Search Results

Search found 21748 results on 870 pages for 'search engine optimizatio'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 195/870 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • How do I use .htaccess conditional redirects for multiple domains?

    - by John
    I'm managing about 15 or so domains for a particular promotion. Each domain has specific redirects in place, as shown below. Rather than make 15 different .htaccess files that I would later have to manage separately, I'd like to use a single .htaccess file and use a symbolic link into each website's directory. The trouble is that, I can't figure out how to make the rules apply only for a specific domain. Every time I visit www.redirectsite2.com, it sends me to www.targetsite.com/search.html?state=PA&id=75, when it should instead be sending me to www.targetsite.com/search.html?state=NJ&id=68. How exactly do I make multiple RewriteRules apply for a given domain and only that domain? Is this even possible to do within a single .htaccess file? Options +FollowSymlinks # redirectsite1.com RewriteEngine On RewriteBase / # start processing rules for www.redirectsite1.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite1\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,L] RewriteRule ^PGN$ http://targetsite.com/search.html?state=PA&id=26 [QSA,R,NC,L] RewriteRule ^NS$ http://targetsite.com/search.html?state=PA&id=27 [QSA,R,NC,L] RewriteRule ^INQ$ http://targetsite.com/search.html?state=PA&id=28 [QSA,R,NC,L] RewriteRule ^AA$ http://targetsite.com/search.html?state=PA&id=29 [QSA,R,NC,L] RewriteRule ^PI$ http://targetsite.com/search.html?state=PA&id=30 [QSA,R,NC,L] RewriteRule ^GV$ http://targetsite.com/search.html?state=PA&id=31 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,NC,L] # end processing rules for www.redirectsite1.com # begin rules for redirectsite2.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite2\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,L] RewriteRule ^SL$ http://targetsite.com/search.html?state=NJ&id=6 [QSA,R,NC,L] RewriteRule ^APP$ http://targetsite.com/search.html?state=NJ&id=8 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,NC,L] Thanks for any help you may be able to provide!

    Read the article

  • Unexpected result in C algebra for search algorithm.

    - by Rhys
    Hi, I've implemented this search algorithm for an ordered array of integers. It works fine for the first data set I feed it (500 integers), but fails on longer searches. However, all of the sets work perfectly with the other four search algorithms I've implemented for the assignment. This is the function that returns a seg fault on line 178 (due to an unexpected negative m value). Any help would be greatly appreciated. CODE: 155 /* perform Algortihm 'InterPolationSearch' on the set 156 * and if 'key' is found in the set return it's index 157 * otherwise return -1 */ 158 int 159 interpolation_search(int *set, int len, int key) 160 { 161 int l = 0; 162 int r = len - 1; 163 int m; 164 165 while (set[l] < key && set[r] >= key) 166 { 167 168 printf ("m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l])\n"); 169 170 printf ("m = %d + ((%d - %d) * (%d - %d)) / (%d - %d);\n", l, key, set[l], r, l, set[r], set[l]); 171 m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]); 172 printf ("m = %d\n", m); 173 174 #ifdef COUNT_COMPARES 175 g_compares++; 176 #endif 177 178 if (set[m] < key) 179 l = m + 1; 180 else if (set[m] > key) 181 r = m - 1; 182 else 183 return m; 184 } 185 186 if (set[l] == key) 187 return l; 188 else 189 return -1; 190 } OUTPUT: m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]) m = 0 + ((68816 - 0) * (100000 - 0)) / (114836 - 0); m = -14876 Thankyou! Rhys

    Read the article

  • How do I do an exact whois search?

    - by brianegge
    When I execute the following whois command on my Ubuntu server, I get all sorts of other domains which contain google.com in the name, but clearly aren't owned by google. As this appears to be some sort of spam, I won't paste the output here. I'd like to check for exactly the name I typed in. I thought the following would work, but it doesn't. What is the proper way to do an exact match? whois -Hx google.com

    Read the article

  • How to use the Rhino javascript engine in an applet

    - by Robber
    For my java program I'm using Rhino to execute JS scripts. Now I'm trying to convert it to an applet which works great, except that everytime it's calling evaluateString(...) the JVM throws an AccessControlException. After some (a lot) of research I found out that this is caused by Rhino's custom classloader. My problem is that after hours of googling I still can't find a way to stop Rhino from trying to load it's own classloader. I hope someone can help me...

    Read the article

  • search data from FileReader in Java

    - by maya
    hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • monit syntax error : "if 5 restarts within 5 cycles then alert"

    - by omry
    I am trying to get an alert from monit if it fails to restart a service 5 times, but I get a syntax error /etc/monit/monit.d/engine.conf:5: Error: syntax error 'alert' this is the engine.conf file: check process engine with pidfile /var/run/engine.pid group engine start program = "/etc/init.d/engine start" stop program = "/etc/init.d/engine stop" if 5 restarts within 5 cycles then alert any idea what's wrong with it?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • With sqlalchemy how to dynamically bind to database engine on a per-request basis

    - by Peter Hansen
    I have a Pylons-based web application which connects via Sqlalchemy (v0.5) to a Postgres database. For security, rather than follow the typical pattern of simple web apps (as seen in just about all tutorials), I'm not using a generic Postgres user (e.g. "webapp") but am requiring that users enter their own Postgres userid and password, and am using that to establish the connection. That means we get the full benefit of Postgres security. Complicating things still further, there are two separate databases to connect to. Although they're currently in the same Postgres cluster, they need to be able to move to separate hosts at a later date. We're using sqlalchemy's declarative package, though I can't see that this has any bearing on the matter. Most examples of sqlalchemy show trivial approaches such as setting up the Metadata once, at application startup, with a generic database userid and password, which is used through the web application. This is usually done with Metadata.bind = create_engine(), sometimes even at module-level in the database model files. My question is, how can we defer establishing the connections until the user has logged in, and then (of course) re-use those connections, or re-establish them using the same credentials, for each subsequent request. We have this working -- we think -- but I'm not only not certain of the safety of it, I also think it looks incredibly heavy-weight for the situation. Inside the __call__ method of the BaseController we retrieve the userid and password from the web session, call sqlalchemy create_engine() once for each database, then call a routine which calls Session.bind_mapper() repeatedly, once for each table that may be referenced on each of those connections, even though any given request usually references only one or two tables. It looks something like this: # in lib/base.py on the BaseController class def __call__(self, environ, start_response): # note: web session contains {'username': XXX, 'password': YYY} url1 = 'postgres://%(username)s:%(password)s@server1/finance' % session url2 = 'postgres://%(username)s:%(password)s@server2/staff' % session finance = create_engine(url1) staff = create_engine(url2) db_configure(staff, finance) # see below ... etc # in another file Session = scoped_session(sessionmaker()) def db_configure(staff, finance): s = Session() from db.finance import Employee, Customer, Invoice for c in [ Employee, Customer, Invoice, ]: s.bind_mapper(c, finance) from db.staff import Project, Hour for c in [ Project, Hour, ]: s.bind_mapper(c, staff) s.close() # prevents leaking connections between sessions? So the create_engine() calls occur on every request... I can see that being needed, and the Connection Pool probably caches them and does things sensibly. But calling Session.bind_mapper() once for each table, on every request? Seems like there has to be a better way. Obviously, since a desire for strong security underlies all this, we don't want any chance that a connection established for a high-security user will inadvertently be used in a later request by a low-security user.

    Read the article

  • Rails - Clearance engine - installation issue

    - by Elliot
    Hey Everyone, The installation for clearance seems very straight forward (http://wiki.github.com/thoughtbot/clearance/installation). I'm following in the instructions, although I'm getting an error almost immediately. On the the fifth step "rake db:migrate" I get the following error: rake aborted! undefined method `configure' for Clearance:Module I have no idea what I should be doing differently? Thanks in advance! -Elliot

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • Java wiki engine

    - by Mite Mitreski
    There are plenty of java wiki engines http://java-source.net/open-source/wiki-engines I'm currently looking for good lightweight wiki , something like the community wiki on stackoverflow , that can be easily integrated into excising applications. Please write about something that you have used.

    Read the article

  • Best .NET blog engine

    - by James Newton-King
    I am thinking about switching my blog away from Community Server to something that is simpler and focuses more on just being a good blog. What are the different .NET blogging engines and which one do you recommend?

    Read the article

  • Search for index.php and index.html and replace string

    - by Jonas
    Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • Java Scripting Engine importing my classes does not work

    - by Ayman
    A code is worth 1000 words of explaining it :-) package jasim; import javax.script.ScriptEngine; import javax.script.ScriptEngineManager; import javax.script.ScriptException; public class JSTest { public static void main(String[] args) throws ScriptException { ScriptEngine jse = new ScriptEngineManager().getEngineByExtension("js"); jse.eval("println(new jasim.JSTest().toString)"); } @Override public String toString() { return "JSTest Object"; } } This code will fail with the below exception: Exception in thread "main" javax.script.ScriptException: sun.org.mozilla.javascript.internal.EcmaError: ReferenceError: "jasim" is not defined. (<Unknown source>#1) in <Unknown source> at line number 1 How do I import my own classes into the ScriptEngine?

    Read the article

  • Content search through source code in finder

    - by gf
    I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

    Read the article

  • php scandir --> search for files/directories

    - by Peter
    Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

    Read the article

  • Java Google App Engine inconsistent data lose after restarting dev server

    - by user259349
    Hello everyone, I am using Java GAE. So far, i'm just scafolding my data objects and i'm seeing an interesting issue. The records that i am playing around with are getting updated properly as long as my dev server is running up. The second that the my dev server gets restarted, i lose all of my changes. That would be not alarming if i lost all of my records, but, there was a point of time where my data persisted through the server restart. I'm worried that i would lose production data if i launched without fixing this potential bugs? ANy idea on wher ei should look?

    Read the article

  • Maven building for GoogleAppEngine, forced to include JDO libraries?

    - by James.Elsey
    Hi, I'm trying to build my application for GoogleAppEngine using maven. I've added the following to my pom which should "enhance" my classes after building, as suggested on the DataNucleus documentation <plugin> <groupId>org.datanucleus</groupId> <artifactId>maven-datanucleus-plugin</artifactId> <version>1.1.4</version> <configuration> <log4jConfiguration>${basedir}/log4j.properties</log4jConfiguration> <verbose>true</verbose> </configuration> <executions> <execution> <phase>process-classes</phase> <goals> <goal>enhance</goal> </goals> </execution> </executions> </plugin> According to the documentation on GoogleAppEngine, you have the choice to use JDO or JPA, I've chosen to use JPA since I have used it in the past. When I try to build my project (before I upload to GAE) using mvn clean package I get the following output [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] Failed to resolve artifact. Missing: ---------- 1) javax.jdo:jdo2-api:jar:2.3-ec Try downloading the file manually from the project website. Then, install it using the command: mvn install:install-file -DgroupId=javax.jdo -DartifactId=jdo2-api -Dversion=2.3-ec -Dpackaging=jar -Dfile=/path/to/file Alternatively, if you host your own repository you can deploy the file there: mvn deploy:deploy-file -DgroupId=javax.jdo -DartifactId=jdo2-api -Dversion=2.3-ec -Dpackaging=jar -Dfile=/path/to/file -Durl=[url] -DrepositoryId=[id] Path to dependency: 1) org.datanucleus:maven-datanucleus-plugin:maven-plugin:1.1.4 2) javax.jdo:jdo2-api:jar:2.3-ec ---------- 1 required artifact is missing. for artifact: org.datanucleus:maven-datanucleus-plugin:maven-plugin:1.1.4 from the specified remote repositories: __jpp_repo__ (file:///usr/share/maven2/repository), DN_M2_Repo (http://www.datanucleus.org/downloads/maven2/), central (http://repo1.maven.org/maven2) [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: 3 seconds [INFO] Finished at: Sat Apr 03 16:02:39 BST 2010 [INFO] Final Memory: 31M/258M [INFO] ------------------------------------------------------------------------ Any ideas why I should get such an error? I've searched through my entire source code and I'm not referencing JDO anywhere, so unless the app engine libraries require it, I'm not sure why I get this message.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >