible to capture output, parse it as html and inject this class easily in php?

  Read the article

• PHP: Is there an elegant way to foreach through multiple items (groups) at a time?

  - by acheong87

  Given an array of N items: $arr = array('a', 'b', 'c', 'd', 'e', 'f'); What's the most elegant way to loop through in groups of M items (assuming N is divisible by M)? I tried foreach (array_chunk($arr, 2) as list($first, $second)) { // do stuff with $first and $second } but this resulted in a syntax error. In other words, I want to emulate what in Tcl would look like this: set arr [a b c d e f] foreach {first second} $arr { // do stuff with $first and $second } For now I've resorted to the obvious measure: foreach (array_chunk($arr, 2) as $group) { $first = $group[0]; $second = $group[1]; // do stuff with $first and $second } But I'm hoping someone has a more elegant method...

  Read the article

• Excel file reading with 2007 office connection string.

  - by p-vasuu

  Actually in my system having 2007 office then i am reading the 2003 .xls file with using the 2007 connection string string ConnectionString = "Provider=Microsoft.ACE.OLEDB.12.0;Data Source=" + Filename + ";Extended Properties=\"Excel 8.0;HDR=YES;\""; data is not reading. But if the first row first column data length is lessthen 255 then the following first columns data is cutting up to 255 character. If the First row first column is morethan the 255 character then the following first columns data is reading fine. Is there any back word computability is there?

  Read the article

< Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >