Search Results

Search found 17437 results on 698 pages for 'nick long'.

Page 188/698 | < Previous Page | 184 185 186 187 188 189 190 191 192 193 194 195  | Next Page >

  • [hibernate - jpa] @OneToOne annotoation problem (i think...)

    - by blow
    Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

    Read the article

  • Return latitude/longitude based on entered address

    - by Don
    I'm building a php based application for a client to enter in addresses for their customers' buildings. They'd like the ability to view the location on a map (either as individuals or grouped in a city search). What I'm trying to accomplish is a lookup once the address is entered into a form that populates the database, so after they enter in the addresss, city, state, zip (these are all US locations) they could click a "get lat/long info" link/button that would check to make sure the data is complete, then would lookup the address and return the latitude/longitude into the appropriate form fields. Then the form could be submitted to store the info, and I could later just pull the lat/long when plotting on a map. 1) Does this make sense, or would I be better off just doing the lookup when it's time to plot it? 2) Does anyone have any pointers to solve this problem? I've seen some of the Google/Yahoo API's but it looks like this is more based on the plotting a point part. I may be able to modify it to suit my needs, but I'm just trying to cut some research time posting here with the hopes one of you may have a more direct route. I'll RTFM if I have to... Thanks, D.

    Read the article

  • Using shared_ptr to implement RCU (read-copy-update)?

    - by yongsun
    I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • How can I keep an event from being delivered to the GUI until my code finished running?

    - by Frerich Raabe
    I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • When to drop an IT job

    - by Nippysaurus
    In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

    Read the article

  • Python FTP grabbing and saving images issue

    - by PylonsN00b
    OK So I have been messing with this all day long. I am fairly new to Python FTP. So I have searched through here and came up w/ this: images = notions_ftp.nlst() for image_name in image_names: if found_url == False: try: for image in images: ftp_image_name = "./%s" % image_name if ftp_image_name == image: found_url = True image_name_we_want = image_name except: pass # We failed to find an image for this product, it will have to be done manually if found_url == False: log.info("Image ain't there baby -- SKU: %s" % sku) return False # Hey we found something! Open the image.... notions_ftp.retrlines("RETR %s" % image_name_we_want, open(image_name_we_want, "rb")) 1/0 So I have narrowed the error down to the line before I divide by zero. Here is the error: Traceback (most recent call last): File "<console>", line 6, in <module> File "<console>", line 39, in insert_image IOError: [Errno 2] No such file or directory: '411483CC-IT,IM.jpg' So if you follow the code you will see that the image IS in the directory because image_name_we_want is set if found in that directory listing on the first line of my code. And I KNOW it's there because I am looking at the FTP site myself and ...it's freakin there. So at some point during all of this I got the image to save locally, which is most desired, but I have long since forgot what I used to make it do that. Either way, why does it think that the image isn't there when it clearly finds it in the listing.

    Read the article

  • Packet fragmentation when sending data via SSLStream

    - by Ive
    When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

    Read the article

  • Match subpatterns in any order

    - by Yaroslav
    I have long regexp with two complicated subpatters inside. How i can match that subpatterns in any order? Simplified example: /(apple)?\s?(banana)?\s?(orange)?\s?(kiwi)?/ and i want to match both of apple banana orange kiwi apple orange banana kiwi It is very simplified example. In my case banana and orange is long complicated subpatterns and i don't want to do something like /(apple)?\s?((banana)?\s?(orange)?|(orange)?\s?(banana)?)\s?(kiwi)?/ Is it possible to group subpatterns like chars in character class? UPD Real data as requested: 14:24 26,37 Mb 108.53 01:19:02 06.07 24.39 19:39 46:00 my strings much longer, but it is significant part. Here you can see two lines what i need to match. First has two values: length (14 min 24 sec) and size 26.37 Mb. Second one has three values but in different order: size 108.53 Mb, length 01 h 19 m 02 s and date June, 07 Third one has two size and length Fourth has only length There are couple more variations and i need to parse all values. I have a regexp that pretty close except i can't figure out how to match patterns in different order without writing it twice. (?<size>\d{1,3}\[.,]\d{1,2}\s+(?:Mb)?)?\s? (?<length>(?:(?:01:)?\d{1,2}:\d{2}))?\s* (?<date>\d{2}\.\d{2}))? NOTE: that is only part of big regexp that forks fine already.

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Drawing an image in Java, slow as hell on a netbook.

    - by Norswap
    In follow-up to my previous questions (especially this one : http://stackoverflow.com/questions/2684123/java-volatileimage-slower-than-bufferedimage), i have noticed that simply drawing an Image (it doesn't matter if it's buffered or volatile, since the computer has no accelerated memory*, and tests shows it's doesn't change anything), tends to be very long. (*) System.out.println(GraphicsEnvironment.getLocalGraphicsEnvironment() .getDefaultScreenDevice().getAvailableAcceleratedMemory()); --> 0 How long ? For a 500x400 image, about 0.04 seconds. This is only drawing the image on the backbuffer (obtained via buffer strategy). Now considering that world of warcraft runs on that netbook (tough it is quite laggy) and that online java games seems to have no problem whatsoever, this is quite thought provoking. I'm quite certain I didn't miss something obvious, I've searched extensively the web, but nothing will do. So do any of you java whiz have an idea of what obscure problem might be causing this (or maybe it is normal, tough I doubt it) ? PS : As I'm writing this I realized this might be cause by my Linux installation (archlinux) tough I have the correct Intel driver. But my computer normally has "Integrated Intel Graphics Media Accelerator 950", which would mean it should have accelerated video memory somehow. Any ideas about this side of things ?

    Read the article

  • Runnable to be run every second only runs once in Fragment onCreateView()

    - by jul
    I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

    Read the article

  • Can a WebServiceHost be changed to avoid the use of HttpListener?

    - by sbyse
    I am looking for a way to use a WCF WebServiceHost without having to rely on the HttpListener class and it's associated permission problems (see this question for details). I'm working on a application which communicates locally with another (third-party) application via their REST API. At the moment we are using WCF as an embedded HTTP server. We create a WebServiceHost as follows: String hostPath = "http://localhost:" + portNo; WebServiceHost host = new WebServiceHost(typeof(IntegrationService), new Uri(hostPath)); // create a webhttpbinding for rest/pox and enable cookie support for session management WebHttpBinding webHttpBinding = new WebHttpBinding(); webHttpBinding.AllowCookies = true; ServiceEndpoint ep = host.AddServiceEndpoint(typeof(IIntegrationService), webHttpBinding, ""); host.Open() ChannelFactory<IIntegrationService> cf = new ChannelFactory<IIntegrationService>(webHttpBinding, hostPath); IIntegrationService channel = cf.CreateChannel(); Everything works nicely as long as our application is run as administrator. If we run our application on a machine without administrative privileges the host.Open() will throw an HttpListenerException with ErrorCode == 5 (ERROR_ACCESS_DENIED). We can get around the problem by running httpcfg.exe from the command line but this is a one-click desktop application and that's not really as long term solution for us. We could ditch WCF and write our own HTTP server but I'd like to avoid that if possible. What's the easiest way to replace HttpListener with a standard TCP socket while still using all of the remaining HTTP scaffolding that WCF provides?

    Read the article

  • Select statement with multiple 'where' fields using same value without duplicating text

    - by kdbdallas
    I will start by saying that I don't think what I want can be done, but that said, I am hoping I am wrong and someone knows more than me. So here is your chance... Prove you are smarter than me :) I want to do a search against a SQLite table looking for any records that "are similar" without having to write out the query in long hand. To clarify this is how I know I can write the query: select * from Articles where title like '%Bla%' or category like '%Bla%' or post like '%Bla%' This works and is not a huge deal if you are only checking against a couple of columns, but if you need to check against a bunch then your query can get really long and nasty looking really fast, not to mention the chance for typos. (ie: 'Bla%' instead of '%Bla%') What I am wondering is if there is a short hand way to do this? *This next code does not work the way I want, but just shows kind of what I am looking for select * from Articles where title or category or post like '%Bla%' Anyone know if there is a way to specify that multiple 'where' columns should use the same search value without listing that same search value for every column? Thanks in advance!

    Read the article

  • How safe and reliable are C++ String Literals?

    - by DoctorT
    So, I'm wanting to get a better grasp on how string literals in C++ work. I'm mostly concerned with situations where you're assigning the address of a string literal to a pointer, and passing it around. For example: char* advice = "Don't stick your hands in the toaster."; Now lets say I just pass this string around by copying pointers for the duration of the program. Sure, it's probably not a good idea, but I'm curious what would actually be going on behind the scenes. For another example, let's say we make a function that returns a string literal: char* foo() { // function does does stuff return "Yikes!"; // somebody's feeble attempt at an error message } Now lets say this function is called very often, and the string literal is only used about half the time it's called: // situation #1: it's just randomly called without heed to the return value foo(); // situation #2: the returned string is kept and used for who knows how long char* retVal = foo(); In the first situation, what's actually happening? Is the string just created but not used, and never deallocated? In the second situation, is the string going to be maintained as long as the user finds need for it? What happens when it isn't needed anymore... will that memory be freed up then (assuming nothing points to that space anymore)? Don't get me wrong, I'm not planning on using string literals like this. I'm planning on using a container to keep my strings in check (probably std::string). I'm mostly just wanting to know if these situations could cause problems either for memory management or corrupted data.

    Read the article

< Previous Page | 184 185 186 187 188 189 190 191 192 193 194 195  | Next Page >