Search Results

Search found 5261 results on 211 pages for 'includes'.

Page 184/211 | < Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >

  • Hide public method used to help test a .NET assembly

    - by ChrisW
    I have a .NET assembly, to be released. Its release build includes: A public, documented API of methods which people are supposed to use A public but undocumented API of other methods, which exist only in order to help test the assembly, and which people are not supposed to use The assembly to be released is a custom control, not an application. To regression-test it, I run it in a testing framework/application, which uses (in addition to the public/documented API) some advanced/undocumented methods which are exported from the control. For the public methods which I don't want people to use, I excluded them from the documentation using the <exclude> tag (supported by the Sandcastle Help File Builder), and the [EditorBrowsable] attribute, for example like this: /// <summary> /// Gets a <see cref="IEditorTransaction"/> instance, which helps /// to combine several DOM edits into a single transaction, which /// can be undone and redone as if they were a single, atomic operation. /// </summary> /// <returns>A <see cref="IEditorTransaction"/> instance.</returns> IEditorTransaction createEditorTransaction(); /// <exclude/> [EditorBrowsable(EditorBrowsableState.Never)] void debugDumpBlocks(TextWriter output); This successfully removes the method from the API documentation, and from Intellisense. However, if in a sample application program I right-click on an instance of the interface to see its definition in the metadata, I can still see the method, and the [EditorBrowsable] attribute as well, for example: // Summary: // Gets a ModelText.ModelDom.Nodes.IEditorTransaction instance, which helps // to combine several DOM edits into a single transaction, which can be undone // and redone as if they were a single, atomic operation. // // Returns: // A ModelText.ModelDom.Nodes.IEditorTransaction instance. IEditorTransaction createEditorTransaction(); // [EditorBrowsable(EditorBrowsableState.Never)] void debugDumpBlocks(TextWriter output); Questions: Is there a way to hide a public method, even from the meta data? If not then instead, for this scenario, would you recommend making the methods internal and using the InternalsVisibleTo attribute? Or would you recommend some other way, and if so what and why? Thank you.

    Read the article

  • Can this way of storing typed objects be improved?

    - by Pindatjuh
    This is an "can it be improved"-question. Topic: Storing typed objects in memory. Background information: I'm building a compiler for the x86-32 Windows platform for my language. My goal includes typed objects. Idea: Every primitive is a semi-class (it can be used as if it was a normal class, but it's stored more compact). Every class is represented by primitives and some meta-data (containing class-properties, inheritance stuff, etc.). The meta-data is complex: it doesn't use fields but instead context-switches. For primitives, the meta-data is very small, compared to a "real" class, which is alot bigger. This enables another idea that "primitives are objects", in my language, which I found nessecairy. Example: If I have an array of 32 booleans, then the pure content of this array is exactly 4 byte (32 bits of booleans). The meta-data will contain flags that the type is an array of booleans, which contains 32 entries. The meta-data is very compacted, on bit-level: using a sort of "packing" mechanism, which is read by a FSM at runtime, when doing inspection of the type (like when passing the object to methods for checking, etc.) For instance (read from left to right, top to bottom, remember vertical position when going to the right, and check nearest column header for meaning of switch): Primitive? Array? Type-Meta 1 Byte? || Size (1 byte) 1 1 [...] 1 [...] done 0 2 Bytes? || Size (2 bytes) 1 [...] done || Size (4 bytes) 0 [...] done Integer? 1 Byte? 2 Bytes? 0 1 0 1 done 1 done 0 done Boolean? Byte? 0 1 0 done 1 done More-Primitives 0 .... Class-Stuff (Huge) 0 ... (After reaching done the data is inserted. || = byte alignment. [...] is variable sized. ... is not described here, for simplicity. And let's call them cost-based-data-structures.) For an array of 32 booleans containing all true values, the memory for this type would be (read top-down): 1 Primitive 1 Array 1 ArrayType: Primitive 0 Not-Array 0 Not-Integer 1 Boolean 0 Not-Byte (thus bit) 1 Integer Size: 1 Byte 00100000 Array size 01010101 01010101 01010101 01010101 Data (user defined) Thus, 8 bytes represent 32 booleans in an array: 11100101 00100000 01010101 01010101 01010101 01010101 How can I improve this? (Both performance- and memory-consumption wise)

    Read the article

  • java multipart POST library

    - by tom
    Is there a multipart POST library out there that achieve the same effect of doing a POST from a html form? for example - upload a file programmingly in Java versus upload the file using a html form. And on the server side, it just blindly expect the request from client side to be a multipart POST request and parse out the data as appropriate. Has anyone tried this? specifically, I am trying to see if I can simulate the following with Java The user creates a blob by submitting an HTML form that includes one or more file input fields. Your app sets blobstoreService.createUploadUrl() as the destination (action) of this form, passing the function a URL path of a handler in your app. When the user submits the form, the user's browser uploads the specified files directly to the Blobstore. The Blobstore rewrites the user's request and stores the uploaded file data, replacing the uploaded file data with one or more corresponding blob keys, then passes the rewritten request to the handler at the URL path you provided to blobstoreService.createUploadUrl(). This handler can do additional processing based on the blob key. Finally, the handler must return a headers-only, redirect response (301, 302, or 303), typically a browser redirect to another page indicating the status of the blob upload. Set blobstoreService.createUploadUrl as the form action, passing the application path to load when the POST of the form is completed. <body> <form action="<%= blobstoreService.createUploadUrl("/upload") %>" method="post" enctype="multipart/form-data"> <input type="file" name="myFile"> <input type="submit" value="Submit"> </form> </body> Note that this is how the upload form would look if it were created as a JSP. The form must include a file upload field, and the form's enctype must be set to multipart/form-data. When the user submits the form, the POST is handled by the Blobstore API, which creates the blob. The API also creates an info record for the blob and stores the record in the datastore, and passes the rewritten request to your app on the given path as a blob key.

    Read the article

  • PHP Regex: How to match anything except a pattern between two tags

    - by Ryan
    Hello, I am attempting to match a string which is composed of HTML. Basically it is an image gallery so there is a lot of similarity in the string. There are a lot of <dl> tags in the string, but I am looking to match the last <dl>(.?)+</dl> combo that comes before a </div>. The way I've devised to do this is to make sure that there aren't any <dl's inside the <dl></dl> combo I'm matching. I don't care what else is there, including other tags and line breaks. I decided I had to do it with regular expressions because I can't predict how long this substring will be or anything that's inside it. Here is my current regex that only returns me an array with two NULL indicies: preg_match_all('/<dl((?!<dl).)+<\/dl>(?=<\/div>)/', $foo, $bar) As you can see I use negative lookahead to try and see if there is another <dl> within this one. I've also tried negative lookbehind here with the same results. I've also tried using +? instead of just + to no avail. Keep in mind that there's no pattern <dl><dl></dl> or anything, but that my regex is either matching the first <dl> and the last </dl> or nothing at all. Now I realize . won't match line breaks but I've tried anything I could imagine there and it still either provides me with the NULL indicies or nearly the whole string (from the very first occurance of <dl to </dl></div>, which includes several other occurances of <dl>, exactly what I didn't want). I honestly don't know what I'm doing incorrectly. Thanks for your help! I've spent over an hour just trying to straighten out this one problem and it's about driven me to pulling my hair out.

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • Change the Session Variable Output

    - by user567230
    Hello I am using Dreamweaver CS5 with Coldfusion 9 to build a dynamic website. I have a MS Access Database that stores login information which includes ID, FullName, FirstName, LastName, Username, Pawword, AcessLevels. My question is this: I currently have session variable to track the Username when it is entered into the login page. However I would like to use that Username to pull the User's FullName to display throughout the web pages and use for querying data. How do I change the session variable to read that when they are not entering their FullName on the login page but only Username and password. I have listed my login information code below if there is any additional information needed please let me know. This is the path for which the FullName values reside DataSource "Access" Table "Logininfo" Field "FullName" I want the FullName to be unique based on the Username submitted from the Login page. I apologize in advance for any rookie mistake I may have made I am new to this but learning fast! Ha. <cfif IsDefined("FORM.username")> <cfset MM_redirectLoginSuccess="members_page.cfm"> <cfset MM_redirectLoginFailed="sorry.cfm"> <cfquery name="MM_rsUser" datasource="Access"> SELECT FullName, Username,Password,AccessLevels FROM Logininfo WHERE Username=<cfqueryparam value="#FORM.username#" cfsqltype="cf_sql_clob" maxlength="50"> AND Password=<cfqueryparam value="#FORM.password#" cfsqltype="cf_sql_clob" maxlength="50"> </cfquery> <cfif MM_rsUser.RecordCount NEQ 0> <cftry> <cflock scope="Session" timeout="30" type="Exclusive"> <cfset Session.MM_Username=FORM.username> <cfset Session.MM_UserAuthorization=MM_rsUser.AccessLevels[1]> </cflock> <cfif IsDefined("URL.accessdenied") AND false> <cfset MM_redirectLoginSuccess=URL.accessdenied> </cfif> <cflocation url="#MM_redirectLoginSuccess#" addtoken="no"> <cfcatch type="Lock"> <!--- code for handling timeout of cflock ---> </cfcatch> </cftry> </cfif> <cflocation url="#MM_redirectLoginFailed#" addtoken="no"> <cfelse> <cfset MM_LoginAction=CGI.SCRIPT_NAME> <cfif CGI.QUERY_STRING NEQ ""> <cfset MM_LoginAction=MM_LoginAction & "?" & XMLFormat(CGI.QUERY_STRING)> </cfif> </cfif>

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • remove data layer and put into it's own domain

    - by user334768
    I have a SL4 application that uses EF4 & RIA Services. DB is SQL 2008. All is working well. Now I want to put the Database and web services on one domain (A.com) with the web service exposing the same methods available in my working project. (one listed at top of message) Then put a Silverlight application (same one as above) on domain(B.com) and call the web services on A.com. I thought I had a fair understanding of RIA Services. Enough to get the above application working. Now when I say "working" I do mean on my local dev machine. I have yet to deployed as SL4 & .NET 4 application to my hosting site. But I don't think I understand it well enough. I normally create a new business app, add EF then create the RIA DomainService. Add any [Includes] I need, modify my linq queries and run application. And it works. Now I need to break off my data layer and put it on another hosting site (A.com) And put my UI and business logic on another hosting site (B.com) I think I need to do the following : On the Database & web service site: domain(A.com) create application, create EF4, create RIA Services and deploy. At this time, are the methods exposed available as a "WEB SERVICE" to other applications calling by http:// a.com/serviceName.svc address? I think I need to do the following : On the application site : domain(B.com) create a business application (later will need authentication and navigation). How can I create an EF when I don't have access to the database? (I know I do have access but I want know what happens here when I do not have access to the database, but only data provided by a web service) If I can not create an EF how do I create my RIA Service? I hope any one who takes time to help me understands what I'm asking. Sorry so long.

    Read the article

  • Unable to get index from jQuery UI slider range

    - by Phil.Wheeler
    I'm having a hell of a time trying to get (what I thought was) a simple index from a collection of multiple sliders. The HTML is as follows: <div id="left-values" class="line"> <span id="l1" style="padding: 0 1.8em;">0</span> <span id="l2" style="padding: 0 1.8em;">0</span> <span id="l3" style="padding: 0 1.8em;">0</span> <span id="l4" style="padding: 0 1.8em;">0</span> <span id="l5" style="padding: 0 1.8em;">0</span> <span id="l6" style="padding: 0 1.8em;">0</span> <span id="l7" style="padding: 0 1.8em;">0</span> <span id="l8" style="padding: 0 1.8em;">0</span> </div> And the jQuery code is: // setup audiometry sliders $("#eq > span").each(function (e) { // read initial values from markup and remove that var value = parseInt($(this).text()); // var index = $(this).index; <- this didn't work. $(this).empty(); $(this).slider({ value: value, slide: function (event, ui) { //console.log($(this).attr('id')); <- neither did this. //console.log(index); $('#left-values span:first').text(ui.value); } }) }); The problem is that jQuery UI - when creating a slider - replaces the existing HTML with its own markup. This includes any ID values and, for whatever reason, I can't get the index for a given slider to surface either. So I'm running out of ideas.

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • php pdo connection scope

    - by Scarface
    Hey guys I have a connection class I found for pdo. I am calling the connection method on the page that the file is included on. The problem is that within functions the $conn variable is not defined even though I stated the method was public (bare with me I am very new to OOP), and I was wondering if anyone had an elegant solution other then using global in every function. Any suggestions are greatly appreciated. CONNECTION class PDOConnectionFactory{ // receives the connection public $con = null; // swich database? public $dbType = "mysql"; // connection parameters // when it will not be necessary leaves blank only with the double quotations marks "" public $host = "localhost"; public $user = "user"; public $senha = "password"; public $db = "database"; // arrow the persistence of the connection public $persistent = false; // new PDOConnectionFactory( true ) <--- persistent connection // new PDOConnectionFactory() <--- no persistent connection public function PDOConnectionFactory( $persistent=false ){ // it verifies the persistence of the connection if( $persistent != false){ $this->persistent = true; } } public function getConnection(){ try{ // it carries through the connection $this->con = new PDO($this->dbType.":host=".$this->host.";dbname=".$this->db, $this->user, $this->senha, array( PDO::ATTR_PERSISTENT => $this->persistent ) ); // carried through successfully, it returns connected return $this->con; // in case that an error occurs, it returns the error; }catch ( PDOException $ex ){ echo "We are currently experiencing technical difficulties. We have a bunch of monkies working really hard to fix the problem. Check back soon: ".$ex->getMessage(); } } // close connection public function Close(){ if( $this->con != null ) $this->con = null; } } PAGE USED ON include("includes/connection.php"); $db = new PDOConnectionFactory(); $conn = $db->getConnection(); function test(){ try{ $sql = 'SELECT * FROM topic'; $stmt = $conn->prepare($sql); $result=$stmt->execute(); } catch(PDOException $e){ echo $e->getMessage(); } } test();

    Read the article

  • Having trouble doing an Update with a Linq to Sql object

    - by Pure.Krome
    Hi folks, i've got a simple linq to sql object. I grab it from the database and change a field then save. No rows have been updated. :( When I check the full Sql code that is sent over the wire, I notice that it does an update to the row, not via the primary key but on all the fields via the where clause. Is this normal? I would have thought that it would be easy to update the field(s) with the where clause linking on the Primary Key, instead of where'ing (is that a word :P) on each field. here's the code... using (MyDatabase db = new MyDatabase()) { var boardPost = (from bp in db.BoardPosts where bp.BoardPostId == boardPostId select bp).SingleOrDefault(); if (boardPost != null && boardPost.BoardPostId > 0) { boardPost.ListId = listId; // This changes the value from 0 to 'x' db.SubmitChanges(); } } and here's some sample sql.. exec sp_executesql N'UPDATE [dbo].[BoardPost] SET [ListId] = @p6 WHERE ([BoardPostId] = @p0) AND .... <snip the other fields>',N'@p0 int,@p1 int,@p2 nvarchar(9),@p3 nvarchar(10),@p4 int,@p5 datetime,@p6 int',@p0=1276,@p1=212787,@p2=N'ttreterte',@p3=N'ttreterte3',@p4=1,@p5='2009-09-25 12:32:12.7200000',@p6=72 Now, i know there's a datetime field in this update .. and when i checked the DB it's value was/is '2009-09-25 12:32:12.720' (less zero's, than above) .. so i'm not sure if that is messing up the where clause condition... but still! should it do a where clause on the PK's .. if anything .. for speed! Yes / no ? UPDATE After reading nitzmahone's reply, I then tried playing around with the optimistic concurrency on some values, and it still didn't work :( So then I started some new stuff ... with the optimistic concurrency happening, it includes a where clause on the field it's trying to update. When that happens, it doesn't work. so.. in the above sql, the where clause looks like this ... WHERE ([BoardPostId] = @p0) AND ([ListId] IS NULL) AND ... <rest snipped>) This doesn't sound right! the value in the DB is null, before i do the update. but when i add the ListId value to the where clause (or more to the point, when L2S add's it because of the optomistic concurrecy), it fails to find/match the row. wtf?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • General workflow to allow multiple OpenIDs to be associated with one app account

    - by BobTodd
    I have a (typical?) scenario: that my app's users can use multiple openids mapped to one app account (like stackoverflow). For me the unique thing on the account is the email address, so this binds openids to the profile. Question is, how to allow a user to start using a second openid once one is setup. I am asking as I have read that it is a security hole to allow automatic account openid syncing simply based on the provider-supplied email address as someone could easily spoof someone's email address to create a spoof openid and falsely access the account (how I am not sure) - although this seems to be exactly how stack operates. See options a. and b. below. Problem for me with a. is what happens if the original openid no longer works for whatever reason - how would you set-up a new openid? Would b. be more acceptable if we used email verification? Does anyone have an article detailing a "standard" way (set of user stories) for this - it seems to be an increasingly popular way to authenticate. I have tried to detail this in a rough decision tree... 1. My Site > authentication landing page - user chooses an openid (facebook, google, myopenid etc), redirection > 2. Provider site returns with token (includes user registering a new openid, logging in or is already logged in to Provider site) 3. My Site > use token id to lookup user 3.1 Profile exists? Yes > authenticate. ends. No > 3.1.1 was email address supplied by provider? Yes > lookup user by email address 3.1.1.1 Profile exists? Yes > a. error message - please login with existing openid and associate this openid (from special page) Yes > b. or associate this openid with existing profile automatically. authenticate. ends. No > Register profile. With registration email address follow 3.1.1, except this time where email is unique, we will associate openid. ends

    Read the article

  • Can highlight the current menu item, but can't add the class= to style unhighleted menu items

    - by bradpotts
    <?php $activesidebar[$currentsidebar]="id=isactive";?> <div class="span3"> <div class="well sidebar-nav hidden-phone"> <ul class="nav nav-list"> <li class="nav-header" <?php echo $activesidebar[1] ?>>Marketing Services</li> <li><a href="#">Marketing Technology</a></li> <li><a href="#">Generate More Sales</a></li> <li><a href="#">Direct Email Marketing</a></li> <li class="nav-header" <?php echo $activesidebar[2] ?>>Advertising Services</li> <li><a href="../services-advertising-mass-media-network.php">Traditional Medias</a></li> <li><a href="#">Online & Social Medias</a></li> <li><a href="#">Media Planing & Purchasing</a></li> <li class="nav-header" <?php echo $activesidebar[3] ?>>Technology Services</li> <li><a href="#">Managed Websites</a></li> <li><a href="#">Managed Web Servers</a></li> <li><a href="#">Managed Databases</a></li> <li class="nav-header" <?php echo $activesidebar[4] ?>>About Us</li> <li><a href="../aboutus-contactus.php">Contact Us</a></li> </ul> </div> This is added to the current page I want to add this on. <?php $currentsidebar =2; include('module-sidebar-navigation.php');?> I had programmed this menu individually on each page, but to make my website dynamic I used one file and use php includes to load the file. I can get the menu to highlight on the current page assigning an id="isactive", how can I assign id="notactive" to the other 3 menu items that are not active on that page. Is there an else or elseif I have to include?

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

  • ZF Autoloader to load ancestor and requested class

    - by Pekka
    I am integrating Zend Framework into an existing application. I want to switch the application over to Zend's autoloading mechanism to replace dozens of include() statements. I have a specific requirement for the autoloading mechanism, though. Allow me to elaborate. The existing application uses a core library (independent from ZF), for example: /Core/Library/authentication.php /Core/Library/translation.php /Core/Library/messages.php this core library is to remain untouched at all times and serves a number of applications. The library contains classes like class ancestor_authentication { ... } class ancestor_translation { ... } class ancestor_messages { ... } in the application, there is also a Library directory: /App/Library/authentication.php /App/Library/translation.php /App/Library/messages.php these includes extend the ancestor classes and are the ones that actually get instantiated in the application. class authentication extends ancestor_authentication { } class translation extends ancestor_translation { } class messages extends ancestor_messages { } usually, these class definitions are empty. They simply extend their ancestors and provide the class name to instantiate. $authentication = new authentication(); The purpose of this solution is to be able to easily customize aspects of the application without having to patch the core libraries. Now, the autoloader I need would have to be aware of this structure. When an object of the class authentication is requested, the autoloader would have to: 1. load /Core/Library/authentication.php 2. load /App/Library/authentication.php My current approach would be creating a custom function, and binding that to Zend_Loader_Autoloader for a specific namespace prefix. Is there already a way to do this in Zend that I am overlooking? The accepted answer in this question kind of implies there is, but that may be just a bad choice of wording. Are there extensions to the Zend Autoloader that do this? Can you - I am new to ZF - think of an elegant way, conforming with the spirit of the framework, of extending the Autoloader with this functionality? I'm not necessary looking for a ready-made implementation, some pointers (This should be an extension to the xyz method that you would call like this...) would already be enough.

    Read the article

  • ASP.Net / MySQL : Translating content into several languages

    - by philwilks
    I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

    Read the article

  • How can I fix this touch event / draw loop "deadlock"?

    - by Josh
    Just want to start out by saying this seems like a great site, hope you guys can help! I'm trying to use the structure laid out in LunarLander to create a simple game in which the user can drag some bitmaps around on the screen (the actual game is more complex, but that's not important). I ripped out the irrelevant parts of LanderLander, and set up my own bitmap drawing, something like BoardThread (an inner class of BoardView): run() { while(mRun) { canvas = lockSurfaceHolder... syncronized(mSurfaceHolder) { /* drawStuff using member position fields in BoardView */ } unlockSurfaceHolder } } My drawStuff simply walks through some arrays and throws bitmaps onto the canvas. All that works fine. Then I wanted to start handling touch events so that when the user presses a bitmap, it is selected, when the user unpresses a bitmap, it is deselected, and if a bitmap is selected during a touch move event, the bitmap is dragged. I did this stuff by listening for touch events in the BoardView's parent, BoardActivity, and passing them down into the BoardView. Something like In BoardView handleTouchEvent(MotionEvent e) { synchronized(mSurfaceHolder) { /* Modify shared member fields in BoardView so BoardThread can render the bitmaps */ } } This ALSO works fine. I can drag my tiles around the screen no problem. However, every once in a while, when the app first starts up and I trigger my first touch event, the handleTouchEvent stops executing at the synchronized line (as viewed in DDMS). The drawing loop is active during this time (I can tell because a timer changes onscreen), and it usually takes several seconds or more before a bunch of touch events come through the pipeline and everything is fine again. This doesn't seem like deadlock to me, since the draw loop is constantly going in and out of its syncronized block. Shouldn't this allow the event handling thread to grab a lock on mSurfaceHolder? What's going on here? Anyone have suggestions for improving how I've structured this? Some other info. This "hang" only ever occurs on first touch event after activity start. This includes on orientation change after restoreState has been called. Also, I can remove EVERYTHING within the syncronized block in the event handler, and it will still get hung up at the syncronized call. Thanks!

    Read the article

  • Hacking "Contact Form 7" code to Add A "Referred By" field

    - by Scott B
    I've got about 6 subdomains that have a "contact us" link and I'm sending all these links to a single form that uses "Contact Form 7". I add ?from=site-name to each of the links so that I can set a $referredFrom variable in the contact form. The only two things I'm missing are (1) the ability to insert this referredFrom variable into the email that I get whenever someone submits the form and (2) The ability to redirect the user back to the site they came from (stored in $referredFrom) Any ideas? Here's a bit of code from includes/classes.php that I thought might be part of the email insert but its not doing much... function mail() { global $referrer; $refferedfrom = $referrer; //HERE IS MY CUSTOM CODE $fes = $this->form_scan_shortcode(); foreach ( $fes as $fe ) { $name = $fe['name']; $pipes = $fe['pipes']; if ( empty( $name ) ) continue; $value = $_POST[$name]; if ( WPCF7_USE_PIPE && is_a( $pipes, 'WPCF7_Pipes' ) && ! $pipes->zero() ) { if ( is_array( $value) ) { $new_value = array(); foreach ( $value as $v ) { $new_value[] = $pipes->do_pipe( $v ); } $value = $new_value; } else { $value = $pipes->do_pipe( $value ); } } $this->posted_data[$name] = $value; $this->posted_data[$refferedfrom] = $referrer; //HERE IS MY CUSTOM CODE } I'm also thinking that I could insert the referredFrom code somewhere in this function as well... function compose_and_send_mail( $mail_template ) { $regex = '/\[\s*([a-zA-Z][0-9a-zA-Z:._-]*)\s*\]/'; $callback = array( &$this, 'mail_callback' ); $mail_subject = preg_replace_callback( $regex, $callback, $mail_template['subject'] ); $mail_sender = preg_replace_callback( $regex, $callback, $mail_template['sender'] ); $mail_body = preg_replace_callback( $regex, $callback, $mail_template['body'] ); $mail_recipient = preg_replace_callback( $regex, $callback, $mail_template['recipient'] ); $mail_headers = "From: $mail_sender\n"; if ( $mail_template['use_html'] ) $mail_headers .= "Content-Type: text/html\n"; $mail_additional_headers = preg_replace_callback( $regex, $callback, $mail_template['additional_headers'] ); $mail_headers .= trim( $mail_additional_headers ) . "\n"; if ( $this->uploaded_files ) { $for_this_mail = array(); foreach ( $this->uploaded_files as $name => $path ) { if ( false === strpos( $mail_template['attachments'], "[${name}]" ) ) continue; $for_this_mail[] = $path; } return @wp_mail( $mail_recipient, $mail_subject, $mail_body, $mail_headers, $for_this_mail ); } else { return @wp_mail( $mail_recipient, $mail_subject, $mail_body, $mail_headers ); } }

    Read the article

  • How to add fadeIn and fadeOut to idTabs plugin's JS snippet?

    - by iMagdy
    Hi, I am using the jQuery plugin idTabs [ [www.sunsean.com/idTabs][1] ] and it allows me to line tabs and tabs' content via element#id and element href="#id" Ok, so I use this snippet: <script type="text/javascript"> $(document).ready(function() { $("#requestPool").idTabs(); $(".tabs").idTabs(); $(".miniTabs").idTabs(".active"); $(".switchers").idTabs(".activePanel"); }); </script> To run the plugin on two different areas: div#requestPool this has it's own tabs and it's own tab content, Also the div.tabs which is another place and has it's own tabs and it's own tabs content. The div.miniTabs and div.switchers are the divs that includes the tabs links (tabs headers) and I putted them in the snippet to change the default selected tab class from .selected to .active and .activePanel Now, what I would love to add is a nice fadeIn and fadeOut effects to the content of my tabs while browsing through them. Thanks Here is the HTML code for one of the tabbed areas: <div id="requestPool"> <!-- The tabs heads --> <div class="miniTabs"> <a href="#today" class="active">Today</a> <!-- First active tab --> <a href="#tomorrow">Tomorrow</a> <a href="#friday">Friday</a> <a href="#saturday">Saturday</a> <a href="#sunday">Sunday</a> <a href="#monday">Monday</a> <a href="#tuesday">Tuesday</a> </div> <!-- The tabs contents (the ones that I want them to fade in and out while browsing through them using the tabs above) --> <div id="today"class="miniTab"></div> <div id="tomorrow"class="miniTab"></div> <div id="friday"class="miniTab"></div> <div id="saturday"class="miniTab"></div> <div id="sunday"class="miniTab"></div> ...etc the week days </div> Thanks very much (again the tabs are working very fine, but without the fade effect which I want to have).

    Read the article

  • php functions within functions.

    - by Adamski
    Hi all, ihave created a simple project to help me get to grips with php and mysql, but have run into a minor issue, i have a working solution but would like to understand why i cannot run this code successfully this way, ill explain: i have a function, function fetch_all_movies(){ global $connection; $query = 'select distinct * FROM `'.TABLE_MOVIE.'` ORDER BY movieName ASC'; $stmt = mysqli_prepare($connection,$query); mysqli_execute($stmt); mysqli_stmt_bind_result($stmt,$id,$name,$genre,$date,$year); while(mysqli_stmt_fetch($stmt)){ $editUrl = "index.php?a=editMovie&movieId=".$id.""; $delUrl = "index.php?a=delMovie&movieId=".$id.""; echo "<tr><td>".$id."</td><td>".$name."</td><td>".$date."</td><td>".get_actors($id)."</td><td><a href=\"".$editUrl."\">Edit</a> | <a href=\"".$delUrl."\">Delete</a></td></tr>"; } } this fetches all the movies in my db, then i wish to get the count of actors for each film, so i pass in the get_actors($id) function which gets the movie id and then gives me the count of how many actors are realted to a film. here is the function for that: function get_actors($movieId){ global $connection; $query = 'SELECT DISTINCT COUNT(*) FROM `'.TABLE_ACTORS.'` WHERE movieId = "'.$movieId.'"'; $result = mysqli_query($connection,$query); $row = mysqli_fetch_array($result); return $row[0]; } the functions both work perfect when called separately, i just would like to understand when i pass the function inside a function i get this warning: Warning: mysqli_fetch_array() expects parameter 1 to be mysqli_result, boolean given in /Applications/MAMP/htdocs/movie_db/includes/functions.inc.php on line 287 could anyone help me understand why? many thanks.

    Read the article

  • Facebook Connect from Localhost, doing some weird stuff

    - by Brett
    So maybe the documentation is out of date, or I am just off here. But I have done a slew of FB iframe apps (connect), but I am starting my first FB Connect site. Running it from localhost, and the Connect URL is http:// my_external_IP_address. When I click on the FB login button on my site, it pops up, says waiting for facebook, and it returns my site in that box, with the URL up top with the http:// mysite/?session={session key, user_id, etc.} The user_id is infact my FB id. And so it thinks I am logged in. If I close the popup, I'm not logged in. I'm not sure why the pop up isn't doing the normal fb connect dialog. I'm following these steps. (I added spaces to the http:// as to not be detected as 'spam') html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://www.facebook.com/2008/fbml" right after <body> <script src="http://static.ak.connect.facebook.com/js/api_lib/v0.4/FeatureLoader.js.php" type="text/javascript"> At the end, before the body close tag: script type="text/javascript"> FB.init("fbkey", "http://127.0.0.1/xd_receiver.htm"); I have tried using xd_receiver.htm, /xd_receiver.htm (and other combos), and that brings up a blank page. using the http://127.0.0.1 at least does something. In my config file, which is called before all of those, it checks for a PHP session key to see if they are logged in, if that doesn't exist it looks for a cookie, and if that doesn't exist it does this: require_once('includes/facebook.php'); $facebook = new Facebook($fbkey, $fbsec); $user_id = $facebook->get_loggedin_user(); if($user_id > 0){ $user = $ac->getUserFromFB($user_id); $_SESSION['user_id'] = $user['user_id']; } The user_id is always empty when I echo it out to the screen to test. The session event never occurs as well. So I don't know what it is doing in the popup, but I think Facebook thinks it is logging me in. Not sure. Pretty stumped on this one. Any help would be appreciated. Thanks!

    Read the article

  • jQuery question from a person who can't javascript

    - by Evilalan
    So I'm trying to adapt this Dropdown menu on Joomla the styles work great as expected so I'll post the javascript includes on the head of my website: <script type='text/javascript' src='js/jquery.js'></script> <script type='text/javascript' src='js/dropdown.js'></script> <script type='text/javascript'> $(function() { $('.menu').droppy(); }); </script> <script type='text/javascript'> $(function() { $('.menu').droppy({speed: 100}); }); </script> ok I don't know why its is not working I'll post the dropdown.js should I post the jQuery too? it's really big! $.fn.droppy = function(options) { options = $.extend({speed: 250}, options || {}); this.each(function() { var root = this, zIndex = 1000; function getSubnav(ele) { if (ele.nodeName.toLowerCase() == 'li') { var subnav = $('> ul', ele); return subnav.length ? subnav[0] : null; } else { return ele; } } function getActuator(ele) { if (ele.nodeName.toLowerCase() == 'ul') { return $(ele).parents('li')[0]; } else { return ele; } } function hide() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', false); setTimeout(function() { if (!$.data(subnav, 'cancelHide')) { $(subnav).slideUp(options.speed); } }, 500); } function show() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', true); $(subnav).css({zIndex: zIndex++}).slideDown(options.speed); if (this.nodeName.toLowerCase() == 'ul') { var li = getActuator(this); $(li).addClass('hover'); $('> a', li).addClass('hover'); } } $('ul, li', this).hover(show, hide); $('li', this).hover( function() { $(this).addClass('hover'); $('> a', this).addClass('hover'); }, function() { $(this).removeClass('hover'); $('> a', this).removeClass('hover'); } ); }); }; My question here is: Why is it not working! I know that this is really complex (I don't anything about JavaScript) but if you help me I'll post a tutorial and edited files that will help a lot of people! By the way I've download jQuery from the original site so I don't think that this can be the problem! Thanks in advance!

    Read the article

  • Is it possible to use .data() as a search criteria?

    - by Andrew
    I have a pretty complex chat application going on, and there are multiple chat panes, chat entries, chat submits, etc. going on in the same window. At first I was going to do something like.... <input type="text" class="chattext" id="chattext-42"> <input type="text" class="chattext" id="chattext-93"> <input type="button" class="chatsubmit" id="chatsubmit-42"> <input type="button" class="chatsubmit" id="chatsubmit-93"> ... etc. (of course this is vastly simplified, they'd be in separate divs, separate visibilities, etc) So, when they clicked on a .chatsubmit, it would then get the id of that and find the last two characters for the chat ID. This presents some problems, as it would require rewrites if IDs changed lengths, and seems just plain inelegant to me. I then remembered the .data() facility in jQuery... I thought, maybe I could do it more like this: <input type="text" class="chattext"> ... and add a .data("id", 42) to this one <input type="button" class="chatsubmit"> ... and add a .data("id", 42) So that when they click chatsubmit, it gets the ID, and then finds the chattext with that ID and processes it. But looking at the documentation, I don't see an easy way to search by this. For example, let's say the event target in this case is the chatsubmit with the data('id') of 42... var ID = $(event.target).data('id'); // Sets it to 42 var chattext = ... And here I run into the trouble. How do I find which DOM element matches a class of chattext and a data('id') of 42? Is there any easy method, or do I have to search every .chattext for the one with an id of 42? Or is there another easy way of doing this? I did consider the possibility of the container div having the ID, which would make it, I think,? slightly easier to get. But if this works, it could be dealing with things in other container divs as well, making that not a long-term solution. Edit: Literally seconds after posting this, I found this: http://james.padolsey.com/javascript/extending-jquerys-selector-capabilities/ which includes information on extending the selector to data. So I'll try that out, and in the meantime, is this a completely foolhardy way of handling this?

    Read the article

< Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >