Search Results

Search found 4969 results on 199 pages for 'def'.

Page 195/199 | < Previous Page | 191 192 193 194 195 196 197 198 199  | Next Page >

  • Why does C# exit when calling the Ada elaboration routine using debug?

    - by erict
    I have a DLL created in Ada using GPS. I am dynamically loading it and calling it successfully both from Ada and from C++. But when I try to call it from C#, the program exits on the call to Elaboration init. What am I missing? The exact same DLL is perfectly happy getting called from C++ and Ada. Edit: If I start the program without Debugging, it also works with C#. But if I run it with the Debugger, then it exits on the call to ElaborationInit. There are no indications in any of the Windows event logs. If the Ada DLL is Pure, and I skip the elaboration init call, the actual function DLL is called correctly, so it has something to do with the elaboration. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Runtime.InteropServices; namespace CallingDLLfromCS { class Program { [DllImport("kernel32.dll", CharSet = CharSet.Auto, SetLastError = true)] public static extern IntPtr LoadLibrary(string dllToLoad); [DllImport("kernel32.dll", CharSet = CharSet.Ansi, SetLastError = true)] public static extern IntPtr GetProcAddress(IntPtr hModule, string procedureName); [DllImport("kernel32.dll", CharSet = CharSet.Auto, SetLastError = true)] public static extern bool FreeLibrary(IntPtr hModule); [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate int AdaCallable2_dlgt(int val); static AdaCallable2_dlgt fnAdaCallable2 = null; [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate void ElaborationInit_dlgt(); static ElaborationInit_dlgt ElaborationInit = null; [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate void AdaFinal_dlgt(); static AdaFinal_dlgt AdaFinal = null; static void Main(string[] args) { int result; bool fail = false; // assume the best IntPtr pDll2 = LoadLibrary("libDllBuiltFromAda.dll"); if (pDll2 != IntPtr.Zero) { // Note the @4 is because 4 bytes are passed. This can be further reduced by the use of a DEF file in the DLL generation. IntPtr pAddressOfFunctionToCall = GetProcAddress(pDll2, "AdaCallable@4"); if (pAddressOfFunctionToCall != IntPtr.Zero) { fnAdaCallable2 = (AdaCallable2_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(AdaCallable2_dlgt)); } else fail = true; pAddressOfFunctionToCall = GetProcAddress(pDll2, "DllBuiltFromAdainit"); if (pAddressOfFunctionToCall != IntPtr.Zero) { ElaborationInit = (ElaborationInit_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(ElaborationInit_dlgt)); } else fail = true; pAddressOfFunctionToCall = GetProcAddress(pDll2, "DllBuiltFromAdafinal"); if (pAddressOfFunctionToCall != IntPtr.Zero) AdaFinal = (AdaFinal_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(AdaFinal_dlgt)); else fail = true; if (!fail) { ElaborationInit.Invoke(); // ^^^^^^^^^^^^^^^^^^^^^^^^^ FAILS HERE result = fnAdaCallable2(50); Console.WriteLine("Return value is " + result.ToString()); AdaFinal(); } FreeLibrary(pDll2); } } } }

    Read the article

  • How to access controller dynamic properties within a base controller's constructor in Grails?

    - by 4h34d
    Basically, I want to be able to assign objects created within filters to members in a base controller from which every controller extends. Any possible way to do that? Here's how I tried, but haven't got to make it work. What I'm trying to achieve is to have all my controllers extend a base controller. The base controller's constructor would be used to assign values to its members, those values being pulled from the session map. Example below. File grails-app/controllers/HomeController.groovy: class HomeController extends BaseController { def index = { render username } } File grails-app/controllers/BaseController.groovy: abstract class BaseController { public String username public BaseController() { username = session.username } } When running the app, the output shown is: 2010-06-15 18:17:16,671 [main] ERROR [localhost].[/webapp] - Exception sending context initialized event to listener instance of class org.codehaus.groovy.grails.web.context.GrailsContextLoaderListener org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'pluginManager' defined in ServletContext resource [/WEB-INF/applicationContext.xml]: Invocation of init method failed; nested exception is java.lang.RuntimeException: Unable to locate constructor with Class parameter for class org.codehaus.groovy.grails.commons.DefaultGrailsControllerClass ... Caused by: java.lang.RuntimeException: Unable to locate constructor with Class parameter for class org.codehaus.groovy.grails.commons.DefaultGrailsControllerClass ... Caused by: java.lang.reflect.InvocationTargetException ... Caused by: org.codehaus.groovy.grails.exceptions.NewInstanceCreationException: Could not create a new instance of class [com.my.package.controller.HomeController]! ... Caused by: groovy.lang.MissingPropertyException: No such property: session for class: com.my.package.controller.HomeController at com.my.package.controller.BaseController.<init>(BaseController.groovy:16) at com.my.package.controller.HomeController.<init>(HomeController.groovy) ... 2010-06-15 18:17:16,687 [main] ERROR core.StandardContext - Error listenerStart 2010-06-15 18:17:16,687 [main] ERROR core.StandardContext - Context [/webapp] startup failed due to previous errors And the app won't run. This is just an example as in my case I wouldn't want to assign a username to a string value, but rather a few objects pulled from the session map. The objects pulled from the session map are being set within filters. The alternative I see is being able to access the controller's instance within the filter's execution. Is that possible? Please help! Thanks a bunch!

    Read the article

  • JavaFX - question regarding binding button's disabled state

    - by jamiebarrow
    I'm trying to create a dummy application that maintains a list of tasks. For now, all I'm trying to do is add to the list. I enter a task name in a text box, click on the add task button, and expect the list to be updated with the new item and the task name input to be cleared. I only want to be able to add tasks if the task name is not empty. The below code is my implementation, but I have a question regarding the binding. I'm binding the textbox's text variable to a string in my view model, and the button's disable variable to a boolean in my view model. I have a trigger to update the disabled state when the task name changes. When the binding of the task name happens the boolean is updated accordingly, but the button still appears disabled. But then when I mouse over the button, it becomes enabled. I believe this is due to JavaFX 1.3's binding being lazy - only updates the bound variable when it is read. Also, when I've added the task, I clear the task name in the model, but the textbox's text doesn't change - even though I'm using bind with inverse. Is there a way to make the textbox's text and the button's disabled state update automatically via the binding as I was expecting? Thanks, James AddTaskViewModel.fx: package jamiebarrow; import java.lang.System; public class AddTaskViewModel { function logChange(prop:String,oldValue,newValue):Void { println("{System.currentTimeMillis()} : {prop} [{oldValue}] to [{newValue}] "); } public var newTaskName: String on replace old { logChange("newTaskName",old,newTaskName); isAddTaskDisabled = (newTaskName == null or newTaskName.trim().length() == 0); }; public var isAddTaskDisabled: Boolean on replace old { logChange("isAddTaskDisabled",old,isAddTaskDisabled); }; public var taskItems = [] on replace old { logChange("taskItems",old,taskItems); }; public function addTask() { insert newTaskName into taskItems; newTaskName = ""; } } Main.fx: package jamiebarrow; import javafx.scene.control.Button; import javafx.scene.control.TextBox; import javafx.scene.control.ListView; import javafx.scene.Scene; import javafx.scene.layout.VBox; import javafx.stage.Stage; import javafx.scene.layout.HBox; def viewModel = AddTaskViewModel{}; var txtName: TextBox = TextBox { text: bind viewModel.newTaskName with inverse onKeyTyped: onKeyTyped }; function onKeyTyped(event): Void { txtName.commit(); // ensures model is updated cmdAddTask.disable = viewModel.isAddTaskDisabled;// the binding only occurs lazily, so this is needed } var cmdAddTask = Button { text: "Add" disable: bind viewModel.isAddTaskDisabled with inverse action: onAddTask }; function onAddTask(): Void { viewModel.addTask(); } var lstTasks = ListView { items: bind viewModel.taskItems with inverse }; Stage { scene: Scene { content: [ VBox { content: [ HBox { content: [ txtName, cmdAddTask ] }, lstTasks ] } ] } }

    Read the article

  • An AuthLogic form is giving me incorrect validation errors -- why?

    - by sscirrus
    Hi everyone, I set up AuthLogic for Rails according to the AuthLogic example: http://github.com/binarylogic/authlogic_example. I can log on successfully to the system, but when accessing users/new.html.erb to register a new user, the form returns the following validation errors: Email is too short (minimum is 6 characters) Email should look like an email address. Login is too short (minimum is 3 characters) Login should use only letters, numbers, spaces, and .-_@ please. Password is too short (minimum is 4 characters) Password confirmation is too short (minimum is 4 characters) None of these errors exist in the data I am entering. # new.html.erb <%= form.label :login, nil, :class => "label" %><br /> <%= form.text_field :login, :class => "inputBox", :name => "login", :type => "text" %><br /> <%= form.label :password, form.object.new_record? ? nil : "Change password", :class => "label" %><br /> <%= form.password_field :password, :class => "inputBox", :name => "password", :type => "text" %><br /> <%= form.label "Confirm password", nil, :class => "label" %><br /> <%= form.password_field :password_confirmation, :class => "inputBox", :name => "password_confirmation", :type => "text" %><br /> <%= form.label :email, nil, :class => "label" %><br /> <%= form.text_field :email, :class => "inputBox", :name => "email", :type => "text" %><br /> # Users controller def new @user = User.new render :layout => "forms" end I think the problem is that the data isn't being transferred somehow and therefore AuthLogic doesn't think the inputs are sufficient. Do you have any idea why AuthLogic is telling me the data doesn't satisfy its validation?

    Read the article

  • How to check for palindrome using Python logic

    - by DrOnline
    My background is only a 6 month college class in basic C/C++, and I'm trying to convert to Python. I may be talking nonsense, but it seems to me C, at least at my level, is very for-loop intensive. I solve most problems with these loops. And it seems to me the biggest mistake people do when going from C to Python is trying to implement C logic using Python, which makes things run slowly, and it's just not making the most of the language. I see on this website: http://hyperpolyglot.org/scripting (serach for "c-style for", that Python doesn't have C-style for loops. Might be outdated, but I interpret it to mean Python has its own methods for this. I've tried looking around, I can't find much up to date (Python 3) advice for this. How can I solve a palindrome challenge in Python, without using the for loop? I've done this in C in class, but I want to do it in Python, on a personal basis. The problem is from the Euler Project, great site btw. def isPalindrome(n): lst = [int(n) for n in str(n)] l=len(lst) if l==0 || l==1: return True elif len(lst)%2==0: for k in range (l) ##### else: while (k<=((l-1)/2)): if (list[]): ##### for i in range (999, 100, -1): for j in range (999,100, -1): if isPalindrome(i*j): print(i*j) break I'm missing a lot of code here. The five hashes are just reminders for myself. Concrete questions: 1) In C, I would make a for loop comparing index 0 to index max, and then index 0+1 with max-1, until something something. How to best do this in Python? 2) My for loop (in in range (999, 100, -1), is this a bad way to do it in Python? 3) Does anybody have any good advice, or good websites or resources for people in my position? I'm not a programmer, I don't aspire to be one, I just want to learn enough so that when I write my bachelor's degree thesis (electrical engineering), I don't have to simultaneously LEARN an applicable programming language while trying to obtain good results in the project. "How to go from basic C to great application of Python", that sort of thing. 4) Any specific bits of code to make a great solution to this problem would also be appreciated, I need to learn good algorithms.. I am envisioning 3 situations. If the value is zero or single digit, if it is of odd length, and if it is of even length. I was planning to write for loops... PS: The problem is: Find the highest value product of two 3 digit integers that is also a palindrome.

    Read the article

  • Python File Search Line And Return Specific Number of Lines after Match

    - by Simos Anderson
    I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

    Read the article

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • Stop output of image if no record - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Rails Tutorial Chapter 4 2nd Ed. Title Helper not being called with out argument.

    - by SuddenlyAwakened
    I am running through the Rails Tutorial by Michael Hartl (Screen Cast). Ran into the and issue in chapter 4 on the title helper. I have been putting my own twist on the code as I go to make sure I understand it all. However on this one I it is very similar and I am not quite sure why it is acting the way it is. Here is the code: Application.html.erb <!DOCTYPE html> <html> <head> <%- Rails.logger.info("Testing: #{yield(:title)}") %> <title><%= full_title(yield(:title)) %></title> <%= stylesheet_link_tag "application", :media => "all" %> <%= javascript_include_tag "application" %> <%= csrf_meta_tags %> </head> <body> <%= yield %> </body> </html> Application_helper.rb module ApplicationHelper def full_title(page_title) full_title = "Ruby on Rails Tutorial App" full_title += " | #{page_title}" unless page_title.blank? end end Home.html.erb <h1><%= t(:sample_app) %></h1> <p> This is the home page for the <a href="http://railstutorial.org/">Ruby on Rails Tutorial</a> sample application </p> about.html.erb <% provide(:title, t(:about_us)) %> <h1><%= t(:about_us) %></h1> <p> The <a href="http://railstutorial.org/">Ruby on Rails Tutorial</a> is a project to make a book and screencast to teach web development with <a href="http://railstutorial.org/">Ruby on Rails</a>. This is the sample application for the tutorial. </p> What Happens: The code works fine when I set the provide method like on the about page. However when I do not it does not seem to even call the helper. I am assuming that because no title is passed back. Any ideas on what I am doing wrong? Thank you all for your help.

    Read the article

  • Ruby: UnknownAttributeError

    - by Flexo
    Hi i have some Orders that can have several Items and these Items have an associated Kind. The Kind can belong to many Items. but i get a "unknown attribute: kinds" in my OrdersController when i hit the submit form button. I use nested forms btw. Order.rb class Order < ActiveRecord::Base validates_presence_of :ref_nr, :total_price has_many :items, :dependent => :destroy has_many :kinds, :through => :items accepts_nested_attributes_for :items accepts_nested_attributes_for :kinds validates_associated :items validates_associated :kinds end Item.rb class Item < ActiveRecord::Base belongs_to :order has_one :kind accepts_nested_attributes_for :kind validates_associated :kind end Kind.rb class Kind < ActiveRecord::Base belongs_to :item end OrdersController.rb:Create def create @order = Order.new(params[:order]) end new.erb.html <% form_for @order do |f| %> <%= f.error_messages %> <% f.fields_for :items do |builder| %> <table> <tr> <% f.fields_for :kinds do |m| %> <td><%= m.collection_select :kind, Kind.find(:all, :order => "created_at DESC"), :id, :name, {:prompt => "Select a Type" }, {:id => "selector", :onchange => "type_change(this)"} %></td> <% end %> <td><%= f.text_field :amount, :id => "amountField", :onchange => "change_total_price()" %></td> <td><%= f.text_field :text, :id => "textField" %></td> <td><%= f.text_field :price, :class => "priceField", :onChange => "change_total_price()" %></td> <td><%= link_to_remove_fields "Remove Item", f %></td> </tr> </table> <% end %> <p><%= link_to_add_fields "Add Item", f, :items %></p> <p> <%= f.label :total_price %><br /> <%= f.text_field :total_price, :class => "priceField", :id => "totalPrice" %> </p> <p><%= submit_tag %></p> <% end %> i cant see what im missing

    Read the article

  • sequence generators are getting ignored

    - by luvfort
    I'm getting the following error while saving a object. However similar configuration is working for other model objects in my projects. Any help would be greatly appreciated. @Entity @Table(name = "ENROLLMENT_GROUP_MEMBERSHIPS", schema = "LEAD_ROUTING") public class EnrollmentGroupMembership implements Serializable, Comparable,Auditable { @javax.persistence.SequenceGenerator(name = "enrollmentGroupMemID", sequenceName = "S_ENROLLMENT_GROUP_MEMBERSHIPS") @Id @GeneratedValue(strategy = GenerationType.AUTO, generator = "enrollmentGroupMemID") @Column(name = "ID") private Long id; @ManyToOne() @JoinColumn(name = "TIER_WEIGHT_OID", referencedColumnName = "OID", updatable = false, insertable = false) private TierWeight tierWeight; public EnrollmentGroupMembership() { } } Code: @Entity @Table(name = "TIER_WEIGHT", schema = "LEAD_ROUTING") public class TierWeight implements Serializable, Auditable { @SequenceGenerator(name = "tierSequence",sequenceName = "S_TIER_WEIGHT") @Column(name = "OID") @Id @GeneratedValue(strategy = GenerationType.AUTO, generator = "tierSequence") private Long id; @OneToMany @JoinColumn(name = "TIER_WEIGHT_OID", referencedColumnName = "OID") private Set<EnrollmentGroupMembership> memberships; public TierWeight() { } } The logic layer's code is @Override public void createTier(String tierName, float weight) { TierWeight tier = new TierWeight(); tier.setWeight(weight); tier.setTier(tierName); tierWeightDAO.create(tier); } Similar Many-one configuration is working through out the project. I don't know why this one instance is failing. Any help would be greatly appreciated. The following is the error that I'm getting Caused by: org.hibernate.id.IdentifierGenerationException: ids for this class must be manually assigned before calling save(): edu.apollogrp.d2ec.model.TierWeight at org.hibernate.id.Assigned.generate(Assigned.java:3 3) at org.hibernate.event.def.AbstractSaveEventListener. saveWithGeneratedId(AbstractSaveEventListener.java :99) The log file is telling that the sequence generator tierSequence is not getting created. However other sequence generators are getting created. 2010-06-03 11:24:51,834 DEBUG [org.hibernate.cfg.AnnotationBinder:] Processing annotations of edu.apollogrp.d2ec.model.TierWeight.dateCreated 2010-06-03 11:24:51,834 DEBUG [org.hibernate.cfg.AnnotationBinder:] Processing annotations of edu.apollogrp.d2ec.model.TierWeight.dateCreated 2010-06-03 11:24:51,834 DEBUG [org.hibernate.cfg.Ejb3Column:] Binding column DATE_CREATED unique false ....................................... ....................................... 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.AnnotationBinder:] Processing annotations of edu.apollogrp.d2ec.model.CounselorAvailability.id 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.Ejb3Column:] Binding column OID unique false 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.Ejb3Column:] Binding column OID unique false 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.AnnotationBinder:] id is an id 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.AnnotationBinder:] id is an id 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.AnnotationBinder:] Add sequence generator with name: counselorAvailabilityID 2010-06-03 11:24:51,756 DEBUG [org.hibernate.cfg.AnnotationBinder:] Add sequence generator with name: counselorAvailabilityID While debugging, I see that the org.hibernate.impl.SessionFactoryImpl is returning the "Assigned" identifierGenerator. This is horrible. I've specified the identifierGenerator as "Auto". Please see the above code. As a sidenote, I was trying to debug and seeing how the objects are getting retrieved from the database. Looks like the enrollmentgroupmembership records have the tierweight value populated. However if I look at the tierweight object, it doesn't have the enrollmentgroupmembership records. I'm puzzled. I think these two problems must be related. Maddy.

    Read the article

  • Hibernate MappingException Unknown entity: $Proxy2

    - by slynn1324
    I'm using Hibernate annotations and have a VERY basic data object: import java.io.Serializable; import javax.persistence.Entity; import javax.persistence.Id; @Entity public class State implements Serializable { /** * */ private static final long serialVersionUID = 1L; @Id private String stateCode; private String stateFullName; public String getStateCode() { return stateCode; } public void setStateCode(String stateCode) { this.stateCode = stateCode; } public String getStateFullName() { return stateFullName; } public void setStateFullName(String stateFullName) { this.stateFullName = stateFullName; } } and am trying to run the following test case: public void testCreateState(){ Session s = HibernateUtil.getSessionFactory().getCurrentSession(); Transaction t = s.beginTransaction(); State state = new State(); state.setStateCode("NE"); state.setStateFullName("Nebraska"); s.save(s); t.commit(); } and get an org.hibernate.MappingException: Unknown entity: $Proxy2 at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.event.def.AbstractSaveEventListener.saveWithGeneratedId(AbstractSaveEventListener.java:121) .... I haven't been able to find anything referencing the $Proxy part of the error - and am at a loss.. Any pointers to what I'm missing would be greatly appreciated. hibernate.cfg.xml <property name="hibernate.connection.driver_class">org.hsqldb.jdbcDriver</property> <property name="connection.url">jdbc:hsqldb:hsql://localhost/xdb</property> <property name="connection.username">sa</property> <property name="connection.password"></property> <property name="current_session_context_class">thread</property> <property name="dialect">org.hibernate.dialect.HSQLDialect</property> <property name="show_sql">true</property> <property name="hbm2ddl.auto">update</property> <property name="hibernate.transaction.factory_class">org.hibernate.transaction.JDBCTransactionFactory</property> <mapping class="com.test.domain.State"/> in HibernateUtil.java public static SessionFactory getSessionFactory(boolean testing ) { if ( sessionFactory == null ){ try { String configPath = HIBERNATE_CFG; AnnotationConfiguration config = new AnnotationConfiguration(); config.configure(configPath); sessionFactory = config.buildSessionFactory(); } catch (Exception e){ e.printStackTrace(); throw new ExceptionInInitializerError(e); } } return sessionFactory; }

    Read the article

  • Rails, Edit page update in a window

    - by Mike
    I have my code working so that I have a table of businesses. There's a pencil icon you can click on the edit the business information. The edit information comes up in a partial inside of a modal pop up box. The only problem is that once they make the changes they want and click update, it sends them to the 'show' page for that business. What I want to happen is have the pop up box close and have it update the information. This is my update function in my controller. def update @business = Business.find(params[:id]) respond_to do |format| if @business.update_attributes(params[:business]) flash[:notice] = 'Business was successfully updated.' format.html { redirect_to(business_url(@business)) } format.js else format.html { render :action => "edit" } format.xml { render :xml => @business.errors, :status => :unprocessable_entity } end end end I tried following railscast 43 and i created an .rjs file but I couldn't get that to work at all. My update was still taking me to the show page. Any help would be appreciated. EDIT: Added some more code. <% form_for(@business) do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= f.text_field :name %> </p> ... <%= f.label :business_category %><br /> <%= f.select :business_category_id, @business_categories_map, :selected => @business.business_category_id %> </p> <p> <%= f.label :description %><br /> <%= f.text_area :description %> </p> <p> <%= f.submit 'Update' %> </p> <% end %> This is my form inside of my edit page which is being called through the index in a pop up by: <div id="popupEdit<%=h business.id %>" class="popupContact"> <a class="popupClose<%=h business.id %>" id="popupClose">x</a> <% if business.business_category_id %> <% @business = business %> <%= render "business/edit" %> <% end %> </div>

    Read the article

  • Rails 3 Atom Feed

    - by scud bomb
    Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Using JSON Data to Populate a Google Map with Database Objects

    - by MikeH
    I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

    Read the article

  • Nested attributes form for model which belongs_to few models

    - by ExiRe
    I have few models - User, Teacher and TeacherLeader. class User < ActiveRecord::Base attr_accessible ..., :teacher_attributes has_one :teacher has_one :teacher_leader accepts_nested_attributes_for :teacher_leader end class Teacher < ActiveRecord::Base belongs_to :user has_one :teacher_leader end class TeacherLeader < ActiveRecord::Base belongs_to :user belongs_to :teacher end I would like to fill TeacherLeader via nested attributes. So, i do such things in controller: class TeacherLeadersController < ApplicationController ... def new @user = User.new @teacher_leader = @user.build_teacher_leader @teachers_collection = Teacher.all.collect do |t| [ "#{t.teacher_last_name} #{t.teacher_first_name} #{t.teacher_middle_name}", t.id ] end @choosen_teacher = @teachers_collection.first.last unless @teachers_collection.empty? end end And also have such view (new.html.erb): <%= form_for @user, :url => teacher_leaders_url, :html => {:class => "form-horizontal"} do |f| %> <%= field_set_tag do %> <% f.fields_for :teacher_leader do |tl| %> <div class="control-group"> <%= tl.label :teacher_id, "Teacher names", :class => "control-label" %> <div class="controls"> <%= select_tag( :teacher_id, options_for_select( @teachers_collection, @choosen_teacher )) %> </div> </div> <% end %> <div class="control-group"> <%= f.label :user_login, "Login", :class => "control-label" %> <div class="controls"> <%= f.text_field :user_login, :placeholder => @everpresent_field_placeholder %> </div> </div> <div class="control-group"> <%= f.label :password, "Pass", :class => "control-label" %> <div class="controls"> <%= f.text_field :password, :placeholder => @everpresent_field_placeholder %> </div> </div> <% end %> <%= f.submit "Create", :class => "btn btn-large btn-success" %> <% end %> Problem is that select form here does NOT appear. Why? Do i do something wrong?

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • validate uniqueness amongst multiple subclasses with Single Table Inheritance

    - by irkenInvader
    I have a Card model that has many Sets and a Set model that has many Cards through a Membership model: class Card < ActiveRecord::Base has_many :memberships has_many :sets, :through => :memberships end class Membership < ActiveRecord::Base belongs_to :card belongs_to :set validates_uniqueness_of :card_id, :scope => :set_id end class Set < ActiveRecord::Base has_many :memberships has_many :cards, :through => :memberships validates_presence_of :cards end I also have some sub-classes of the above using Single Table Inheritance: class FooCard < Card end class BarCard < Card end and class Expansion < Set end class GameSet < Set validates_size_of :cards, :is => 10 end All of the above is working as I intend. What I'm trying to figure out is how to validate that a Card can only belong to a single Expansion. I want the following to be invalid: some_cards = FooCard.all( :limit => 25 ) first_expansion = Expansion.new second_expansion = Expansion.new first_expansion.cards = some_cards second_expansion.cards = some_cards first_expansion.save # Valid second_expansion.save # **Should be invalid** However, GameSets should allow this behavior: other_cards = FooCard.all( :limit => 10 ) first_set = GameSet.new second_set = GameSet.new first_set.cards = other_cards # Valid second_set.cards = other_cards # Also valid I'm guessing that a validates_uniqueness_of call is needed somewhere, but I'm not sure where to put it. Any suggestions? UPDATE 1 I modified the Expansion class as sugested: class Expansion < Set validate :validates_uniqueness_of_cards def validates_uniqueness_of_cards membership = Membership.find( :first, :include => :set, :conditions => [ "card_id IN (?) AND sets.type = ?", self.cards.map(&:id), "Expansion" ] ) errors.add_to_base("a Card can only belong to a single Expansion") unless membership.nil? end end This works when creating initial expansions to validate that no current expansions contain the cards. However, this (falsely) invalidates future updates to the expansion with new cards. In other words: old_exp = Expansion.find(1) old_exp.card_ids # returns [1,2,3,4,5] new_exp = Expansion.new new_exp.card_ids = [6,7,8,9,10] new_exp.save # returns true new_exp.card_ids << [11,12] # no other Expansion contains these cards new_exp.valid? # returns false ... SHOULD be true

    Read the article

  • Dynamically loading modules in Python (+ threading question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new thread, so that the code runs in a separate thread. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the threads. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do?

    Read the article

  • Multiple layouts in rails [Newbie Q]

    - by BriteLite
    Hi. As a newb, I decided to build a "home inventory" application. I am now stuck on how to programmatically select a layout based on what type of item it is when viewing it in a browser. According to my planning, so far I should have created a few models to represent types of items I can find in my home: Furniture, Electronics and Books. class Book < ActiveRecord::Base end class Furniture < ActiveRecord::Base end class Electronic < ActiveRecord::Base end Now the Books model has things like isbn, pages, address, and category. Furniture model has things like color, price, address, and category. Electronics has things like name, voltage, address, and category. Here is where I got confused. I know the property address is going to be the same for all of them. I also know that, I will need to create multiple "layouts" for 3 different types of items to show the different properties of said items with appropriate graphics and stylesheets. But how will I go about deciding which category the item is so I can determine which layout to render. According to me, this is how I will do it: class DisplayController < ApplicationController def display @item = Params[:item] if @item.category = "electronics" render :layout => 'electronics' end end In my routes.rb map.display ':item', :controller => 'display', :action => 'display' I only seem to have one concern with this, I probably will add a lot of categories later on and think there should be a more DRY-esque way of dealing, rather than hardcoding them. I understand that I need to add into my layout html tags to display relevant information for that particular category. ----Questions---- Is this the right way to approach this type of problem. Will this approach be compatible when I decide to add a gem like *thinking_sphinx* to run search. What issues do you see with my approach and how can I make it better. I was reading something about "Polymorphic Assoc", does that apply in this case, since category exist for all items? Also, I was trying to get a routes to render a URL like "http://localhost/living-room-tv"

    Read the article

  • User authentication in Django. Problems with is_authenticated

    - by tim
    I have one problem with users menu. So, I want, that authenticated user can see his/her profile page and logout (links) in menu. It works (when I logging in) on index page: index, page1, profile, logout ,but, if I go to the, for example, page1 I can see in menu: index, page1, login, not profile and logout. How to fix it? in urls: url(r'^accounts/login/$', 'django.contrib.auth.views.login' ), url(r'^accounts/logout/$', 'django.contrib.auth.views.logout_then_login' ), url(r'^accounts/profile/$', 'my_app.views.profile' ), in views: def profile(request): if not request.user.is_authenticated(): return HttpResponseRedirect("/accounts/login/") else: user = request.user.is_authenticated() return render_to_response('profile.html',locals()) Part of index.html: {% if user.is_authenticated or request.user.is_authenticated %} <li><a href="/accounts/profile/">Profile</a></li> <li><a href="/accounts/logout/">logout</a></li> {% else %} <li><a href="/accounts/login/">login</a></li> {% endif %} login.html: {% extends "index.html" %} {% load url from future %} {% block application %} {% if form.errors %} <p>Try one more time</p> {% endif %} <form method="post" action="{% url 'django.contrib.auth.views.login' %}"> {% csrf_token %} <table> <tr> <td>{{ form.username.label_tag }}</td> <td>{{ form.username }}</td> </tr> <tr> <td>{{ form.password.label_tag }}</td> <td>{{ form.password }}</td> </tr> </table> <input type="submit" value="Login" /> <input type="hidden" name="next" value="{{ next }}" /> </form> {% endblock %} profile.html: {% extends "index.html" %} {% block application %} {% if request.user.is_authenticated %} <p>Welcome, {{ request.user.username }}. Thanks for logging in.</p> {% else %} <p>Welcome, new user. Please log in.</p> {% endif %} {% endblock %}

    Read the article

  • Python: (sampling with replacement): efficient algorithm to extract the set of UNIQUE N-tuples from a set

    - by Homunculus Reticulli
    I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199  | Next Page >