Search Results

Search found 1098 results on 44 pages for 'continuous'.

Page 19/44 | < Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >

  • TSQL Challenge 79 - Finding the Islands

    The challenge is to find the Islands(gaps) in sequential dates. You need to write a query to identify continuous intervals from the start date and end date. What are your servers really trying to tell you? Find out with new SQL Monitor 3.0, an easy-to-use tool built for no-nonsense database professionals.For effortless insights into SQL Server, download a free trial today.

    Read the article

  • SSL certificates work fine from command line but fails in script

    - by jrallison
    I'm trying to setup email notifications for my continuous integration server. I have a script which uses nail to send the email when the build works: #!/bin/bash echo "Build Worked!" | nail -A myisp -s 'Build Success' [email protected] When I run this from the command line with sh build-worked, it works and I receive the email. However, when I start the continuous integration server which executes the same script, I get the following error: nail: /opt/bitnami/common/lib/libssl.so.0.9.8: no version information available (required by nail) nail: /opt/bitnami/common/lib/libcrypto.so.0.9.8: no version information available (required by nail) Error with certificate at depth: 0 issuer = /C=ZA/ST=Western Cape/L=Cape Town/O=Thawte Consulting cc/OU=Certification Services Division/CN=Thawte Premium Server CA/[email protected] subject = /C=US/ST=California/L=Mountain View/O=Google Inc/CN=smtp.gmail.com err 20: unable to get local issuer certificate Continue (y/n)? could not initiate SSL/TLS connection: error:14090086:SSL routines:SSL3_GET_SERVER_CERTIFICATE:certificate verify failed . . . message not sent. I must be messing some configuration, any ideas?

    Read the article

  • SSL certificates work fine from command line but fail in script

    - by jrallison
    I'm trying to setup email notifications for my continuous integration server. I have a script which uses nail to send the email when the build works: #!/bin/bash echo "Build Worked!" | nail -A myisp -s 'Build Success' [email protected] When I run this from the command line with sh build-worked, it works and I receive the email. However, when I start the continuous integration server which executes the same script, I get the following error: nail: /opt/bitnami/common/lib/libssl.so.0.9.8: no version information available (required by nail) nail: /opt/bitnami/common/lib/libcrypto.so.0.9.8: no version information available (required by nail) Error with certificate at depth: 0 issuer = /C=ZA/ST=Western Cape/L=Cape Town/O=Thawte Consulting cc/OU=Certification Services Division/CN=Thawte Premium Server CA/[email protected] subject = /C=US/ST=California/L=Mountain View/O=Google Inc/CN=smtp.gmail.com err 20: unable to get local issuer certificate Continue (y/n)? could not initiate SSL/TLS connection: error:14090086:SSL routines:SSL3_GET_SERVER_CERTIFICATE:certificate verify failed . . . message not sent. I must be messing some configuration, any ideas?

    Read the article

  • Adobe Acrobat Reader don't zoom out the page enough in "one page" mode

    - by mbaitoff
    I'm using Adobe Acrobat Reader version 9.4 under Debian Lenny. I'm experiencing a problem: when I push the "Show one page at a time" button, I expect the page to zoom such that pressing PgUp/PgDn would turn to the next/previous page. However, the zoom seems to be not enough - very thin bottom portion of the page doesn't fit inside the reader window, and pressing PgUp/PgDn gives the jitter of the same page, and I have to push twice to get to the next page. It is even worse in continuous page mode - a roll of pages begin to be non-synced with window boundaries, ending up with page break right in the middle of the view after several turns of the pages. This behaviour doesn't occur on windows version - I have a page properly zoomed in single/continuous modes, so that turning the pages is performed as page-at-once, as intended. How to make the Acrobat Reader fit the page to window properly? Thats how it looks before pressing PgDn (notice the bottom edge of the "paper" hidden beneath the bottom window edge): Thats how it looks after pressing PgDn (notice the "paper" bottom edge emerged from beneath the window edge, while the "paper" upper edge hides behind the upper window edge, showing that the document window size is not enough to contain the whole page):

    Read the article

  • windows 2008 r2 iis worker proccess memory usage increase

    - by nLL
    I have this web site written in c#. around 400-500 users online at any time. it was on windows 2008 32 bit machine before and never ever locked/slowed down due to increased memory consumption up until i upgraded it's server to win 2008 r2 64 bit. Old server had only 4 gig ram and quad core cpu at 2ghz. site was working just fine. since i've upgraded the server i noticed (2 times with in 10 days) it started to eat ram. last night it went up to 4 gb ram. with ram increase response slows down quite a lot. recycling app pool doesn't help. I have to restart it's worker process to recover. i've noticed this usually happens if there are continuous errors. as i didn't change anything in the code am i safe to assume it is not related to memory leak in the code? did anyone came across something like that? same thing happens if i create continuous errors with classic asp. thanks

    Read the article

  • Professional Scrum Developer (.NET) Training in London

    - by Martin Hinshelwood
    On the 26th - 30th July in Microsoft’s offices in London Adam Cogan from SSW will be presenting the first Professional Scrum Developer course in the UK. I will be teaching this course along side Adam and it is a fantastic experience. You are split into teams and go head-to-head to deliver units of potentially shippable work in four two hour sprints. The Professional Scrum Developer course is the only course endorsed by both Microsoft and Ken Schwaber and they have worked together very effectively in brining this course to fruition. This course is the brain child of Richard Hundhausen, a Microsoft Regional Director, and both Adam and I attending the Trainer Prep in Sydney when he was there earlier this year. He is a fantastic trainer and no matter where you do this course you can be safe in the knowledge that he has trained and vetted all of the teachers. A tools version of Ken if you will Find a course and register Download this syllabus Download the Scrum Guide What is the Professional Scrum Developer course all about? Professional Scrum Developer course is a unique and intensive five-day experience for software developers. The course guides teams on how to turn product requirements into potentially shippable increments of software using the Scrum framework, Visual Studio 2010, and modern software engineering practices. Attendees will work in self-organizing, self-managing teams using a common instance of Team Foundation Server 2010. Who should attend this course? This course is suitable for any member of a software development team – architect, programmer, database developer, tester, etc. Entire teams are encouraged to attend and experience the course together, but individuals are welcome too. Attendees will self-organize to form cross-functional Scrum teams. These teams require an aggregate of skills specific to the selected case study. Please see the last page of this document for specific details. Product Owners, ScrumMasters, and other stakeholders are welcome too, but keep in mind that everyone who attends will be expected to commit to work and pull their weight on a Scrum team. What should you know by the end of the course? Scrum will be experienced through a combination of lecture, demonstration, discussion, and hands-on exercises. Attendees will learn how to do Scrum correctly while being coached and critiqued by the instructor, in the following topic areas: Form effective teams Explore and understand legacy “Brownfield” architecture Define quality attributes, acceptance criteria, and “done” Create automated builds How to handle software hotfixes Verify that bugs are identified and eliminated Plan releases and sprints Estimate product backlog items Create and manage a sprint backlog Hold an effective sprint review Improve your process by using retrospectives Use emergent architecture to avoid technical debt Use Test Driven Development as a design tool Setup and leverage continuous integration Use Test Impact Analysis to decrease testing times Manage SQL Server development in an Agile way Use .NET and T-SQL refactoring effectively Build, deploy, and test SQL Server databases Create and manage test plans and cases Create, run, record, and play back manual tests Setup a branching strategy and branch code Write more maintainable code Identify and eliminate people and process dysfunctions Inspect and improve your team’s software development process What does the week look like? This course is a mix of lecture, demonstration, group discussion, simulation, and hands-on software development. The bulk of the course will be spent working as a team on a case study application delivering increments of new functionality in mini-sprints. Here is the week at a glance: Monday morning and most of the day Friday will be spent with the computers powered off, so you can focus on sharpening your game of Scrum and avoiding the common pitfalls when implementing it. The Sprints Timeboxing is a critical concept in Scrum as well as in this course. We expect each team and student to understand and obey all of the timeboxes. The timebox duration will always be clearly displayed during each activity. Expect the instructor to enforce it. Each of the ½ day sprints will roughly follow this schedule: Component Description Minutes Instruction Presentation and demonstration of new and relevant tools & practices 60 Sprint planning meeting Product owner presents backlog; each team commits to delivering functionality 10 Sprint planning meeting Each team determines how to build the functionality 10 The Sprint The team self-organizes and self-manages to complete their tasks 120 Sprint Review meeting Each team will present their increment of functionality to the other teams = 30 Sprint Retrospective A group retrospective meeting will be held to inspect and adapt 10 Each team is expected to self-organize and manage their own work during the sprint. Pairing is highly encouraged. The instructor/product owner will be available if there are questions or impediments, but will be hands-off by default. You should be prepared to communicate and work with your team members in order to achieve your sprint goal. If you have development-related questions or get stuck, your partner or team should be your first level of support. Module 1: INTRODUCTION This module provides a chance for the attendees to get to know the instructors as well as each other. The Professional Scrum Developer program, as well as the day by day agenda, will be explained. Finally, the Scrum team will be selected and assembled so that the forming, storming, norming, and performing can begin. Trainer and student introductions Professional Scrum Developer program Agenda Logistics Team formation Retrospective Module 2: SCRUMDAMENTALS This module provides a level-setting understanding of the Scrum framework including the roles, timeboxes, and artifacts. The team will then experience Scrum firsthand by simulating a multi-day sprint of product development, including planning, review, and retrospective meetings. Scrum overview Scrum roles Scrum timeboxes (ceremonies) Scrum artifacts Simulation Retrospective It’s required that you read Ken Schwaber’s Scrum Guide in preparation for this module and course. MODULE 3: IMPLEMENTING SCRUM IN VISUAL STUDIO 2010 This module demonstrates how to implement Scrum in Visual Studio 2010 using a Scrum process template*. The team will learn the mapping between the Scrum concepts and how they are implemented in the tool. After connecting to the shared Team Foundation Server, the team members will then return to the simulation – this time using Visual Studio to manage their product development. Mapping Scrum to Visual Studio 2010 User Story work items Task work items Bug work items Demonstration Simulation Retrospective Module 4: THE CASE STUDY In this module the team is introduced to their problem domain for the week. A kickoff meeting by the Product Owner (the instructor) will set the stage for the why and what that will take during the upcoming sprints. The team will then define the quality attributes of the project and their definition of “done.” The legacy application code will be downloaded, built, and explored, so that any bugs can be discovered and reported. Introduction to the case study Download the source code, build, and explore the application Define the quality attributes for the project Define “done” How to file effective bugs in Visual Studio 2010 Retrospective Module 5: HOTFIX This module drops the team directly into a Brownfield (legacy) experience by forcing them to analyze the existing application’s architecture and code in order to locate and fix the Product Owner’s high-priority bug(s). The team will learn best practices around finding, testing, fixing, validating, and closing a bug. How to use Architecture Explorer to visualize and explore Create a unit test to validate the existence of a bug Find and fix the bug Validate and close the bug Retrospective Module 6: PLANNING This short module introduces the team to release and sprint planning within Visual Studio 2010. The team will define and capture their goals as well as other important planning information. Release vs. Sprint planning Release planning and the Product Backlog Product Backlog prioritization Acceptance criteria and tests Sprint planning and the Sprint Backlog Creating and linking Sprint tasks Retrospective At this point the team will have the knowledge of Scrum, Visual Studio 2010, and the case study application to begin developing increments of potentially shippable functionality that meet their definition of done. Module 7: EMERGENT ARCHITECTURE This module introduces the architectural practices and tools a team can use to develop a valid design on which to develop new functionality. The teams will learn how Scrum supports good architecture and design practices. After the discussion, the teams will be presented with the product owner’s prioritized backlog so that they may select and commit to the functionality they can deliver in this sprint. Architecture and Scrum Emergent architecture Principles, patterns, and practices Visual Studio 2010 modeling tools UML and layer diagrams SPRINT 1 Retrospective Module 8: TEST DRIVEN DEVELOPMENT This module introduces Test Driven Development as a design tool and how to implement it using Visual Studio 2010. To maximize productivity and quality, a Scrum team should setup Continuous Integration to regularly build every team member’s code changes and run regression tests. Refactoring will also be defined and demonstrated in combination with Visual Studio’s Test Impact Analysis to efficiently re-run just those tests which were impacted by refactoring. Continuous integration Team Foundation Build Test Driven Development (TDD) Refactoring Test Impact Analysis SPRINT 2 Retrospective Module 9: AGILE DATABASE DEVELOPMENT This module lets the SQL Server database developers in on a little secret – they can be agile too. By using the database projects in Visual Studio 2010, the database developers can join the rest of the team. The students will see how to apply Agile database techniques within Visual Studio to support the SQL Server 2005/2008/2008R2 development lifecycle. Agile database development Visual Studio database projects Importing schema and scripts Building and deploying Generating data Unit testing SPRINT 3 Retrospective Module 10: SHIP IT Teams need to know that just because they like the functionality doesn’t mean the Product Owner will. This module revisits acceptance criteria as it pertains to acceptance testing. By refining acceptance criteria into manual test steps, team members can execute the tests, recording the results and reporting bugs in a number of ways. Manual tests will be defined and executed using the Microsoft Test Manager tool. As the Sprint completes and an increment of functionality is delivered, the team will also learn why and when they should create a branch of the codeline. Acceptance criteria Testing in Visual Studio 2010 Microsoft Test Manager Writing and running manual tests Branching SPRINT 4 Retrospective Module 11: OVERCOMING DYSFUNCTION This module introduces the many types of people, process, and tool dysfunctions that teams face in the real world. Many dysfunctions and scenarios will be identified, along with ideas and discussion for how a team might mitigate them. This module will enable you and your team to move toward independence and improve your game of Scrum when you depart class. Scrum-butts and flaccid Scrum Best practices working as a team Team challenges ScrumMaster challenges Product Owner challenges Stakeholder challenges Course Retrospective What will be expected of you and you team? This is a unique course in that it’s technically-focused, team-based, and employs timeboxes. It demands that the members of the teams self-organize and self-manage their own work to collaboratively develop increments of software. All attendees must commit to: Pay attention to all lectures and demonstrations Participate in team and group discussions Work collaboratively with other team members Obey the timebox for each activity Commit to work and do your best to deliver All teams should have these skills: Understanding of Scrum Familiarity with Visual Studio 201 C#, .NET 4.0 & ASP.NET 4.0 experience*  SQL Server 2008 development experience Software testing experience * Check with the instructor ahead of time for the exact technologies Self-organising teams Another unique attribute of this course is that it’s a technical training class being delivered to teams of developers, not pairs, and not individuals. Ideally, your actual software development team will attend the training to ensure that all necessary skills are covered. However, if you wish to attend an open enrolment course alone or with just a couple of colleagues, realize that you may be placed on a team with other attendees. The instructor will do his or her best to ensure that each team is cross-functional to tackle the case study, but there are no guarantees. You may be required to try a new role, learn a new skill, or pair with somebody unfamiliar to you. This is just good Scrum! Who should NOT take this course? Because of the nature of this course, as explained above, certain types of people should probably not attend this course: Students requiring command and control style instruction – there are no prescriptive/step-by-step (think traditional Microsoft Learning) labs in this course Students who are unwilling to work within a timebox Students who are unwilling to work collaboratively on a team Students who don’t have any skill in any of the software development disciplines Students who are unable to commit fully to their team – not only will this diminish the student’s learning experience, but it will also impact their team’s learning experience Find a course and register Download this syllabus Download the Scrum Guide Technorati Tags: Scrum,SSW,Pro Scrum Dev

    Read the article

  • Oracle Data Integration 12c: Simplified, Future-Ready, High-Performance Solutions

    - by Thanos Terentes Printzios
    In today’s data-driven business environment, organizations need to cost-effectively manage the ever-growing streams of information originating both inside and outside the firewall and address emerging deployment styles like cloud, big data analytics, and real-time replication. Oracle Data Integration delivers pervasive and continuous access to timely and trusted data across heterogeneous systems. Oracle is enhancing its data integration offering announcing the general availability of 12c release for the key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c, delivering Simplified and High-Performance Solutions for Cloud, Big Data Analytics, and Real-Time Replication. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions : Supporting Current and Emerging Initiatives Extreme Performance : Even higher performance than ever before Fast Time-to-Value : Higher IT Productivity and Simplified Solutions  With the new capabilities in Oracle Data Integrator 12c, customers can benefit from: Superior developer productivity, ease of use, and rapid time-to-market with the new flow-based mapping model, reusable mappings, and step-by-step debugger. Increased performance when executing data integration processes due to improved parallelism. Improved productivity and monitoring via tighter integration with Oracle GoldenGate 12c and Oracle Enterprise Manager 12c. Improved interoperability with Oracle Warehouse Builder which enables faster and easier migration to Oracle Data Integrator’s strategic data integration offering. Faster implementation of business analytics through Oracle Data Integrator pre-integrated with Oracle BI Applications’ latest release. Oracle Data Integrator also integrates simply and easily with Oracle Business Analytics tools, including OBI-EE and Oracle Hyperion. Support for loading and transforming big and fast data, enabled by integration with big data technologies: Hadoop, Hive, HDFS, and Oracle Big Data Appliance. Only Oracle GoldenGate provides the best-of-breed real-time replication of data in heterogeneous data environments. With the new capabilities in Oracle GoldenGate 12c, customers can benefit from: Simplified setup and management of Oracle GoldenGate 12c when using multiple database delivery processes via a new Coordinated Delivery feature for non-Oracle databases. Expanded heterogeneity through added support for the latest versions of major databases such as Sybase ASE v 15.7, MySQL NDB Clusters 7.2, and MySQL 5.6., as well as integration with Oracle Coherence. Enhanced high availability and data protection via integration with Oracle Data Guard and Fast-Start Failover integration. Enhanced security for credentials and encryption keys using Oracle Wallet. Real-time replication for databases hosted on public cloud environments supported by third-party clouds. Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c and other Oracle technologies, such as Oracle Database 12c and Oracle Applications, provides a number of benefits for organizations: Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c enables developers to leverage Oracle GoldenGate’s low overhead, real-time change data capture completely within the Oracle Data Integrator Studio without additional training. Integration with Oracle Database 12c provides a strong foundation for seamless private cloud deployments. Delivers real-time data for reporting, zero downtime migration, and improved performance and availability for Oracle Applications, such as Oracle E-Business Suite and ATG Web Commerce . Oracle’s data integration offering is optimized for Oracle Engineered Systems and is an integral part of Oracle’s fast data, real-time analytics strategy on Oracle Exadata Database Machine and Oracle Exalytics In-Memory Machine. Oracle Data Integrator 12c and Oracle GoldenGate 12c differentiate the new offering on data integration with these many new features. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. Find out much more about the new release in the video webcast "Introducing 12c for Oracle Data Integration", where customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Resource Kits Meet Oracle Data Integration 12c  Discover what's new with Oracle Goldengate 12c  Oracle EMEA DIS (Data Integration Solutions) Partner Community is available for all your questions, while additional partner focused webcasts will be made available through our blog here, so stay connected. For any questions please contact us at partner.imc-AT-beehiveonline.oracle-DOT-com Stay Connected Oracle Newsletters

    Read the article

  • Three Key Tenets of Optimal Social Collaboration

    - by kellsey.ruppel
    Today's blog post comes to us from John Bruswick! This post is an abridged version of John’s white paper in which he discusses three principals to optimize social collaboration within an enterprise.   By [email protected], Oracle Principal Sales Consultant Effective social collaboration is actionable, deeply contextual and inherently derives its value from business entities outside of itself. How does an organization begin the journey from traditional, siloed collaboration to natural, business entity based social collaboration? Successful enablement of enterprise social collaboration requires that organizations embrace the following tenets and understand that traditional collaborative functionality has inherent limits - it is innovation and integration in accordance with the following tenets that will provide net-new efficiency benefits. Key Tenets of Optimal Social Collaboration Leverage a Ubiquitous Social Fabric - Collaborative activities should be supported through a ubiquitous social fabric, providing a personalized experience, broadcasting key business events and connecting people and business processes.  This supports education of participants working in and around a specific business entity that will benefit from an implicit capture of tacit knowledge and provide continuity between participants.  In the absence of this ubiquitous platform activities can still occur but are essentially siloed causing frequent duplication of effort across similar tasks, with critical tacit knowledge eluding capture. Supply Continuous Context to Support Decision Making and Problem Solving - People generally engage in collaborative behavior to obtain a decision or the resolution for a specific issue.  The time to achieve resolution is referred to as "Solve Time".  Users have traditionally been forced to switch or "alt-tab" between business systems and synthesize their own context across disparate systems and processes.  The constant loss of context forces end users to exert a large amount of effort that could be spent on higher value problem solving. Extend the Collaborative Lifecycle into Back Office - Beyond the solve time from decision making efforts, additional time is expended formalizing the resolution that was generated from collaboration in a system of record.  Extending collaboration to result in the capture of an explicit decision maximizes efficiencies, creating a closed circuit for a particular thread.  This type of structured action may exist today within your organization's customer support system around opening, solving and closing support issues, but generally does not extend to Sales focused collaborative activities. Excelling in the Unstructured Future We will always have to deal with unstructured collaborative processes within our organizations.  Regardless of the participants and nature of the collaborate process, two things are certain – the origination and end points are generally known and relate to a business entity, perhaps a customer, opportunity, order, shipping location, product or otherwise. Imagine the benefits if an organization's key business systems supported a social fabric, provided continuous context and extended the lifecycle around the collaborative decision making to include output into back office systems of record.   The technical hurdle to embracing optimal social collaboration would fall away, leaving the company with an opportunity to focus on and refine how processes were approached.  Time and resources previously required could then be reallocated to focusing on innovation to support competitive differentiation unique to your business. How can you achieve optimal social collaboration? Oracle Social Network enables business users to collaborate with each other using a broad range of collaboration styles and integrates data from a variety of sources and business applications -- allowing you to achieve optimal social collaboration. Looking to learn more? Read John's white paper, where he discusses in further detail the three principals to optimize social collaboration within an enterprise. 

    Read the article

  • Welcome Oracle Data Integration 12c: Simplified, Future-Ready Solutions with Extreme Performance

    - by Irem Radzik
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 The big day for the Oracle Data Integration team has finally arrived! It is my honor to introduce you to Oracle Data Integration 12c. Today we announced the general availability of 12c release for Oracle’s key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions Extreme Performance Fast Time-to-Value       There are many new features that support these key differentiators for Oracle Data Integrator 12c and for Oracle GoldenGate 12c. In this first 12c blog post, I will highlight only a few:·Future-Ready Solutions to Support Current and Emerging Initiatives: Oracle Data Integration offer robust and reliable solutions for key technology trends including cloud computing, big data analytics, real-time business intelligence and continuous data availability. Via the tight integration with Oracle’s database, middleware, and application offerings Oracle Data Integration will continue to support the new features and capabilities right away as these products evolve and provide advance features. E    Extreme Performance: Both GoldenGate and Data Integrator are known for their high performance. The new release widens the gap even further against competition. Oracle GoldenGate 12c’s Integrated Delivery feature enables higher throughput via a special application programming interface into Oracle Database. As mentioned in the press release, customers already report up to 5X higher performance compared to earlier versions of GoldenGate. Oracle Data Integrator 12c introduces parallelism that significantly increases its performance as well. Fast Time-to-Value via Higher IT Productivity and Simplified Solutions:  Oracle Data Integrator 12c’s new flow-based declarative UI brings superior developer productivity, ease of use, and ultimately fast time to market for end users.  It also gives the ability to seamlessly reuse mapping logic speeds development.Oracle GoldenGate 12c ‘s Integrated Delivery feature automatically optimally tunes the process, saving time while improving performance. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. On November 12th we will reveal much more about the new release in our video webcast "Introducing 12c for Oracle Data Integration". Our customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Please join us at this free event to learn more from our executives about the 12c release, hear our customers’ perspectives on the new features, and ask your questions to our experts in the live Q&A. Also, please continue to follow our blogs, tweets, and Facebook updates as we unveil more about the new features of the latest release. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • First Day of Data Integration Track at Oracle OpenWorld 2012

    - by Irem Radzik
    OpenWorld started full speed for us today with a great set of sessions in the Data Integration track. After the exciting keynote session on Oracle Database 12c in the morning; Brad Adelberg, VP of Development for Data Integration products, presented Oracle’s data integration product strategy. His session highlighted the new requirements for data integration to achieve pervasive and continuous access to trusted data. The new requirements and product focus areas presented in this session are: Provide access to any data at any source On premise or on cloud Enable zero downtime operations and maximum performance Leverage real-time data for accurate business insights And ensure high quality data is used across the enterprise During the session Brad walked over how Oracle’s data integration products, Oracle Data Integrator, Oracle GoldenGate, Oracle Enterprise Data Quality, and Oracle Data Service Integrator, deliver on these requirements and how recent product releases build on this strategy. Soon after Brad’s session we heard from a panel of Oracle GoldenGate customers, St. Jude Medical, Equifax, and Bank of America, how they achieved zero downtime operations using Oracle GoldenGate. The panel presented different use cases of GoldenGate, from Active-Active replication to offloading reporting. Especially St. Jude Medical’s implementation, which involves the alert management system for patients that use their pacemakers, reminded me in some cases downtime of mission-critical systems can be a matter of life or death. It is very comforting to hear that GoldenGate delivers highly-reliable continuous availability for life-saving medical systems. In the afternoon, Nick Wagner from the Product Management team and I followed the customer panel with the review of Oracle GoldenGate 11gR2’s New Features.  Many questions we received from audience were about GoldenGate’s new Integrated Capture for Oracle Database and the enhanced Conflict Management features, as well as how GoldenGate compares to Oracle Streams. In addition to giving details on GoldenGate’s unique capability to capture changed data with a direct integration to the Oracle DBMS engine, we reminded the audience that enhancements to Oracle GoldenGate will continue, while Streams will be primarily maintained. Last but not least, Tim Garrod and Ryan Fonnett from Raymond James presented a unified real-time data integration solution using Oracle Data Integrator and GoldenGate for their operational data store (ODS). The ODS supports application services across the enterprise and providing timely data is a critical requirement. In this solution, Oracle GoldenGate does the log-based change data capture for Oracle Data Integrator’s near real-time data integration between heterogeneous systems. As Raymond James’ ODS supports mission-critical services for their advisors, the project team had to set up this integration environment to be highly available. During the session, Ryan and Tim explained how they use ODI to enable automated process execution and “always-on” integration processes. Their presentation included 2 demonstrations that focused on CDC patterns deployed with ODI and the automated multi-instance execution and monitoring. We are very grateful to Tim and Ryan for their very-well prepared presentation at OpenWorld this year. Day 2 (Tuesday) will be also a busy day in our track. In addition to the Fusion Middleware Innovation Awards ceremony at 11:45am at Moscone West 3001, we have the following DI sessions Real-World Operational Reporting Customer Panel 11:45am Moscone West- 3005 Oracle Data Integrator Product Update and Future Strategy 1:15pm Moscone West- 3005 High-volume OLTP with Oracle GoldenGate: Best Practices from Comcast 1:15pm Moscone West- 3005 Everything You need to Know about Monitoring Oracle GoldenGate 5pm Moscone West-3005 If you are at OpenWorld please join us in these sessions. For a full review of data integration track at OpenWorld please see our Focus-On document.

    Read the article

  • JDeveloper 11g R1 (11.1.1.4.0) - New Features on ADF Desktop Integration Explained

    - by juan.ruiz
    One of the areas that introduced many new features on the latest release (11.1.1.4.0)  of JDeveloper 11g R1 is ADF Desktop integration - in this article I’ll provide an overview of these new features. New ADF Desktop Integration Ribbon in Excel - After installing the ADF desktop integration add-in and depending on the mode in which you open the desktop integration workbook, the ADF Desktop integration ribbon for design time and runtime are displayed as a separate tab within Excel. In previous version the ADF Desktop integration environment used to be placed inside the add-ins tab. Above you can see both, design time ribbon as well as runtime ribbon. On the design time ribbon you can manage the workbook and worksheet properties, worksheet component properties, diagnostics, execution and publication of the workbook. The runtime version of the ribbon is totally customizable and represents what it used to be the runtime menu on the spreadsheet, in this ribbon you can include all the operations and actions that could be executed by the end user while working with the spreadsheet data. Diagnostics - A very important aspect for developers is how to debug or verify the interactions of the client with the server, for that ADF desktop integration has provided since day one a series of diagnostics tools. In this release the diagnostics tools are more visible and are really easy to configure. You can access the client console while testing the workbook, or you can simple dump all the messages to a log file – having the ability of setting the output level for both. Security - There are a number of enhancements on security but the one with more impact for developers is tha security now is optional when using ADF Desktop Integration. Until this version every time that you wanted to work with ADFdi it was a must that the application was previously secured. In this release security is optional which means that if you have previously defined security on your application, then you must secure the ADFdi servlet as explained in one of my previous (ADD LINK) posts. In the other hand, if but the time that you start working with ADFdi you have not defined security, you can test and publish your workbooks without adding security. Support for Continuous Integration - In this release we have added tooling for continuous integration building. in the ADF desktop integration space, the concept translates to adding functionality that developers can use to publish ADFdi workbooks as part of their entire application build. For that purpose, we have a publish tool that can be easily invoke from an ANT task such that all the design time workbooks are re-published into the latest version of the application building process. Key Column - At runtime, on any worksheet containing editable tables you will notice a new additional column called the key column. The purpose of this column is to make the end user aware that all rows on the table need to be selected at the time of sorting. The users cannot alter the value of this column. From the developers points of view there are no steps required in order to have the key column included into the worksheets. Installation and Creation of New Workbooks - Both use cases can be executed now directly from JDeveloper. As part of the Tools menu options the developer can install the ADF desktop integration designer. Also, creating new workbooks that previously was done through that convert tool shipped with JDeveloper is now automatic done from the New Gallery. Creating a new ADFdi workbook adds metadata information information to the Excel workbook so you can work in design time. Other Enhancements Support for Excel 2010 and the ADF components ready-only enabled don’t allow to change its value – the cell in Excel is automatically protected, this could cause confusion among customers of previous releases.

    Read the article

  • Visual Studio 2010 Best Practices

    - by Etienne Tremblay
    I’d like to thank Packt for providing me with a review version of Visual Studio 2010 Best Practices eBook. In fairness I also know the author Peter having seen him speak at DevTeach on many occasions.  I started by looking at the table of content to see what this book was about, knowing that “best practices” is a real misnomer I wanted to see what they were.  I really like the fact that he starts the book by really saying they are not really best practices but actually recommend practices.  As a Team Foundation Server user I found that chapter 2 was more for the open source crowd and I really skimmed it.  The portion on Branching was well documented, although I’m not a fan of the testing branch myself, but the rest was right on. The section on merge remote changes (bring the outside to you) paradigm is really important and was touched on. Chapter 3 has good solid practices on low level constructs like generics and exceptions. Chapter 4 dives into architectural practices like decoupling, distributed architecture and data based architecture.  DTOs and ORMs are touched on briefly as is NoSQL. Chapter 5 is about deployment and is really a great primer on all the “packaging” technologies like Visual Studio Setup and Deployment (depreciated in 2012), Click Once and WIX the major player outside of commercial solutions.  This is a nice section on how to move from VSSD to WIX this is going to be important in the coming years due to the fact that VS 2012 doesn’t support VSSD. In chapter 6 we dive into automated testing practices, including test coverage, mocking, TDD, SpecDD and Continuous Testing.  Peter covers all those concepts really nicely albeit succinctly. Being a book on recommended practices I find this is really good. I really enjoyed chapter 7 that gave me a lot of great tips to enhance my Visual Studio “experience”.  Tips on organizing projects where good.  Also even though I knew about configurations I like that he put that in there so you can move all your settings to another machine, a lot of people don’t know about that. Quick find and Resharper are also briefly covered.  He touches on macros (depreciated in 2012).  Finally he touches on Continuous Integration a very important concept in today’s ALM landscape. Chapter 8 is all about Parallelization, threads, Async, division of labor, reactive extensions.  All those concepts are touched on and again generalized approaches to those modern problems are giving.       Chapter 9 goes into distributed apps, the most used and accepted practice in the industry for .NET projects the chapter tackles concepts like Scalability, Messaging and Cloud (the flavor of the month of distributed apps, although I think this will stick ;-)).  He also looks a protocols TCP/UDP and how to debug distributed apps.  He touches on logging and health monitoring. Chapter 10 tackles recommended practices for web services starting with implementing WCF services, which goes into all sort of goodness like how to host in IIS or self-host.  How to manual test WCF services, also a section on authentication and authorization.  ASP.NET Web services are also touched on in that chapter All in all a good read, nice tips and accepted practices.  I like the conciseness of the subjects and Peter touches on a lot of things in this book and uses a lot of the current technologies flavors to explain the concepts.   Cheers, ET

    Read the article

  • Visual Studio 2012 and .NET 4.5 now Live!

    - by Tarun Arora
    Today was the formal launch event for Visual Studio 2012 and .NET 4.5, a state-of-the-art development solution for building modern applications that span connected devices and continuous services, from the client to the cloud. The event was streamed live from http://visualstudiolaunch.com, S.Somasegar corporate vice president of the Developer Division opened the key note, Jason Zander dived deeper into how to leverage Visual Studio 2012 and .NET 4.5 to build modern application. Brian Harry all the awesome features in Visual Studio 2012 to improve the application lifecycle management.   I. Summary of the announcements made today 1. Visual Studio Updates coming this fall –  VS Update will better support agile teams, enable continuous quality, elevate SharePoint development with application lifecycle management (ALM) tools, and expand Visual Studio 2012 Windows development capabilities. It will be available as a community technology preview (CTP) later this month and in final release later this calendar year. A comprehensive list of what will be on offer can be found here. 2. Visual Studio Express 2012 for Windows Desktop – Visual Studio Express 2012 for Windows Desktop brings the newest desktop development capabilities in Visual Studio 2012 to Express users, too. You would be excited to know that the express SKU will support Integration with TFS among some of the other cool features I would like to mention Unit Testing, Unit Testing, Code Analysis, dependency management with NuGet a full list and download links can be found here. 3. F# tools for Visual Studio Express 2012 for web –  This F# Tools release adds in F# 3.0 components, such as the F# 3.0 compiler, F# Interactive, IDE support, and new F# features such as type providers and query expressions to your Visual Studio 2012 express for web. More details and download links can be found here. 4. Visual Studio TFS 2012 Power Tools – The TFS 2012 Power tools brings the goodness of Best Practice Analyzer, Process Template Editor, Storyboard Shapes, Team Explorer enhancements, TFPT command line, TFS Server Backups, etc via to your TFS 2012 installation. It can be downloaded right away from here. II. Road shows There will be many more community road shows this month packaged with hours of demos and discussions. The Visual Studio UK Team has just announced that there will be four UK launch events, face to face session including a product group speaker and partner sessions: Edinburgh, 1st October Manchester, 3rd October London, 4th October Reading, 5th October III. Get Started Download Visual Studio 2012 and the additional supporting software's from here. The Visual Studio development team has put together over 60 videos to help you learn about the new Visual Studio 2012 capabilities in more detail, and all of these will be available for watching here. IV. What’s Next A lot more exciting stuff lined up… Windows 8 Anticipated release: Oct. 26 (UPDATED 9/12) Windows Server 2012 Released (UPDATED 9/4) System Center 2012 Released (UPDATED 9/11) SQL Server 2012 Released (UPDATED 4/2) Internet Explorer 10 Anticipated release: Between Q3 2012 and early 2013 (UPDATED 5/3   Office 2013 Anticipated release: Q4 2012 or Q1 2013(UPDATED 9/12) Exchange 2013 Anticipated release: Q4 2012 (UPDATED 7/26) Visual Studio 2012 Released (UPDATED 9/12) Kinect for Windows Released (UPDATED 9/4) Windows Phone "Tango" and 8 "Tango": Released; Anticipated "Windows Phone 8" release: Q4 2012 (UPDATED 9/5) Dynamics ERP Online Anticipated release: September or October 2012 (UPDATED 7/20) Office 365 Anticipated update schedule: "Almost weekly"(UPDATED 9/12) Windows Azure Rumored CTP release: Spring 2012 (UPDATED 9/7) SharePoint 2013 Anticipated release: Q4 2012 (UPDATED 8/21) Enjoy

    Read the article

  • Mastering snow and Java development at jDays in Gothenburg

    - by JavaCecilia
    Last weekend, I took the train from Stockholm to Gothenburg to attend and present at the new Java developer conference jDays. It was professionally arranged in the Swedish exhibition hall close to the amusement park Liseberg and we got a great deal out of the top-level presenters and hallway discussions. Understanding and Improving Your Java Process Our main purpose was to spread information on JVM and our monitoring tools for Java processes, so I held a crash course in the most important terms and concepts if you want to affect the performance of your Java process. From the beginning - the JVM specification to interpretation of heap usage graphs. For correct analysis, you also need to understand something about process memory - you need space for the Java heap (-Xms for initial size and -Xmx for max heap size), but the process memory also contain the thread stacks (to a size of -Xss), JVM internal data structures used for keeping track of Java objects on the heap, method compilation/optimization, native libraries, etc. If you get long pause times, make sure to monitor your application, see the allocation rate and frequency of pause times.My colleague Klara Ward then held a presentation on the Java Mission Control product, the profiling and diagnostics tools suite for HotSpot, coming soon. The room was packed and very appreciated, Klara demonstrated four different scenarios, e.g. how to diagnose and fix latencies due to lock contention for logging.My German colleague, OpenJDK ambassador Dalibor Topic travelled to Sweden to do the second keynote on "Make the Future Java". He let us in on the coming features and roadmaps of Java, now delivering major versions on a two-year schedule (Java 7 2011, Java 8 2013, etc). Also letting us in on where to download early versions of 8, to report problems early on. Software Development in teams Being a scout leader, I'm drilled in different team building and workshop techniques, creating strong groups - of course, I had to attend Henrik Berglund's session on building successful teams. He spoke about the importance of clear goals, autonomy and agreed processes. Thomas Sundberg ended the conference by doing live remote pair programming with Alex in Rumania and a concrete tips for people wanting to try it out (for local collaboration, remember to wash and change clothes). Memory Master Keynote The conference keynote was delivered by the Swedish memory master Mattias Ribbing, showing off by remembering the order of a deck of cards he'd seen once. He made it interactive by forcing the audience to learn a memory mastering technique of remembering ten ordered things by heart, asking us to shout out the order backwards and we made it! I desperately need this - bought the book, will get back on the subject. Continuous Delivery The most impressive presenter was Axel Fontaine on Continuous Delivery. Very well prepared slides with key images of his message and moved about the stage like a rock star. The topic is of course highly interesting, how to create an infrastructure enabling immediate feedback to developers and ability to release your product several times per day. Tomek Kaczanowski delivered a funny and useful presentation on good and bad tests, providing comic relief with poorly written tests and the useful rules of thumb how to rewrite them. To conclude, we had a great time and hope to see you at jDays next year :)

    Read the article

  • Find the "largest" dense sub matrix in a large sparse matrix

    - by BCS
    Given a large sparse matrix (say 10k+ by 1M+) I need to find a subset, not necessarily continuous, of the rows and columns that form a dense matrix (all non-zero elements). I want this sub matrix to be as large as possible (not the largest sum, but the largest number of elements) within some aspect ratio constraints. Are there any known exact or aproxamate solutions to this problem? A quick scan on Google seems to give a lot of close-but-not-exactly results. What terms should I be looking for? edit: Just to clarify; the sub matrix need not be continuous. In fact the row and column order is completely arbitrary so adjacency is completely irrelevant. A thought based on Chad Okere's idea Order the rows from largest count to smallest count (not necessary but might help perf) Select two rows that have a "large" overlap Add all other rows that won't reduce the overlap Record that set Add whatever row reduces the overlap by the least Repeat at #3 until the result gets to small Start over at #2 with a different starting pair Continue until you decide the result is good enough

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Timer a usage in msp430 in high compiler optimization mode

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code, //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • My timer code is failing when IAR is configured to do max optimization

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code [Code] //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled [/code] Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • What guidelines should be followed when using an unstable/testing/stable branching scheme?

    - by Elliot
    My team is currently using feature branches while doing development. For each user story in our sprint, we create a branch and work it in isolation. Hence, according to Martin Fowler, we practice Continuous Building, not Continuous Integration. I am interested in promoting an unstable/testing/stable scheme, similar to that of Debian, so that code is promoted from unstable = testing = stable. Our definition of done, I'd recommend, is when unit tests pass (TDD always), minimal documentation is complete, automated functional tests pass, and feature has been demo'd and accepted by PO. Once accepted by the PO, the story will be merged into the testing branch. Our test developers spend most of their time in this branch banging on the software and continuously running our automated tests. This scares me, however, because commits from another incomplete story may now make it into the testing branch. Perhaps I'm missing something because this seems like an undesired consequence. So, if moving to a code promotion strategy to solve our problems with feature branches, what strategy/guidelines do you recommend? Thanks.

    Read the article

  • Copy File Contiguously to Disk from OSX/Unix/Linux to FAT32 FS?

    - by alharaka
    So the Sysinternals guys have that cool contig.exe utility that allows me ensure a file is contiguous. I need to copy overs ISO files to a FAT32 USB flash key. Grub4DOS requires the files be continuous, but I do not have Windows access at the moment. Is there a way to copy a file so it is contiguous on the target drive, or a tool like the aforementioned that will make an existing file contiguous. Again, I need it on FAT32, and there lies the rub.

    Read the article

  • How to declutter and organize the cables on and under my desk?

    - by splattne
    Computer cables and external devices are a continuous source of frustration for everybody who likes a clean working environment. The more devices you add to your home office, the more disastrous the situation under the table becomes: cords falling behind the desk, ugly cables running along the sides and under of the desk, making it almost impossible to clean and remove the dust. This is not my office, but I've seen similar "setups:" I'm looking for good tips/products which help me in keeping the all cables somehow under control and organized. Thanks!

    Read the article

  • Optimize windows 2008 performance

    - by Giorgi
    Hello, I have windows server 2008 sp2 installed as virtual machine on my personal laptop. I use it only for source control (visual svn) and continuous integration (teamcity). As the virtual machine resources are limited I'd like to optimize it's performance by disabling services and features that are not necessary for my purposes. Can anyone recommend where to start or provide with tips for getting better performance. Thanks.

    Read the article

< Previous Page | 15 16 17 18 19 20 21 22 23 24 25 26  | Next Page >