Search Results

Search found 12670 results on 507 pages for 'ie tweaker plus'.

Page 194/507 | < Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201 | Next Page >

Search for string allowing for one mismatches in any location of the string, Python

- by Vincent

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

Read the article
imagegrabwindow + https = black screen

- by earls

I'm doing something stupid and trying to capture thumbnails, snapshots, images of a html webpages. I'm doing something along the lines of: http://stackoverflow.com/questions/443837/how-might-i-obtain-a-snapshot-or-thumbnail-of-a-web-page-using-php DCOM + IE + PHP (imagegrabwindow; example from manual) Everything works PERFECT until I try to capture a HTTPS website... https://mail.google.com for example. imagegrabwindow produces a png, but it only shows the browser. the contents of the browser are black. If I log out of Google, I can capture the browser window and the contents thereof - the second I log in, the contents (not the browser frame) are black screen. Yes, I've increased the timeout (before closing the browser window). IE has clearly loaded the page, it just refuses to render for imagegrabwindow. I've been fighting this long enough I know it's either a permissions problem or a service needs to interact with the desktop. Does anyone have any clue what permissions need to be set or which service needs access? I assumed cryptographic services, but that's run as a network service and trying to change it to interact makes it shout and carry on. This is the last piece of the puzzle, I'd really like to get it working. Thank you!

Read the article
Creative ways to punish (or just curb) laziness in coworkers

- by FerretallicA

Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

Read the article
Very strange jQuery / AJAX behavior

- by Dr. DOT

I have an Ajax call to the server that only works when I pass an alert(); to it. Cannot figure out what is wrong. Can anyone help? This Does Not Work (ie., Ajax call to server does not get made):  This Works! (ie., Ajax call to server gets made when I have the alert() present):  Thanks.

Read the article
Circle drawing with SVG's arc path

- by ????

The following SVG path can draw 99.99% of a circle: (try it on http://jsfiddle.net/DFhUF/46/ and see if you see 4 arcs or only 2, but note that if it is IE, it is rendered in VML, not SVG, but have the similar issue) M 100 100 a 50 50 0 1 0 0.00001 0 But when it is 99.99999999% of a circle, then nothing will show at all? M 100 800 a 50 50 0 1 0 0.00000001 0 And that's the same with 100% of a circle (it is still an arc, isn't it, just a very complete arc) M 100 800 a 50 50 0 1 0 0 0 How can that be fixed? The reason is I use a function to draw a percentage of an arc, and if I need to "special case" a 99.9999% or 100% arc to use the circle function, that'd be kind of silly. Again, a test case on jsfiddle using RaphaelJS is at http://jsfiddle.net/DFhUF/46/ (and if it is VML on IE 8, even the second circle won't show... you have to change it to 0.01) Update: This is because I am rendering an arc for a score in our system, so 3.3 points get 1/3 of a circle. 0.5 gets half a circle, and 9.9 points get 99% of a circle. But what if there are scores that are 9.99 in our system? Do I have to check whether it is close to 99.999% of a circle, and use an arc function or a circle function accordingly? Then what about a score of 9.9987? Which one to use? It is ridiculous to need to know what kind of scores will map to a "too complete circle" and switch to a circle function, and when it is "a certain 99.9%" of a circle or a 9.9987 score, then use the arc function.

Read the article
jQuery: Traversing AJAX response in Chrome/Safari

- by jitzo

I'm trying to traverse an AJAX response, which contains a remote web page (an HTML output). My goal is to iterate through the 'script', 'link', and 'title' elements of the remote page - load them if necessary, and embed its contents to the current page. Its working great in FF/IE, but for some reason - Chrome & Safari behaves differently: When I run a .each() loop on the response, Chrome/Safari seems to omit everything that is under the section of the page. Here's my current code: $.ajax({ url: 'remoteFile.php', cache: false, dataFilter: function(data) { console.log(data); /* The output seems to contain the entire response, including the <head> section - on all browsers, including Chrome/Safari */ $(data).filter("link, script, title").each(function(i) { console.log($(this)); /* IE/FF outputs all of the link/script/title elements, Chrome will output only those that are not in the <head> section */ }); console.log($(data)); /* This also outputs the incomplete structure on Chrome/Safari */ return data; }, success: function(response) {} }); I've been struggling with this problem for quite a while now, i've found some other similar cases on google searches, but no real solution. This happens on both jQuery 1.4.2, and jQuery 1.3.2. I really don't want to parse the response with .indexOf() and .substring() - it seems to me that it will be an overkill for the client. Many thanks in advance!

Read the article
Academic question: typename

- by Arman

Hi, recently I accounted with a "simple problem" of porting code from VC++ to gcc/intel. The code is compiles w/o error on VC++: #include <vector> using std::vector; template <class T> void test_vec( std::vector<T> &vec) { typedef std::vector<T> M; /*==> add here typename*/ M::iterator ib=vec.begin(),ie=vec.end(); }; int main() { vector<double> x(100, 10); test_vec<double>(x); return 0; } then with g++ we have some unclear errors: g++ t.cpp t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&)': t.cpp:13: error: expected `;' before 'ie' t.cpp: In function 'void test_vec(std::vector<T, std::allocator<_CharT> >&) [with T = double]': t.cpp:18: instantiated from here t.cpp:12: error: dependent-name 'std::M::iterator' is parsed as a non-type, but instantiation yields a type t.cpp:12: note: say 'typename std::M::iterator' if a type is meant If we add typename before iterator the code will compile w/o pb. If it is possible to make a compiler which can understand the code written in the more "natural way", then for me is unclear why we should add typename? Which rules of "C++ standards"(if there are some) will be broken if we allow all compilers to use without "typename"? kind regards Arman.

Read the article
How to stop MVC caching the results of invoking and action method?

- by Trey Carroll

I am experiencing a problem with IE caching the results of an action method. Other articles I found were related to security and the [Authorize] attribute. This problem has nothing to do with security. This is a very simple "record a vote, grab the average, return the avg and the number of votes" method. The only slightly interesting thing about it is that it is invoked via Ajax and returns a Json object. I believe that it is the Json object that is getting catched. When I run it from FireFox and watch the XHR traffic with Firebug, everything works perfectly. However, under IE 8 the "throbber" graphic doesn't ever have time to show up and the page elements that display the "new" avg and count that are being injected into the page with jQuery are never different. I need a way to tell MVC to never cache this action method. This article seems to address the problem, but I cannot understand it: http://stackoverflow.com/questions/1441467/prevent-caching-of-attributes-in-asp-net-mvc-force-attribute-execution-every-tim I need a bit more context for the solution to understand how to extend AuthorizationAttribute. Please address your answer as if you were speaking to someone who lacks a deep understanding of MVC even if that means replying with an article on some basics/prerequisites that are required. Thanks, Trey Carroll

Read the article
What is Adobe Flex? Is it just Flash II?

- by Adam Davis

Question Alright, I'm confused by all the buzzwords and press release bingo going on. What is the relationship between flash and flex: Replace flash (not really compatible) Enhance flash The next version of flash but still basically compatible Separate technology altogether ??? If I'm starting out in Flash now, should I just skip to Flex? Follow up Ok, so what I'm hearing is that there's three different parts to the puzzle: Flash The graphical editor used to make "Flash Movies", ie it's an IDE that focuses on the visual aspect of "Flash" (Officially Flash CS3?) The official name for the display plugins (ie, "Download Flash Now!") A general reference to the entire technology stack In terms of the editor, it's a linear timeline based editor, best used for animations with complex interactivity. Actionscript The "Flash" programming language Flex An Adobe Flash IDE that focuses on the coding/programming aspect of "Flash" (Flex Builder?) A Flash library that enhances Flash and makes it easier to program for (Flex SDK?) Is not bound to a timeline (as the Flash IDE is) and so "standard" applications are more easily accomplished. Is this correct?

Read the article
Emulating a web browser

- by Sean

Hello, we are tasked with basically emulating a browser to fetch webpages, looking to automate tests on different web pages. This will be used for (ideally) console-ish applications that run in the background and generate reports. We tried going with .NET and the WatiN library, but it was built on a Marshalled IE, and so it lacked many features that we hacked in with calls to unmanaged native code, but at the end of the day IE is not thread safe nor process safe, and many of the needed features could only be implemented by changing registry values and it was just terribly unflexible. Proxy support JavaScript support- we have to be able to parse the actual DOM after any javascript has executed (and hopefully an event is raised to handle any ajax calls) Ability to save entire contents of page including images FROM THE loaded page's CACHE to a separate location ability to clear cookies/cache, get the cookies/cache, etc. Ability to set headers and alter post data for any browser call And for the love of drogs, an API that isn't completely cryptic Languages acceptable C++, C#, Python, anything that can be a simple little console application that doesn't have a retarded syntax like Ruby. From my own research, and believe me I am terrible at google searches, I have heard good things about WebKit... would the Qt module QtWebKit handle all these features?

Read the article
Javascript error when attempting to open a modal window in a modal window

- by The Sheek Geek

The application is running on a windows server 2003 box using asp.net 2.0 and is an IE specific web app. There is a button that opens a form in an iframe using showModalDialog(...) from a function call located in the javascript. Here is an example of the fucntion: function ShowBusinessHoursSubForm( source ) { var retval = window.showModalDialog("htm/" + locLocaleID + "/SubFormHostFrame.htm", source, "dialogWidth:265px;dialogHeight:261px;help:no;scroll:no;status:no;"); } The host frame is loading an aspx page which contains the actual form that is being used. On the form that is opened there is a button that, when clicked, submits changed to the form. However, if no changed were made before the form was submitted, another modal window pops up stating that there were no changed to the form. This modal window is opened through registration of some javascript in the button click event. The code is as follows (C#): string l_S_ErrorScript = "<script type='text/javascript' language='javascript'>window.showModalDialog('htm/" + l_S_Culture + "/NotChangedErrorDialog.htm', '../../" + l_S_SkinPath + "', 'dialogWidth:310px;dialogHeight:145px;scroll:no;help:no;status:no;');</script>"; if(!m_Page.ClientScript.IsStartupScriptRegistered("ErrorScript")) { m_Page.ClientScript.RegisterStartupScript(this.GetType(), "ErrorScript", l_S_ErrorScript); } When the button is clicked and this dialog needs to appear the following javascript error appears: Error: Object doesn't support this property or method The weird thing is, if I access the application locally and try it everything works fine, but accessing from another computer causes the error. Also, depending on what server (we have many servers for testing all with windows server 2003) the error may not occur on another computer either. These computers are running the same software version using the same version of IE with the same settings. I'm inclined to believe that there is some configuration issue somewhere, but with the settings being the same it is hard to tell. I cannot really change how the app works or the technologies used either. Anyone have any ideas as to what may be causing this?

Read the article
Opacity CSS not working in IE8

- by Alistair Christie

I'm using CSS to indicate the trigger text for a jQuery slide-down section: i.e. when you hover over the trigger text the cursor changes to a pointer and the opacity of the trigger text is reduced to indicate that the text has a click action. This works fine in Firefox and Chrome, but in IE8 the opacity doesn't change. I've tried a variety of CSS settings without any success. For example HTML: <h3 class="slidedownTrigger">This is the trigger text</h3> CSS: .slidedownTrigger { cursor: pointer; -ms-filter: “progid:DXImageTransform.Microsoft.Alpha(Opacity=75)”; filter: alpha(opacity=75); -khtml-opacity: 0.75; -moz-opacity: 0.75; opacity: 0.75; } What's stopping IE changing the opacity? Note: I've tried this on a variety of different elements, swapping round the order of the CSS statements, and just using the IE ones on their own. I've also tried using -ms-filter: "alpha(opacity=75)"; but with no success. I've run out of things to try to get opacity modification working in IE8. Any ideas?

Read the article
jQuery Animate Inconsistencies between Browsers

- by silent1mezzo

I'm trying to figure out why this works in FireFox, Chrome but not in IE and not properly in Safari and Opera (you can view it working at http://41six.com/about/) HTML: <div id="menu"> <ul> <li> <a href="/" class="home" title="Home" alt="fortyonesix"> </a> <div id='home-hover'>Home Page</div> </li> </ul> </div> CSS: #menu .home { display:block; height:24px; width:24px; background-image: url('../images/Home.png'); } #home-hover { position:fixed; padding: 3px 0 3px 10px; left:40px; top:125px; width: 100px; height: 20px; background-color:#000; color: #fff; z-index:9999; opacity: .9; filter: alpha(opacity=90); -ms-filter:"progid:DXImageTransform.Microsoft.Alpha(Opacity=90)"; -moz-border-radius-topright: 5px; -webkit-border-top-right-radius: 5px; -moz-border-radius-bottomright: 5px; -webkit-border-top-bottom-radius: 5px; display:none; } JQuery: $('.home').hover(function() { $('#home-hover').animate({width:'toggle'},200); }, function() { $('#home-hover').animate({width:'toggle'},200); }); It's definitely not pretty but I'm not sure why its not working for Safari, Opera and IE

Read the article
Making HTTP POST request

- by infrared

I'm trying to make a POST request to retrieve information about a book. Here is the code that returns HTTP code: 302, Moved import httplib, urllib params = urllib.urlencode({ 'isbn' : '9780131185838', 'catalogId' : '10001', 'schoolStoreId' : '15828', 'search' : 'Search' }) headers = {"Content-type": "application/x-www-form-urlencoded", "Accept": "text/plain"} conn = httplib.HTTPConnection("bkstr.com:80") conn.request("POST", "/webapp/wcs/stores/servlet/BuybackSearch", params, headers) response = conn.getresponse() print response.status, response.reason data = response.read() conn.close() When I try from a browser, from this page: http://www.bkstr.com/webapp/wcs/stores/servlet/BuybackMaterialsView?langId=-1&catalogId=10001&storeId=10051&schoolStoreId=15828 , it works. What am I missing in my code? Thanks EDIT: Here's what I get when I call print response.msg 302 Moved Date: Tue, 07 Sep 2010 16:54:29 GMT Vary: Host,Accept-Encoding,User-Agent Location: http://www.bkstr.com/webapp/wcs/stores/servlet/BuybackSearch X-UA-Compatible: IE=EmulateIE7 Content-Length: 0 Content-Type: text/plain; charset=utf-8 Seems that the location points to the same url I'm trying to access in the first place? EDIT2: I've tried using urllib2 as suggested here. Here is the code: import urllib, urllib2 url = 'http://www.bkstr.com/webapp/wcs/stores/servlet/BuybackSearch' values = {'isbn' : '9780131185838', 'catalogId' : '10001', 'schoolStoreId' : '15828', 'search' : 'Search' } data = urllib.urlencode(values) req = urllib2.Request(url, data) response = urllib2.urlopen(req) print response.geturl() print response.info() the_page = response.read() print the_page And here is the output: http://www.bkstr.com/webapp/wcs/stores/servlet/BuybackSearch Date: Tue, 07 Sep 2010 16:58:35 GMT Pragma: No-cache Cache-Control: no-cache Expires: Thu, 01 Jan 1970 00:00:00 GMT Set-Cookie: JSESSIONID=0001REjqgX2axkzlR6SvIJlgJkt:1311s25dm; Path=/ Vary: Accept-Encoding,User-Agent X-UA-Compatible: IE=EmulateIE7 Content-Length: 0 Connection: close Content-Type: text/html; charset=utf-8 Content-Language: en-US Set-Cookie: TSde3575=225ec58bcb0fdddfad7332c2816f1f152224db2f71e1b0474c866f3b; Path=/

Read the article
CSS Menu disappear

- by WtFudgE

Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

Read the article
how to know location of return address on stack c/c++

- by Dr Deo

i have been reading about a function that can overwrite its return address. void foo(const char* input) { char buf[10]; //What? No extra arguments supplied to printf? //It's a cheap trick to view the stack 8-) //We'll see this trick again when we look at format strings. printf("My stack looks like:\n%p\n%p\n%p\n%p\n%p\n% p\n\n"); //%p ie expect pointers //Pass the user input straight to secure code public enemy #1. strcpy(buf, input); printf("%s\n", buf); printf("Now the stack looks like:\n%p\n%p\n%p\n%p\n%p\n%p\n\n"); } It was sugggested that this is how the stack would look like Address of foo = 00401000 My stack looks like: 00000000 00000000 7FFDF000 0012FF80 0040108A <-- We want to overwrite the return address for foo. 00410EDE Question: -. Why did the author arbitrarily choose the second last value as the return address of foo()? -. Are values added to the stack from the bottom or from the top? apart from the function return address, what are the other values i apparently see on the stack? ie why isn't it filled with zeros Thanks.

Read the article
[Google Maps] Trouble with invalid argument when switching jQueryUI based tabs

- by Chad

Here's a page with the issue To reproduce the error, using IE - click the directions tab, then any of the others. What I'm trying to do is this: On page load, do nothing really. However, when the directions tab loads - setup the map. Like so: $('#tabs').bind('tabsshow', function(event, ui) { if (ui.panel.id == "tabs-5") { // get map for directions var dirMap = new GMap2($("div#dirMap").get(0)); dirMap.setCenter(new GLatLng(35.79648921414565,139.40663874149323), 12); dirMap.enableScrollWheelZoom(); dirMap.addControl(new PanoMapTypeControl()); geocoder = new GClientGeocoder(); $("#dirMap").resizable({ stop: function() { dirMap.checkResize(); } }); // clear dirText $("div#dirMapText").html(""); dirMap.clearOverlays(); var polygon = new GPolygon([new GLatLng(35.724496338474104,139.3444061279297),new GLatLng(35.74748750802863,139.3363380432129),new GLatLng(35.75765724051559,139.34303283691406),new GLatLng(35.76545779822543,139.3418312072754),new GLatLng(35.767547103447725,139.3476676940918),new GLatLng(35.75835374997911,139.34955596923828),new GLatLng(35.755149755962755,139.3567657470703),new GLatLng(35.74679090345495,139.35796737670898),new GLatLng(35.74762682821177,139.36294555664062),new GLatLng(35.744422402303826,139.36346054077148),new GLatLng(35.74860206266584,139.36946868896484),new GLatLng(35.735644401200986,139.36843872070312),new GLatLng(35.73843117306677,139.36174392700195),new GLatLng(35.73592308277646,139.3531608581543),new GLatLng(35.72686543236113,139.35298919677734),new GLatLng(35.724496338474104,139.3444061279297)], "#f33f00", 5, 1, "#ff0000", 0.2);dirMap.addOverlay(polygon); // load directions directions = new GDirections(dirMap, $("div#dirMapText").get(0)); directions.load("from: [email protected],139.37083393335342 to: Ruby [email protected],139.40663874149323"); } }); What the heck is causing the error? The IE javascript debugger claims the error lies in main.js, line 139 character 28. (the google maps api file). Which is this line: function zf(a,b){a=a.style;a.width=b.getWidthString();a.height=b.getHeightString()} Any ideas? Thanks in advance!

Read the article
How do I escape ampersands in batch files?

- by Peter Mortensen

How do I escape ampersands in a batch file (or from the Windows command line) in order to use the start command to open web pages with ampersands in the URL? Double quotes will not work with start; this starts a new command line window instead. Update 1: Wael Dalloul's solution works. In addition, if there are URL encoded characters (e.g. space is encoded as %20) in the URL and it is in a batch file then '%' must be encoded as '%%'. This is not the case in the example. Example, from the command line (CMD.EXE): start http://www.google.com/search?client=opera&rls=en&q=escape+ampersand&sourceid=opera&ie=utf-8&oe=utf-8 will result in http://www.google.com/search?client=opera being opened in the default browser and these errors in the command line window: 'rls' is not recognized as an internal or external command, operable program or batch file. 'q' is not recognized as an internal or external command, operable program or batch file. 'sourceid' is not recognized as an internal or external command, operable program or batch file. 'ie' is not recognized as an internal or external command, operable program or batch file. 'oe' is not recognized as an internal or external command, operable program or batch file. Platform: Windows XP 64 bit SP2.

Read the article
Python minidom and UTF-8 encoded XML with hash references

- by Jakob Simon-Gaarde

Hi I am experiencing some difficulty in my home project where I need to parse a SOAP request. The SOAP is generated with gSOAP and involves string parameters with special characters like the danish letters "æøå". gSOAP builds SOAP requests with UTF-8 encoding by default, but instead of sending the special chatacters in raw format (ie. bytes C3A6 for the special character "æ") it sends what I think is called character hash references (ie. Ã¦). I don't completely understand why gSOAP does it this way as I can see that it has marked the incomming payload as being UTF-8 encoded anyway (Content-Type: text/xml; charset=utf-8), but this is besides the question (I think). Anyway I guess gSOAP probably is obeying transport rules, or what? When I parse the request from gSOAP in python with xml.dom.minidom.parseString() I get element values as unicode objects which is fine, but the character hash references are not decoded as UTF-8 character codes. It unescapes the character hash references, but does not decode the string afterwards. In the end I have a unicode string object with UTF-8 encoding: So if the string "æble" is contained in the XML, it comes like this in the request: "Ã¦ble" After parsing the XML the unicode string in the DOM Text Node's data member looks like this: u'\xc3\xa6ble' I would expect it to look like this: u'\xe6ble' What am I doing wrong? Should I unescape the SOAP XML before parsing it, or is it somewhere else I should be looking for the solution, maybe gSOAP? Thanks in advance. Best regards Jakob Simon-Gaarde

Read the article
Monitor file selection in explorer (like clipboard monitoring) in C#

- by Christian

Hi, I am trying to create a little helper application, one scenario is "file duplication finder". What I want to do is this: I start my C# .NET app, it gives me an empty list. Start the normal windows explorer, select a file in some folder The C# app tells me stuff about this file (e.g. duplicates) How can I monitor the currently selected file in the "normal" windows explorer instance. Do I have to start the instance using .NET to have a handle of the process. Do I need a handle, or is there some "global hook" I can monitor inside C#. Its a little bit like monitoring the clipboard, but not exactly the same... Any help is appreciated (if you don't have code, just point me to the right interops, dlls or help pages :-) Thanks, Chris EDIT 1 (current source, thanks to Mattias) using SHDocVw; using Shell32; public static void ListExplorerWindows() { foreach (InternetExplorer ie in new ShellWindowsClass()) DebugExplorerInstance(ie); } public static void DebugExplorerInstance(InternetExplorer instance) { Debug.WriteLine("DebugExplorerInstance ".PadRight(30, '=')); Debug.WriteLine("FullName " + instance.FullName); Debug.WriteLine("AdressBar " + instance.AddressBar); var doc = instance.Document as IShellFolderViewDual ; if (doc != null) { Debug.WriteLine(doc.Folder.Title); foreach (FolderItem item in doc.SelectedItems()) { Debug.WriteLine(item.Path); } } }

Read the article
I am trying to get a simple jqplot example going but it will not display, why not?

- by stephenmm

Here is the entire contents of the file: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> <title>jqPlot Examples</title>  <script language="javascript" type="text/javascript" src="../jqtouch-1_0_b/jqtouch/jquery.1.3.2.min.js"></script> <script language="javascript" type="text/javascript" src="../javascript/jquery.jqplot.min.js"></script> <link rel="stylesheet" type="text/css" href="../javascript/jquery.jqplot.css" /> </head> <body> <h1>jqPlot Examples</h1> <script id="source" language="javascript" type="text/javascript"> $.jqplot('chartdiv', [[[1, 2],[3,5.12],[5,13.1],[7,33.6],[9,85.9],[11,219.9]]]); </script> div<br> <div id="chartdiv" style="height:400px;width:300px; "></div> div<br> </body> </html> <html> Here is what I see in FF, chrome, IE: jqPlot Examples div div I am seeing no errors in my Apache error log. I know all the .js files are accessible from the html. Does anyone have an idea about why this might not be working?

Read the article
Building a News-feed that comprises posts "created by user's connections" && "on the topics user is following"

- by aklin81

I am working on a project of Questions & Answers website that allows a user to follow questions on certain topics from his network. A user's news-feed wall comprises of only those questions that have been posted by his connections and tagged on the topics that he is following(his expertise topics). I am confused what database's datamodel would be most fitting for such an application. The project needs to consider the future provisions for scalability and high performance issues. I have been looking at Cassandra and MySQL solutions as of now. After my study of Cassandra I realized that Simple news-feed design that shows all the posts from network would be easy to design using Cassandra by executing fast writes to all followers of a user about the post from user. But for my kind of application where there is an additional filter of 'followed topics', (ie, the user receives posts "created by his network" && "on topics user is following"), I could not convince myself with a good schema design in Cassandra. I hope if I missed something because of my short understanding of cassandra, perhaps, can you please help me out with your suggestions of how this news-feed could be implemented in Cassandra ? Looking for a great project with Cassandra ! Edit: There are going to be maximum 5 tags allowed for tagging the question (ie, max 5 topics can be tagged on a question).

Read the article
Launch ClickOnce via URL but not checking for updates

- by Jeff Kotula

I have a ClickOnce app that is frequently launched from another application via a URL. The URL includes some command-line arguments that load data, etc. Since the frequency of launching the app is so high, I want to cut out the check for version updates. So I implemented my own checking through the ApplicationDeployment class to avoid it. It works fine if you launch from the Start Menu once the app is installed. However, we also want to preserve the launch via URL behavior because it is advantageous in so many ways. But when launching via URL, the update check is always performed -- it seems IE isn't smart enough to look for the app in the local download area to see if it is already installed or not... Does anyone know of a way to get the "don't check for updates automatically" behavior while still using the URL launch mechanism? Actually, it looks like the issue is a Catch-22 in the ClickOnce model. If you launch with a URL, IE will always touch base with the host and check the version, updating if necessary, regardless of whether or not the app is flagged as "Don't check version". However, if you launch from the Start Menu, ClickOnce disables command-line arguments. Has anyone found any way around this, or know of a MS plan to fix it?

Read the article
Select highest rated, oldest track

- by Blair McMillan

I have several tables: CREATE TABLE [dbo].[Tracks]( [Id] [uniqueidentifier] NOT NULL, [Artist_Id] [uniqueidentifier] NOT NULL, [Album_Id] [uniqueidentifier] NOT NULL, [Title] [nvarchar](255) NOT NULL, [Length] [int] NOT NULL, CONSTRAINT [PK_Tracks_1] PRIMARY KEY CLUSTERED ( [Id] ASC )WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] CREATE TABLE [dbo].[TrackHistory]( [Id] [int] IDENTITY(1,1) NOT NULL, [Track_Id] [uniqueidentifier] NOT NULL, [Datetime] [datetime] NOT NULL, CONSTRAINT [PK_TrackHistory] PRIMARY KEY CLUSTERED ( [Id] ASC )WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] INSERT INTO [cooltunes].[dbo].[TrackHistory] ([Track_Id] ,[Datetime]) VALUES ("335294B0-735E-4E2C-8389-8326B17CE813" ,GETDATE()) CREATE TABLE [dbo].[Ratings]( [Id] [int] IDENTITY(1,1) NOT NULL, [Track_Id] [uniqueidentifier] NOT NULL, [User_Id] [uniqueidentifier] NOT NULL, [Rating] [tinyint] NOT NULL, CONSTRAINT [PK_Ratings] PRIMARY KEY CLUSTERED ( [Id] ASC )WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] INSERT INTO [cooltunes].[dbo].[Ratings] ([Track_Id] ,[User_Id] ,[Rating]) VALUES ("335294B0-735E-4E2C-8389-8326B17CE813" ,"C7D62450-8BE6-40F6-80F1-A539DA301772" ,1) Users User_Id|Guid Other fields Links between the tables are pretty obvious. TrackHistory has each track added to it as a row whenever it is played ie. a track will appear in there many times. Ratings value will either be 1 or -1. What I'm trying to do is select the Track with the highest rating, that is more than 2 hours old, and if there is a duplicate rating for a track (ie a track receives 6 +1 ratings and 1 - rating, giving that track a total rating of 5, another track also has a total rating of 5), the track that was last played the longest ago should be returned. (If all tracks have been played within the last 2 hours, no rows should be returned) I'm getting somewhere doing each part individually using the link above, SUM(Value) and GROUP BY Track_Id, but I'm having trouble putting it all together. Hopefully someone with a bit more (MS)SQL knowledge will be able to help me. Many thanks!

Read the article
Page_PreRender fires twice on first load in session

- by awe

I have an issue when I access the application, I notice that Page_PreRender is fired twice. This only happens the first time in a new session. It does not happen if I refresh the page, or on postbacks. I use .NET framework 3.5 and the built in ajax functionality. I think the problem is not related to img tag with empty src attribute as I have seen other posts has mentioned, because I see this in both FireFox and IE. The posts I saw about this stated that this was not a problem in IE. I have also searched and found no img tags with empty src in the generated page source, so it should not be this. I have also made a simple test page where I have included some of the functionality, and this does not happen. Here I have also tried to reproduce the empty src bug by including <img src="" /> on the page, but this does not trigger this problem. Have anyone any suggestions on what happens? Note: It is the entire page cycle that is firing twice, not just render.

Read the article

< Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201 | Next Page >