Search Results

Search found 10883 results on 436 pages for 'ms expression'.

Page 195/436 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • Comparing 2 linq applications: Unexpected result

    - by lukesky
    I drafted 2 ASP.NET applications using LINQ. One connects to MS SQL Server, another to some proprietary memory structure. Both applications work with tables of 3 int fields, having 500 000 records (the memory structure is identical to SQL Server table). The controls used are regular: GridView and ObjectDataSource. In the applications I calculate the average time needed for each paging click processing. LINQ + MS SQL application demands 0.1 sec per page change. LINQ + Memory Structure demands 0.8 sec per page change. This Is shocking result. Why the application handling data in memory works 8 times slower than the application using hard drive? Can anybody tell me why that happens?

    Read the article

  • How to create an image from a 2-dimensional byte array?

    - by Manoj
    Hi all, In my project after long process, i got a 2 dimensional byte array from the IR camera. The byte array holds image in it... How to convert that byte array to image in C#.. I know that by MemoryStream ms = new MemoryStream(byteArray); System.drawing.Image im = Image.FromStream(ms); We can pass 1 dimensional array and convert it into image.. If i pass 2 dimensional array as a single dimensional array.. it shows error.. How to rectify it..???? or else how to convert 2 dimensional byte array to image...??? Thank you!!

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • Map wont show rigth in Joomla

    - by user1653126
    I have the following code of a map using api google, I have tested the code in several html editor and its work perfectly, but when i upload in my web page doesn’t work. The map appears all zoomed in some random point in the ocean. I create an article in Joomla 1.5.20, paste the code. Its shows right in the preview but not in the web page. I disable filtering and use none editor and still won’t work. Thanks for the help. <!DOCTYPE html> <html> <head> <meta name="viewport" content="initial-scale=1.0, user-scalable=no" /> <style type="text/css"> html { height: 100% } body { height: 100%; margin: 0; padding: 0 } #map_canvas { height: 100% } </style> <script type="text/javascript" src="http://maps.googleapis.com/maps/api/js?key=AIzaSyBInlv7FuwtKGhzBP0oISDoB2Iu79HNrPU&sensor=false"> </script> <script type="text/javascript"> var map; // lets define some vars to make things easier later var kml = { a: { name: "Productor", url: "https://maps.google.hn/maps/ms?authuser=0&vps=2&hl=es&ie=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c934a224eca7c3ad4" }, b: { name: "A&S", url: "https://maps.google.hn/maps/ms?ie=UTF8&authuser=0&msa=0&output=kml&msid=200984447026903306654.0004c94bac74cf2304c71" } // keep adding more if ye like }; // initialize our goo function initializeMap() { var options = { center: new google.maps.LatLng(13.324182,-87.080071), zoom: 9, mapTypeId: google.maps.MapTypeId.TERRAIN } map = new google.maps.Map(document.getElementById("map_canvas"), options); var ctaLayer = new google.maps.KmlLayer('https://maps.google.hn/maps/ms?authuser=0&vps=5&hl=es&ie=UTF8&oe=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c94bc3bce6f638aa1'); ctaLayer.setMap(map); var ctaLayer = new google.maps.KmlLayer('https://maps.google.hn/maps/ms?authuser=0&vps=2&ie=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c94ec7e838242b67d'); ctaLayer.setMap(map); createTogglers(); }; google.maps.event.addDomListener(window, 'load', initializeMap); // the important function... kml[id].xxxxx refers back to the top function toggleKML(checked, id) { if (checked) { var layer = new google.maps.KmlLayer(kml[id].url, { preserveViewport: true, suppressInfoWindows: true }); google.maps.event.addListener(layer, 'click', function(kmlEvent) { var text = kmlEvent.featureData.description; showInContentWindow(text); }); function showInContentWindow(text) { var sidediv = document.getElementById('content_window'); sidediv.innerHTML = text; } // store kml as obj kml[id].obj = layer; kml[id].obj.setMap(map); } else { kml[id].obj.setMap(null); delete kml[id].obj; } }; // create the controls dynamically because it's easier, really function createTogglers() { var html = "<form><ul>"; for (var prop in kml) { html += "<li id=\"selector-" + prop + "\"><input type='checkbox' id='" + prop + "'" + " onclick='highlight(this,\"selector-" + prop + "\"); toggleKML(this.checked, this.id)' \/>" + kml[prop].name + "<\/li>"; } html += "<li class='control'><a href='#' onclick='removeAll();return false;'>" + "Limpiar el Mapa<\/a><\/li>" + "<\/ul><\/form>"; document.getElementById("toggle_box").innerHTML = html; }; // easy way to remove all objects function removeAll() { for (var prop in kml) { if (kml[prop].obj) { kml[prop].obj.setMap(null); delete kml[prop].obj; } } }; // Append Class on Select function highlight(box, listitem) { var selected = 'selected'; var normal = 'normal'; document.getElementById(listitem).className = (box.checked ? selected: normal); }; </script> <style type="text/css"> .selected { font-weight: bold; } </style> </head> <body> <div id="map_canvas" style="width: 80%; height: 400px; float:left"></div> <div id="toggle_box" style="position: absolute; top: 100px; right: 640px; padding: 10px; background: #fff; z-index: 5; "></div> <div id="content_window" style="width:10%; height:10%; float:left"></div> </body> </html>

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • Do you know any build systems with decent support for parallelization?

    - by dahpgjgamgan
    Hi, I am looking for a build system (working on ms windows) that has good support for parallelization of tasks/targets (or whatever you call them). To be more specific - during build (that is initiated on MS Windows machine) I need to copy source files to a number of different machines (which are not necessarily running Windows) and start a remote job on each of them - and I really like to do that on all machines at once. Does anyone know a build system that's capable of executing such a task in parallel. From what I googled, the options currently available are: -j switch in make - but i don't know if nmake supports this -some custom nAnt tasks -msbuild has some form of support for parallelization - seems similiar to make (meaning you don't specify what to do in parallel, just specify that it would be nice to build things that way) -fake (f# make) is written in functional programming language which are known to have good parallelization support - but I'm not very skillful in functional programming area. Any other solutions I could explore?

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • How exactly can Python compliment your C# skills for windows based development?

    - by JL
    I'm looking for a fun challenge, and am thinking about learning Python. I've heard really good things about the language. My question is, how (if at all) can Python compliment the skills of a typical C# developer working mainly with MS technologies on a Windows Platform. Some examples of typical C# dev on windows would be (SOA applications, web applications, windows services, automation, xml handling) Surely there must be some scenarios where knowing Python would help you get certain tasks done quicker or more efficiently than using traditional C# / MS technologies. If you know of any specific scenarios, then please share. And lastly should this question be a community wiki?

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • Performance optimization for mssql: decrease stored procedures execution time or unload the server?

    - by tim
    Hello everybody! We have a web service which provides search over hotels. There is a problem with performance: a single request to the service takes around 5000 ms. Almost all of the time is spent in database by executing storing procedures. During the request our server (mssql2008) consumes ~90% of the processor time. When 2 requests are made in parallel the average time grows and is around 7000 ms. When number of request is increasing, the average time of response is increasing as well. We have 20-30 requests per minute. Which kind of optimization is the best in this case having in mind that the goal is to provide stable response time for the service: 1) Try to decrease the stored procedures execution time 2) Try to find the way how to unload the server It is interesting to hear from people who deal with booking sites. Thanks!

    Read the article

  • partially connected application using asp.net 3.5 (not mobile apps)

    - by Hari
    We had a requirement to build a ASP.NET 3.5 web application using web forms, WCF, ADO.NET and SQL Server. The users would connect via Internet. Recently we understood that it is possible that users would often remain disconnected and would have Internet access intermittently. I need to understand if we can create occasionally connected web application using asp.net 3.5 - what all technologies/features we need to use? Is MS Sync Framework the answer to the problem - is it a viable option to use with web application? Is windows application the right approach instead of web applications - where the business logic would be run at the client itself, using local SQL Express editions with data then been synced up with Enterprise SQL server at server end when connection is established using replication and/or MS Sync framework. In that case is there a need to use WCF? Does Silverlight applications help in this context -building paritally connected web apps? Really appreciate if you can give pointers to how to go about this task of creating .net partially connected apps (not mobile apps)?

    Read the article

  • Open another application from your own (intent)

    - by AndersWid
    I know how to update my own programs, and I know how to open programs using the a predefined Uri (for sms or email for example) I need to know how I can create an Intent to open MyTracks or any other application that I don't know what intents they listen to. I got this info from DDMS, but I havn't been succesful in turning this to an Intent I can use. This is taken from when opening MyTracks manually. Thanks for your help 05-06 11:22:24.945: INFO/ActivityManager(76): Starting activity: Intent { act=android.intent.action.MAIN cat=[android.intent.category.LAUNCHER] flg=0x10200000 cmp=com.google.android.maps.mytracks/com.google.android.apps.mytracks.MyTracks bnds=[243,338][317,417] } 05-06 11:22:25.005: INFO/ActivityManager(76): Start proc com.google.android.maps.mytracks for activity com.google.android.maps.mytracks/com.google.android.apps.mytracks.MyTracks: pid=1176 uid=10063 gids={3003, 1015} 05-06 11:22:26.995: INFO/ActivityManager(76): Displayed activity com.google.android.maps.mytracks/com.google.android.apps.mytracks.MyTracks: 1996 ms (total 1996 ms)

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >