Search Results

Search found 15021 results on 601 pages for 'location aware'.

Page 193/601 | < Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >

  • Deploying DotNetNuke and separate ASP.NET Application together - Possible Issues?

    - by TheTXI
    I am making this in a proactive attempt to head off any potential problems which could arise from this. The situation is that we are developing an ASP.NET application for a client which will handle the online ordering from their customers. This application is going to be using the same database that their current WinForms application uses (no real issue here). At the same time we are developing a new front-end website for them using DotNetNuke. The DotNetNuke app will simply be linking to the ASP.NET application for the customers to submit their orders (no need for them to communicate back and forth, etc.) The plan is to host both applications on the same box at the client location. What I am looking for are potential problems or setup tips which would prevent possible conflict between the two apps (web.config conflicts, etc.) Is there a problem with having both hosted on the same location, how should IIS be set up, etc.? If there are any external resources also available which could address this, please feel free to link them as well.

    Read the article

  • authorise user from mysql database

    - by Jacksta
    I suck at php, and cant find the error here. The script gets 2 variables "username" and "password" from a html from then check them against a MySQL databse. When I run this I get the follow error "Query was empty" <? if ((!$_POST[username]) || (!$_POST[password])) { header("Location: show_login.html"); exit; } $db_name = "testDB"; $table_name = "auth_users"; $connection = @mysql_connect("localhost", "admin", "pass") or die(mysql_error()); $db = @mysql_select_db($db_name, $connection) or die(mysql_error()); $slq = "SELECT * FROM $table_name WHERE username ='$_POST[username]' AND password = password('$_POST[password]')"; $result = @mysql_query($sql, $connection) or die(mysql_error()); $num = mysql_num_rows($result); if ($num != 0) { $msg = "<p>Congratulations, you're authorised!</p>"; } else { header("Location: show_login.html"); exit; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Secret Area</title> </head> <body> <? echo "$msg"; ?> </body> </html>

    Read the article

  • How to update child iFrame's entire html (header+body) inside jQuery's post

    - by knappy
    I have a chat webpage for Firefox that is structured like this ..... Outer HTML -----|......Frameset Frame ------------|...... header: contains jQuery post has returned data: rdata = new_iFrame_html_str, the entire html string of the iFrame that should be updated ------------|...... iFrame --------------------|...... header: contains jQuery --------------------|...... body: chat messages that depends on the header jQuery to behave properly QUESTION: I can't this jQuery post to work, i.e. I can't find a way for this post to update the ENTIRE iFrame (header + body). Things I've tried and FAILED with javascript and jQuery: top.frames['framesetFrame_name'].document.getElementById('iframe_id').contentDocument.body.innerHTML = new_iFrame_html_str; I don't like this because it's only changing the body, not the header, so the behavior generated from jQuery can't be shown top.frames['framesetFrame_name'].document.getElementById('iframe_bucinid').contentWindow.location.reload(); I do not want to reload because a reload makes the iFrame flicker, bad for a chat program top.frames['framesetFrame_name'].document.getElementById('iframe_id').contents().html = new_iFrame_html_str; Not updating anything that shows :( top.frames['framesetFrame_name'].document.getElementById('iframe_id').contentWindow.location.href = new_iFrame_html_str; This is actually the wrong form here, because it should be = url_of_new_content $( top.frames['framesetFrame_name'].document.getElementById('iframe_id') ).html( new_iFrame_html_str ) ; Not updating anything that shows :(

    Read the article

  • ASP.NET - Accessing copied content

    - by James Kolpack
    I have a class library project which contains some content files configured with the "Copy if newer" copy build action. This results in the files being copied to a folder under ...\bin\ for every project in the solution. In this same solution, I've got a ASP.NET web project (which is MVC, by the way). In the library I have a static constructor load the files into data structures accessible by the web project. Previously I've been including the content as an embedded resource. I now need to be able to replace them without recompiling. I want to access the data in three different contexts: Unit testing the library assembly Debugging the web application Hosting the site in IIS For unit testing, Environment.CurrentDirectory points to a path containing the copied content. When debugging however, it points to C:\Program Files\Microsoft Visual Studio 9.0\Common7\IDE. I've also looked at Assembly.GetExecutingAssembly().Location which points to C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\c44f9da4\9238ccc\assembly\dl3\eb4c23b4\9bd39460_f7d4ca01\. What I need is to the physical location of the webroot \bin folder, but since I'm in a static constructor in the library project, I don't have access to a Request.PhysicalApplicationPath. Is there some other environment variable or structure where I can always find my "Copy if newer" files?

    Read the article

  • Reading a C/C++ data structure in C# from a byte array

    - by Chris Miller
    What would be the best way to fill a C# struct from a byte[] array where the data was from a C/C++ struct? The C struct would look something like this (my C is very rusty): typedef OldStuff { CHAR Name[8]; UInt32 User; CHAR Location[8]; UInt32 TimeStamp; UInt32 Sequence; CHAR Tracking[16]; CHAR Filler[12];} And would fill something like this: [StructLayout(LayoutKind.Explicit, Size = 56, Pack = 1)]public struct NewStuff{ [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(0)] public string Name; [MarshalAs(UnmanagedType.U4)] [FieldOffset(8)] public uint User; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(12)] public string Location; [MarshalAs(UnmanagedType.U4)] [FieldOffset(20)] public uint TimeStamp; [MarshalAs(UnmanagedType.U4)] [FieldOffset(24)] public uint Sequence; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 16)] [FieldOffset(28)] public string Tracking;} What is best way to copy OldStuff to NewStuff, if OldStuff was passed as byte[] array? I'm currently doing something like the following, but it feels kind of clunky. GCHandle handle;NewStuff MyStuff;int BufferSize = Marshal.SizeOf(typeof(NewStuff));byte[] buff = new byte[BufferSize];Array.Copy(SomeByteArray, 0, buff, 0, BufferSize);handle = GCHandle.Alloc(buff, GCHandleType.Pinned);MyStuff = (NewStuff)Marshal.PtrToStructure(handle.AddrOfPinnedObject(), typeof(NewStuff));handle.Free(); Is there better way to accomplish this?

    Read the article

  • Ajax Request not working. onSuccess and onFailure not triggering

    - by Kye
    Hi all, trying to make a page which will recursively call a function until a limit has been reached and then to stop. It uses an ajax query to call an external script (which just echo's "done" for now) howver with neither onSuccess or onFailure triggering i'm finding it hard to find the problem. Here is the javascript for it. In the header for the webpage there is a script to an ajax.js document which contains the request data. I know the ajax.js works as I've used it on another website var Rooms = "1"; var Items = "0"; var ccode = "9999/1"; var x = 0; function echo(string,start){ var ajaxDisplay = document.getElementById('ajaxDiv'); if(start) {ajaxDisplay.innerHTML = string;} else {ajaxDisplay.innerHTML = ajaxDisplay.innerHTML + string;} } function locations() { echo("Uploading location "+x+" of " + Rooms,true); Ajax.Request("Perform/location.php", { method:'get', parameters: {ccode: ccode, x: x}, onSuccess: function(reply) {alert("worked"); if(x<Rooms) { x++; locations(); } else { x=0; echo("Done",true); } }, onFailure: function() {alert("not worked"); echo("not done"); } }); alert("boo"); } Any help or advice will be most appreciated.

    Read the article

  • LINQ-to-XML Error "is not a member of 'String'"

    - by mmcglynn
    The following code returns the error from the For Each loop. I have similar code that does not return the error. 'DisplayTitle' is not a member of 'Sting' Dim evXML As XDocument = XDocument.Load(Server.MapPath("~/App_Data/event.xml")) Dim sbEventDetail As New StringBuilder() Dim summary = _ From sum In evXML.<root>.Elements() _ Select sum...<DisplayTitle>.Value For Each item In summary sbEventDetail.Append("<h4>" & item.DisplayTitle & "</h4>") Next The XML: <root xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <StartTime>2010-03-05T16:00:00</StartTime> <EndTime>2010-03-06T02:00:00</EndTime> <Duration>10:00:00</Duration> <DisplayTitle>MARCH MADNESS</DisplayTitle> <Location>565 Main St</Location> <IsAllDay>False</IsAllDay> <Recurrence> <OriginatingTimeZone>Eastern Standard Time</OriginatingTimeZone> <RecurrenceType>0</RecurrenceType> <RecurrenceEndDate>9999-12-31T23:59:59</RecurrenceEndDate> </Recurrence> <IsVariance>False</IsVariance> <IsCancelled>False</IsCancelled> <OriginalStart>0001-01-01T00:00:00</OriginalStart> </root>

    Read the article

  • Create a real time web application using .net framework and azure - very confused

    - by test
    Let us say I would like a simple (yet complex) web application where there is continuous READING AND WRITING to the sql azure database. Let us say I am tracking a location, and I would like it to be updated very frequently (lets take the worst case: 1 second). From the little knowledge I have, I think that this involves the use of the database to continuously write the location to the database, and continuously read from the database to update another person through a website. Do you please have any suggestion which technologies can I use? Is there a simple way? I heard about node.js, signalR. I have no idea how to use them, if they are really what I need. the last tutorial I checked out simply uses a while(true) loop..but I don't think that that's something good to keep a thread continuously busy... Do I have to create some background task? Do I have to create some web service? This is a school project and I wish not to go for the most difficult option, but if there is some sort of solution, challenge accepted :) Can you please help me? Since I have asked many questions here and yet I have no solution in mind

    Read the article

  • DataGridView not displaying data in ToolStripControlHost

    - by jblaske
    I'm utilizing the code posted by Jesper Palm here: http://stackoverflow.com/questions/280891/make-user-control-display-outside-of-form-boundry /// <summary> /// A simple popup window that can host any System.Windows.Forms.Control /// </summary> public class PopupWindow : System.Windows.Forms.ToolStripDropDown { private System.Windows.Forms.Control _content; private System.Windows.Forms.ToolStripControlHost _host; public PopupWindow(System.Windows.Forms.Control content) { //Basic setup... this.AutoSize = false; this.DoubleBuffered = true; this.ResizeRedraw = true; this._content = content; this._host = new System.Windows.Forms.ToolStripControlHost(content); //Positioning and Sizing this.MinimumSize = content.MinimumSize; this.MaximumSize = content.Size; this.Size = content.Size; content.Location = Point.Empty; //Add the host to the list this.Items.Add(this._host); } } I've translated it to VB: Public Class PopupWindow Inherits System.Windows.Forms.ToolStripDropDown Private _content As System.Windows.Forms.Control Private _host As System.Windows.Forms.ToolStripControlHost Public Sub New(ByVal content As System.Windows.Forms.Control) Me.AutoSize = False Me.DoubleBuffered = True Me.ResizeRedraw = True Me._content = content Me._host = New System.Windows.Forms.ToolStripControlHost(content) Me.MinimumSize = content.MinimumSize Me.MaximumSize = content.MaximumSize Me.Size = content.Size content.Location = Point.Empty Me.Items.Add(Me._host) End Sub End Class It works great with a PictureBox showing its information. But for some reason I cannot get the DataGridView to display anything when it is in the popup. If I pull the grid out of the popup it displays all of its information fine. If I pause during debug, the grid shows that it has all the data in it. It's just not displaying anything. Does anybody have any ideas?

    Read the article

  • IE Information Bar, download file...how do I code for this?

    - by flatline
    I have a web page (asp.net) that compiles a package then redirects the user to the download file via javascript (window.location = ....). This is accompanied by a hard link on the page in case the redirect doesn't work - emulating the download process on many popular sites. When the IE information bar appears at the top due to restricted security settings, and a user clicks on it to download the file, it redirects the user to the page, not the download file, which refreshes the page and removes the hard link. What is the information bar doing here? Shouldn't it send the user to the location of the redirect? Am I setting something wrong in the headers of the download response, or doing something else wrong to send the file in the first place? C# Code: m_context.Response.Buffer = false; m_context.Response.ContentType = "application/zip"; m_context.Response.AddHeader("Content-Length", fs.Length.ToString()); m_context.Response.AddHeader("Content-Disposition", string.Format("attachment; filename={0}_{1}.zip", downloadPrefix, DateTime.Now.ToString("yyyy-MM-dd_HH-mm"))); //send the file

    Read the article

  • Splitting data from MySQL using PHP & Javascript works in IE but not in FF

    - by MTSzabo
    I have the following JavaScript function on a page: function setFields(){ var menu = document.getElementById('EditLocation'); var itemDataArray = menu[menu.selectedIndex].value.split('|'); form.LocationShortName.value = itemDataArray[0]; form.LocationLongName.value = itemDataArray[1]; form.Phone.value = itemDataArray[2]; form.Address1.value = itemDataArray[3]; form.CityStateZip.value = itemDataArray[4]; form.MapLink.value = itemDataArray[5]; } Down on the Form, I have the following: <select class="input2" name="EditLocation" id="EditLocation" onchange = "setFields();"> <option value="-Add New-"<?php if($editlocation=='-Add New-'){echo(' selected="selected"');} ?>>-Add New-</option> <?php require_once('connection.php'); $connection = mysql_connect($hostname,$username,$password) or die (mysql_errno().": ".mysql_error()."<BR />"); mysql_select_db($database); $sql = "SELECT * FROM directions ORDER BY dirshortname"; $query = mysql_query($sql); while ($row = mysql_fetch_array($query)) { echo('<option value="'.stripslashes($row['dirshortname']).'|'.stripslashes($row['dirlongname']).'|'.stripslashes($row['dirphone']).'|'.stripslashes($row['dirstreet']).'|'.stripslashes($row['dircsz']).'|'.stripslashes($row['dirmaplink']).'"'); if ($editlocation==stripslashes($row['dirshortname'])) { echo(' selected="selected"'); } echo('>'.stripslashes($row['dirshortname']).'</option>'); } ?> In essence, the PHP is supposed to pack the data elements pulled from MySQL into the OPTION VALUE portion of the SELECT box. Once the user selects a record, the JavaScript pulls the packed data apart and populates the other data elements on the FORM. It all works wonderfully in IE, but in FF the fields do not populate with data. The form is somewhat long, but I'll include it anyway for the sake of completeness. <form action="admin-dirs.php" method="post" enctype="multipart/form-data" style="margin:0px; padding:0px " id="form"> <table width="587" border="0" cellspacing="0" cellpadding="0"> <tr> <td width="60">&nbsp;</td> <td width="185">Select Location to Edit: </td> <td width="342"><select class="input2" name="EditLocation" id="EditLocation" onchange = "setFields();"> <option value="-Add New-"<?php if($editlocation=='-Add New-'){echo(' selected="selected"');} ?>>-Add New-</option> <?php require_once('connection.php'); $connection = mysql_connect($hostname,$username,$password) or die (mysql_errno().": ".mysql_error()."<BR />"); mysql_select_db($database); $sql = "SELECT * FROM directions ORDER BY dirshortname"; $query = mysql_query($sql); while ($row = mysql_fetch_array($query)) { echo('<option value="'.stripslashes($row['dirshortname']).'|'.stripslashes($row['dirlongname']).'|'.stripslashes($row['dirphone']).'|'.stripslashes($row['dirstreet']).'|'.stripslashes($row['dircsz']).'|'.stripslashes($row['dirmaplink']).'"'); if ($editlocation==stripslashes($row['dirshortname'])) { echo(' selected="selected"'); } echo('>'.stripslashes($row['dirshortname']).'</option>'); } ?> </select></td> </tr> <tr> <td width="60">&nbsp;</td> <td colspan="2"><span class="main" style=" padding-left:12px; padding-right:12px; padding-top:6px"><br /> (Note: Leaving the Long Name blank will duplicate the Short Name.)</span></td> </tr> <?php if(!$errlocationshortname=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$errlocationshortname.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>Location Short Name: <span class="red_star">*</span> </td> <td><input name="LocationShortName" id="LocationShortName" type="text" class="input2<?php if(!$errlocationshortname==''){echo('r');} ?>" value="<?php echo($locationshortname); ?>" maxlength="50"></td> </tr> <?php if(!$errlocationlongname=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$errlocationlongname.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>Location Long Name: <span class="red_star">*</span> </td> <td><input name="LocationLongName" id="LocationLongName" type="text" class="input2<?php if(!$errlocationlongname==''){echo('r');} ?>" value="<?php echo($locationlongname); ?>" maxlength="50"></td> </tr> <?php if(!$erraddress=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$erraddress.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>Street Address: <span class="red_star">*</span> </td> <td><input name="Address1" id="Address1" type="text" class="input2<?php if(!$erraddress==''){echo('r');} ?>" value="<?php echo($address); ?>"></td> </tr> <?php if(!$errcsz=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$errcsz.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>City, State, Zip: <span class="red_star">*</span> </td> <td><input name="CityStateZip" id="CityStateZip" type="text" class="input2<?php if(!$errcsz==''){echo('r');} ?>" value="<?php echo($csz); ?>"></td> </tr> <?php if(!$errphone=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$errphone.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>Location Phone Number: <span class="red_star">*</span> </td> <td><input name="Phone" id="Phone" type="text" class="input2<?php if(!$errphone==''){echo('r');} ?>" value="<?php echo($phone); ?>" maxlength="20"></td> </tr> <?php if(!$errmaplink=='' ){echo(' <tr> <td width="60">&nbsp;</td> <td width="185">&nbsp;</td> <td width="342"><span class="redtxterror">'.$errmaplink.'</span></td> </tr>');} ?> <tr> <td>&nbsp;</td> <td>Paste Link to Map: <span class="red_star">*</span> </td> <td><input name="MapLink" id="MapLink" type="text" class="input2<?php if(!$errmaplink==''){echo('r');} ?>" value="<?php echo($maplink); ?>" maxlength="125"></td> </tr> <tr> <td>&nbsp;</td> <td>&nbsp;</td> <td><div align="right" style="padding-right:25px"> <input type="hidden" id="action" name="action" value="submitform" /> <input type="submit" id="savenew" name="savenew" value="Save & New" /> <input type="submit" id="submit" name="submit" value="Save & Close" /> <?php if(!isset($_POST['action'])) {?> <input type="reset" id="reset" name="reset" value="Reset" /> <?php } ?> </div></td> </tr><tr> <td>&nbsp;</td> <td>&nbsp;</td> <td class="main_d"><div align="right" style="padding-right:25px">Your IP Address is Logged as: <?php echo($ip); ?></div></td> </tr> </table> </form>

    Read the article

  • What is the best way to include Javascript?

    - by Paul Tarjan
    Many of the big players recommend slightly different techniques. Mostly on the placement of the new <script>. Google Anayltics: (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Facebook: (function() { var e = document.createElement('script'); e.async = true; e.src = document.location.protocol + '//connect.facebook.net/en_US/all.js'; document.getElementById('fb-root').appendChild(e); }());: Disqus: (function() { var dsq = document.createElement('script'); dsq.type = 'text/javascript'; dsq.async = true; dsq.src = 'http://' + disqus_shortname + '.disqus.com/embed.js'; (document.getElementsByTagName('head')[0] || document.getElementsByTagName('body')[0]).appendChild(dsq); })(); (post others and I'll add them) Is there any rhyme or reason for these choices or does it not matter at all?

    Read the article

  • Can't make HREF change based on PHP value

    - by Liso22
    I want to retrieve the user's location and then show a link that points to an URL that changes according to that location. I just want to place the user's city name at the end of the HREF. I need this work on my wordpress site, on a static page. I use a plugin called Exec-php which let's me run PHP in pages. I have a plugin that provides me the user's city through the shortcode "[mmjs-city]". I tried to make it work through different paths but I never get the link to work. Here I tried assigning that shortcode to a value, <?php $city= "[mmjs-city]"; echo $city; echo "<a href='?s=" . $city ."'>Search for your city</a>"; ?> I added the first two lines to check whether the shortcode is working or not and if it's correctly assinged to the value $city. That part works. Then it creates the link and put's the value $city at the end of it. But when trying it instead of taking me to: /?s=new+york It takes me to: /?s=%3Cscript%20language=%22javascript%22%3Edocument.write(geoip_city());%3C/script%3E I have no idea what to do. I would be really thankful for any info on how to make it work, it's really an important feature for my site. Please ask for any further info or idk anything. Also this is where I tested that code: http://chusmix.com/?page_id=1129 Thanks

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Lucene.Net: How can I add a date filter to my search results?

    - by rockinthesixstring
    I've got my searcher working really well, however it does tend to return results that are obsolete. My site is much like NerdDinner whereby events in the past become irrelevant. I'm currently indexing like this Public Function AddIndex(ByVal searchableEvent As [Event]) As Boolean Implements ILuceneService.AddIndex Dim writer As New IndexWriter(luceneDirectory, New StandardAnalyzer(), False) Dim doc As Document = New Document doc.Add(New Field("id", searchableEvent.ID, Field.Store.YES, Field.Index.UN_TOKENIZED)) doc.Add(New Field("fullText", FullTextBuilder(searchableEvent), Field.Store.YES, Field.Index.TOKENIZED)) doc.Add(New Field("user", If(searchableEvent.User.UserName = Nothing, "User" & searchableEvent.User.ID, searchableEvent.User.UserName), Field.Store.YES, Field.Index.TOKENIZED)) doc.Add(New Field("title", searchableEvent.Title, Field.Store.YES, Field.Index.TOKENIZED)) doc.Add(New Field("location", searchableEvent.Location.Name, Field.Store.YES, Field.Index.TOKENIZED)) doc.Add(New Field("date", searchableEvent.EventDate, Field.Store.YES, Field.Index.UN_TOKENIZED)) writer.AddDocument(doc) writer.Optimize() writer.Close() Return True End Function Notice how I have a "date" index that stores the event date. My search then looks like this ''# code omitted Dim reader As IndexReader = IndexReader.Open(luceneDirectory) Dim searcher As IndexSearcher = New IndexSearcher(reader) Dim parser As QueryParser = New QueryParser("fullText", New StandardAnalyzer()) Dim query As Query = parser.Parse(q.ToLower) ''# We're using 10,000 as the maximum number of results to return ''# because I have a feeling that we'll never reach that full amount ''# anyways. And if we do, who in their right mind is going to page ''# through all of the results? Dim topDocs As TopDocs = searcher.Search(query, Nothing, 10000) Dim doc As Document = Nothing ''# loop through the topDocs and grab the appropriate 10 results based ''# on the submitted page number While i <= last AndAlso i < topDocs.totalHits doc = searcher.Doc(topDocs.scoreDocs(i).doc) IDList.Add(doc.[Get]("id")) i += 1 End While ''# code omitted I did try the following, but it was to no avail (threw a NullReferenceException). While i <= last AndAlso i < topDocs.totalHits If Date.Parse(doc.[Get]("date")) >= Date.Today Then doc = searcher.Doc(topDocs.scoreDocs(i).doc) IDList.Add(doc.[Get]("id")) i += 1 End If End While I also found the following documentation, but I can't make heads or tails of it http://lucene.apache.org/java/1_4_3/api/org/apache/lucene/search/DateFilter.html

    Read the article

  • Using Relative Paths to Load Resources in Cocoa/C++

    - by moka
    I am currently working directly with Cocoa for the first time to built a screen saver. Now I came across a problem when trying to load resources from within the .saver bundle. I basically have a small C++ wrapper class to load .exr files using freeImage. This works as long as I use absoulte paths, but that's not very useful, is it? So, basically, I tried everything: putting the .exr file at the level of the .saver bundle itself, inside the bundles Resources folder, and so on. Then I simply tried to load the .exr like this, but without success: particleTex = [self loadExrTexture:@"ball.exr"]; I also tried making it go to the .saver bundles location like this: particleTex = [self loadExrTexture:@"../../../ball.exr"]; ...to maybe load the .exr from that location, but without success. I then came across this: NSString * path = [[NSBundle mainBundle] pathForResource:@"ball" ofType:@"exr"]; const char * pChar = [path UTF8String]; ...which seems to be a common way to find resources in Cocoa, but for some reason it's empty in my case. Any ideas about that? I really tried out anything that came to my mind without success so I would be glad about some input!

    Read the article

  • PHP Include and sort by variable within file

    - by Jason Hoax
    I have written this PHP include-script but now I'm trying to sort the included files out by variables WITHIN the included php's. In other words, in each included PHP file there is a rating, now I want the ratings to be read so that when they are included they will be sorted out from highest to lowest. (scores are like 6.0 to 9.0) Kind Regards! $location = 'experiments/visualizations'; foreach (glob("$location/*.php") as $filename) { include $filename; } The included files are named randomly like: File1: $filename = "AAAA"; $projecttitle = "Project Name"; $description = "This totally explains the product"; $score = "7.6"; File 2: $filename = "BBBB"; $projecttitle = "Project Name2" $description = "This totally explains the product"; $score = "9.6"; As you can see 9.6 is higher than 7.6 but PHP sorts the includes out by name instead of variables within the file. I tried sorting, but I can't get it fixed. Help!

    Read the article

  • Appending an existing XML file with c#

    - by Farstucker
    I have an existing XML file that I would like to append without changing the format. Existing File looks like this: <Clients> <User username="farstucker"> <UserID>1</UserID> <DOB /> <FirstName>Steve</FirstName> <LastName>Lawrence</LastName> <Location>NYC</Location> </User> </Clients> How can I add another user using this format? My existing code is: string fileLocation = "clients.xml"; XmlTextWriter writer; if (!File.Exists(fileLocation)) { writer = new XmlTextWriter(fileLocation, null); writer.WriteStartDocument(); // Write the Root Element writer.WriteStartElement("Clients"); // End Element and Close writer.WriteEndElement(); writer.Close(); } // Append new data here Ive thought about using XmlDocument Fragment to append the data but Im not certain if I can maintain the existing format ( and empty tags ) without messing up the file. Any advice you could give is much appreciated. EDIT Ive changed the code to read the original XML but the file keeps getting overwritten.

    Read the article

  • Load In and Animate content

    - by crozer
    Hello, I have a little issue concerning an animation-effect which loads a certain div into the body of the site. Let me be more precise: I have a div with the id 'contact': <div id="contact">content</div> The jquery code loads the contents within that div, when I press the link with the id 'ajax_contact': <a href="#" id="ajax_contact">link</a>. The code is working perfectly. However, I want #contact to be HIDDEN when the site loads, i.e. the default state must be non-visible. Only when the user clicks the link #ajax_contact, the div must appear. Please have a look at the jquery code: $(document).ready(function() { var hash = window.location.hash.substr(1); var href = $('#ajax_contact').each(function(){ var href = $(this).attr('href'); if(hash==href.substr(0,href.length-5)){ var toLoad = hash+'.html #contact'; $('#contact').load(toLoad) } }); $('#ajax_contact').click(function(){ var toLoad = $(this).attr('href')+' #contact'; $('#contact').hide('fast',loadContent); $('#load').remove(); $('body').append('<span id="load">LOADING...</span>'); $('#load').fadeIn('normal'); window.location.hash = $(this).attr('href').substr(0,$(this).attr('href').length-5); function loadContent() { $('#contact').load(toLoad,'',showNewContent()) } function showNewContent() { $('#contact').show('normal',hideLoader()); } function hideLoader() { $('#load').fadeOut('normal'); } return false; }); }); I am not sure whether I must change something inside the HTML, but I believe the key is inside the jquery-code. I also tried giving the #contact a CSS style of visible:none, yet this loops and makes the jquery impossible to load the #contact in. I hope I've explained myself well; thank you very much in advance. Chris

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • Compiling GWT 2.6.1 at Java 7 source level

    - by Neeko
    I've recently updated my GWT project to 2.6.1, and started to make use of Java 7 syntax since 2.6 now supports Java 7. However, when I attempt to compile, I'm receiving compiler errors such as [ERROR] Line 42: '<>' operator is not allowed for source level below 1.7 How do I specify the GWT compiler to target 1.7? I was under the impression that it would do that by default, but I guess not. I've attempted cleaning the project, including deleting the gwt-unitCache directory but to no avail. Here is my Ant compile target. <target name="compile" depends="prepare"> <javac includeantruntime="false" debug="on" debuglevel="lines,vars,source" srcdir="${src.dir}" destdir="${build.dir}"> <classpath refid="project.classpath"/> </javac> </target> <target name="gwt-compile" depends="compile"> <java failonerror="true" fork="true" classname="com.google.gwt.dev.Compiler"> <classpath> <!-- src dir is added to ensure the module.xml file(s) are on the classpath --> <pathelement location="${src.dir}"/> <pathelement location="${build.dir}"/> <path refid="project.classpath"/> </classpath> <jvmarg value="-Xmx256M"/> <arg value="${gwt.module.name}"/> </java> </target>

    Read the article

  • Why does PEAR get installed to my user directory?

    - by webworm
    I am new to Linux and I am attempting to install the PHP PEAR library on a virtual server which is running Ubuntu. I am following a tutorial that covers installing PEAR but have run up against an area where I am confused. When running the PEAR installation program I am prompted as to what I want the INSTALL_PREFIX to be. Evidently the INSTALL_PREFIX, among other things, determines where PEAR will be installed. The tutorial suggest the value of INSTALL_PREFIX be the following path ... "/home/MY_USER_NAME/pear" where MY_USER_NAME = my user account Having come from a Windows world, applications are installed on the system where everyone can use them. If I install PEAR underneath my user directory will other developers on the system be able to make use of PEAR in their PHP scripts? I want to make PEAR available to all users and not just myself. Could someone explain to me the difference between installing for all users and installing just for myself? Does the install location matter? Should I be installing PEAR in a different location? Thanks for any suggestions. P.S. The tutorial I am following is located at the following URL ... http://articles.sitepoint.com/article/getting-started-with-pear/2

    Read the article

  • Designing model/database for distance between any two locations (that may change)

    - by Yo Ludke
    We should create a web app which has a number of events each with a location (created as user-generated content, so the number of events will be increasingly large). The distance between any events should be available, for example to determine the top 5 closest events and such things. Users may change the locations of events. How should one design the database/model for this (in a scalable way)? I was thinking of doing it with a "distance table" (like so http://www.deutschland-tourist.info/images/entfernungstabelle.gif). Then every time, if a location changes, one row and one column have to be recalculated (this should be done with a delayed job, because it is not important to have the changes instantly). Possible problems in Scaling: Database to large (n² items for n events), too much calculation to be done. For example we should see if this is okay for 10.000 users. If each has created just one event, then this would be 100 million integers... Do you think this would be a good way to do it efficiently? How could one realize such a distance table with an rails model? Is it possible with a SQL databse? Would you start other approaches?

    Read the article

  • Getting "prompt aborted by user" javascript exception

    - by Bhagwat
    I am getting "Components.Exception("prompt aborted by user", Cr.NS_ERROR_NOT_AVAILABLE)" exception when I am using "windows.location.href" in javasacript. My Code is: function checkCookie(){ var value = null; var cookieName='UserDetailsCookie'; value=ReadCookie(cookieName); if(value != null){ var url='<%=request.getContextPath()%>/jsp/admin.jsp'; window.location.href = url; } document.loginForm.userName.focus(); } function ReadCookie(name) { name += '='; var parts = document.cookie.split(/;\s*/); for (var i = 0; i < parts.length; i++) { var part = parts[i]; if (part.indexOf(name) == 0) return part.substring(name.length); } return null; } and I am calling this method on onLoad event of body <body onLoad="javascript:checkCookie();"> In anyone knows why this exception throws please?

    Read the article

  • Cleaning up PHP Code

    - by Michael
    Hi, I've noticed I am a very sloppy coder and do things out of the ordinary. Can you take a look at my code and give me some tips on how to code more efficiently? What can I do to improve? session_start(); /check if the token is correct/ if ($_SESSION['token'] == $_GET['custom1']){ /*connect to db*/ mysql_connect('localhost','x','x') or die(mysql_error()); mysql_select_db('x'); /*get data*/ $orderid = mysql_real_escape_string($_GET['order_id']); $amount = mysql_real_escape_string($_GET['amount']); $product = mysql_real_escape_string($_GET['product1Name']); $cc = mysql_real_escape_string($_GET['Credit_Card_Number']); $length = strlen($cc); $last = 4; $start = $length - $last; $last4 = substr($cc, $start, $last); $ipaddress = mysql_real_escape_string($_GET['ipAddress']); $accountid = $_SESSION['user_id']; $credits = mysql_real_escape_string($_GET['custom3']); /*insert history into db*/ mysql_query("INSERT into billinghistory (orderid, price, description, credits, last4, orderip, accountid) VALUES ('$orderid', '$amount', '$product', '$credits', '$last4', '$ipaddress', '$accountid')"); /*add the credits to the users account*/ mysql_query("UPDATE accounts SET credits = credits + $credits WHERE user_id = '$accountid'"); /*redirect is successful*/ header("location: index.php?x=1"); }else{ /*something messed up*/ header("location: error.php"); }

    Read the article

< Previous Page | 189 190 191 192 193 194 195 196 197 198 199 200  | Next Page >