Search Results

Search found 6172 results on 247 pages for 'limit choices to'.

Page 196/247 | < Previous Page | 192 193 194 195 196 197 198 199 200 201 202 203  | Next Page >

  • Can this Query be corrected or different table structure needed? (database dumps provided)

    - by sandeepan
    This is a bit lengthy but I have provided sufficient details and kept things very clear. Please see if you can help. (I will surely accept answer if it solves my problem) I am sure a person experienced with this can surely help or suggest me to decide the tables structure. About the system:- There are tutors who create classes A tags based search approach is being followed Tag relations are created/edited when new tutors registers/edits profile data and when tutors create classes (this makes tutors and classes searcheable).For simplicity, let us consider only tutor name and class name are the fields which are matched against search keywords. In this example, I am considering - tutor "Sandeepan Nath" has created a class called "first class" tutor "Bob Cratchit" has created a class called "new class" Desired search results- AND logic to be appied on the search keywords and match against class and tutor data(class name + tutor name), in other words, All those classes be shown such that all the search terms are present in the class name or its tutor name. Example to be clear - Searching "first class" returns class with id_wc = 1. Working Searching "Sandeepan class" should also return class with id_wc = 1. Not working in System 2. Problem with profile editing and searching To tell in one sentence, I am facing a conflict between the ease of profile edition (edition of tag relations when tutor profiles are edited) and the ease of search logic. In the beginning, we had one table structure and search was easy but tag edition logic was very clumsy and unmaintainable(Check System 1 in the section below) . So we created separate tag relations tables to make profile edition simpler but search has become difficult. Please dump the tables so that you can run the search query I have given below and see the results. System 1 (previous system - search easy - profile edition difficult):- Only one table called All_Tag_Relations table had the all the tag relations. The tags table below is common to both systems 1 and 2. CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 1, 1, 1), (4, 2, 1, 1), (5, 3, 1, 1), (6, 4, 1, 1), (7, 6, 2, NULL), (8, 7, 2, NULL), (9, 6, 2, 2), (10, 7, 2, 2), (11, 5, 2, 2), (12, 4, 2, 2); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=8 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'); Please note that for every class, the tag rels of its tutor have to be duplicated. Example, for class with id_wc=1, the tag rel records with id_tag_rel = 3 and 4 are actually extras if you compare with the tag rel records with id_tag_rel = 1 and 2. System 2 (present system - profile edition easy, search difficult) Two separate tables Tutors_Tag_Relations and Webclasses_Tag_Relations have the corresponding tag relations data (Please dump into a separate database)- CREATE TABLE IF NOT EXISTS `tutors_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `tutors_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`) VALUES (1, 1, 1), (2, 2, 1), (3, 6, 2), (4, 7, 2); CREATE TABLE IF NOT EXISTS `webclasses_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `webclasses_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `webclasses_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 3, 1, 1), (2, 4, 1, 1), (3, 5, 2, 2), (4, 4, 2, 2); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=8 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'); CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; insert into All_Tag_Relations select NULL,id_tag,id_tutor,NULL from Tutors_Tag_Relations; insert into All_Tag_Relations select NULL,id_tag,id_tutor,id_wc from Webclasses_Tag_Relations; Here you can see how easily tutor first name can be edited only in one place. But search has become really difficult, so on being advised to use a Temporary table, I am creating one at every search request, then dumping all the necessary data and then searching from it, I am creating this All_Tag_Relations table at search run time. Here I am just dumping all the data from the two tables Tutors_Tag_Relations and Webclasses_Tag_Relations. But, I am still not able to get classes if I search with tutor name This is the query which searches "first class". Running them on both the systems shows correct results (returns the class with id_wc = 1). SELECT wtagrels.id_wc,SUM(DISTINCT( wtagrels.id_tag =3)) AS key_1_total_matches, SUM(DISTINCT( wtagrels.id_tag =4)) AS key_2_total_matches FROM all_tag_relations AS wtagrels WHERE ( wtagrels.id_tag =3 OR wtagrels.id_tag =4 ) GROUP BY wtagrels.id_wc HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 LIMIT 0, 20 But, searching for "Sandeepan class" works only with the 1st system Here is the query which searches "Sandeepan class" SELECT wtagrels.id_wc,SUM(DISTINCT( wtagrels.id_tag =1)) AS key_1_total_matches, SUM(DISTINCT( wtagrels.id_tag =4)) AS key_2_total_matches FROM all_tag_relations AS wtagrels WHERE ( wtagrels.id_tag =1 OR wtagrels.id_tag =4 ) GROUP BY wtagrels.id_wc HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 LIMIT 0, 20 Can anybody alter this query and somehow do a proper join or something to get correct results. That solves my problem in a nice way. As you can figure out, the reason why it does not work in system 2 is that in system 1, for every class, one additional tag relation linking class and tutor name is present. e.g. for class first class, (records with id_tag_rel 3 and 4) which returns the class on searching with tutor name. So, you see the trade-off between the search and profile edition difficulty with the two systems. How do I overcome both. I have to reach a conclusion soon. So far my reasoning is it is definitely not good from a code maintainability point of view to follow the single tag rel table structure of system one, because in a real system while editing a field like "tutor qualifications", there can be as many records in tag rels table as there are words in qualification of a tutor (one word in a field = one tag relation). Now suppose a tutor has 100 classes. When he edits his qualification, all the tag rel rows corresponding to him are deleted and then as many copies are to be created (as per the new qualification data) as there are classes. This becomes particularly difficult if later more searcheable fields are added. The code cannot be robust. Is the best solution to follow system 2 (edition has to be in one table - no extra work for each and every class) and somehow re-create the all_tag_relations table like system 1 (from the tables tutor_tag_relations and webclasses_tag_relations), creating the extra tutor tag rels for each and every class by a tutor (which is currently missing in system 2's temporary all_tag_relations table). That would be a time consuming logic script. I doubt that table can be recreated without resorting to PHP sript (mysql alone cannot do that). But the problem is that running all this at search time will make search definitely slow. So, how do such systems work? How are such situations handled? I thought about we can run a cron which initiates that PHP script, say every 1 minute and replaces the existing all_tag_relations table as per new tag rels from tutor_tag_relations and webclasses_tag_relations (replaces means creates a new table, deletes the original and renames the new one as all_tag_relations, otherwise search won't work during that period- or is there any better way to that?). Anyway, the result would be that any changes by tutors will reflect in search in the next 1 minute and not immediately. An alternateve would be to initate that PHP script every time a tutor edits his profile. But here again, since many users may edit their profiles concurrently, will the creation of so many tables be a burden and can mysql make the server slow? Any help would be appreciated and working solution will be accepted as answer. Thanks, Sandeepan

    Read the article

  • "PGError: no connection to the server" after idle

    - by user573484
    After my application sits idle overnight, when I try to access it in the morning I get a 500 Internal server error and the logs indicate "PGError: no connection to the server". After this first request if I refresh the page again everything is fine. I'm running Ubuntu 10.04 with apache 2, Passenger 3.0.2, Rails 2.3.8, and Postgres 8.4 on a remote server. Any ideas how to fix this? Here is the log: Processing ApplicationController#index (for 192.168.1.33 at 2011-01-06 17:28:14) [GET] Parameters: {"action"=>"index", "controller"=>"da"} ActiveRecord::StatementInvalid (PGError: no connection to the server : SELECT * FROM "users" WHERE ("users"."id" = 1) LIMIT 1): app/controllers/application_controller.rb:47:in `current_user' app/controllers/application_controller.rb:51:in `set_current_user' app/controllers/application_controller.rb:123:in `render_optional_error_file' passenger (3.0.2) lib/phusion_passenger/rack/request_handler.rb:96:in `process_request' passenger (3.0.2) lib/phusion_passenger/abstract_request_handler.rb:513:in `accept_and_process_next_request' passenger (3.0.2) lib/phusion_passenger/abstract_request_handler.rb:274:in `main_loop' passenger (3.0.2) lib/phusion_passenger/classic_rails/application_spawner.rb:321:in `start_request_handler' passenger (3.0.2) lib/phusion_passenger/classic_rails/application_spawner.rb:275:in `send' passenger (3.0.2) lib/phusion_passenger/classic_rails/application_spawner.rb:275:in `handle_spawn_application' passenger (3.0.2) lib/phusion_passenger/utils.rb:479:in `safe_fork' passenger (3.0.2) lib/phusion_passenger/classic_rails/application_spawner.rb:270:in `handle_spawn_application' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:357:in `__send__' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:357:in `server_main_loop' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:206:in `start_synchronously' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:180:in `start' passenger (3.0.2) lib/phusion_passenger/classic_rails/application_spawner.rb:149:in `start' passenger (3.0.2) lib/phusion_passenger/spawn_manager.rb:219:in `spawn_rails_application' passenger (3.0.2) lib/phusion_passenger/abstract_server_collection.rb:132:in `lookup_or_add' passenger (3.0.2) lib/phusion_passenger/spawn_manager.rb:214:in `spawn_rails_application' passenger (3.0.2) lib/phusion_passenger/abstract_server_collection.rb:82:in `synchronize' passenger (3.0.2) lib/phusion_passenger/abstract_server_collection.rb:79:in `synchronize' passenger (3.0.2) lib/phusion_passenger/spawn_manager.rb:213:in `spawn_rails_application' passenger (3.0.2) lib/phusion_passenger/spawn_manager.rb:132:in `spawn_application' passenger (3.0.2) lib/phusion_passenger/spawn_manager.rb:275:in `handle_spawn_application' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:357:in `__send__' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:357:in `server_main_loop' passenger (3.0.2) lib/phusion_passenger/abstract_server.rb:206:in `start_synchronously' passenger (3.0.2) helper-scripts/passenger-spawn-server:99 /!\ FAILSAFE /!\ Thu Jan 06 17:28:14 -0700 2011 Status: 500 Internal Server Error PGError: no connection to the server : SELECT * FROM "users" WHERE ("users"."id" = 1) LIMIT 1 /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract_adapter.rb:221:in `log' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/postgresql_adapter.rb:520:in `execute' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/postgresql_adapter.rb:1002:in `select_raw' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/postgresql_adapter.rb:989:in `select' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/database_statements.rb:7:in `select_all_without_query_cache' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/query_cache.rb:60:in `select_all' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/query_cache.rb:81:in `cache_sql' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/query_cache.rb:60:in `select_all' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/base.rb:664:in `find_by_sql' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/base.rb:1578:in `find_every' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/base.rb:1535:in `find_initial' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/base.rb:616:in `find' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/base.rb:1910:in `find_by_id' /home/user/application/releases/20110106230903/app/controllers/application_controller.rb:47:in `current_user' /home/user/application/releases/20110106230903/app/controllers/application_controller.rb:51:in `set_current_user' /home/user/application/releases/20110106230903/app/controllers/application_controller.rb:123:in `render_optional_error_file' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/rescue.rb:97:in `rescue_action_in_public' /home/user/application/releases/20110106230903/vendor/plugins/exception_notification/lib/exception_notification/notifiable.rb:48:in `rescue_action_in_public' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/rescue.rb:154:in `rescue_action_without_handler' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/rescue.rb:74:in `rescue_action' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/base.rb:532:in `send' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/base.rb:532:in `process_without_filters' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/filters.rb:606:in `process' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/rescue.rb:65:in `call_with_exception' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/dispatcher.rb:90:in `dispatch' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/dispatcher.rb:121:in `_call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/dispatcher.rb:130 /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/query_cache.rb:29:in `call' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/query_cache.rb:29:in `call' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/query_cache.rb:34:in `cache' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/query_cache.rb:9:in `cache' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/query_cache.rb:28:in `call' /var/lib/gems/1.8/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract/connection_pool.rb:361:in `call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/string_coercion.rb:25:in `call' /var/lib/gems/1.8/gems/rack-1.1.0/lib/rack/head.rb:9:in `call' /var/lib/gems/1.8/gems/rack-1.1.0/lib/rack/methodoverride.rb:24:in `call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/params_parser.rb:15:in `call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/session/cookie_store.rb:99:in `call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/failsafe.rb:26:in `call' /var/lib/gems/1.8/gems/rack-1.1.0/lib/rack/lock.rb:11:in `call' /var/lib/gems/1.8/gems/rack-1.1.0/lib/rack/lock.rb:11:in `synchronize' /var/lib/gems/1.8/gems/rack-1.1.0/lib/rack/lock.rb:11:in `call' /var/lib/gems/1.8/gems/actionpack-2.3.8/lib/action_controller/dispatcher.rb:106:in `call' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/rack/request_handler.rb:96:in `process_request' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_request_handler.rb:513:in `accept_and_process_next_request' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_request_handler.rb:274:in `main_loop' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/classic_rails/application_spawner.rb:321:in `start_request_handler' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/classic_rails/application_spawner.rb:275:in `send' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/classic_rails/application_spawner.rb:275:in `handle_spawn_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/utils.rb:479:in `safe_fork' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/classic_rails/application_spawner.rb:270:in `handle_spawn_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:357:in `__send__' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:357:in `server_main_loop' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:206:in `start_synchronously' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:180:in `start' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/classic_rails/application_spawner.rb:149:in `start' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/spawn_manager.rb:219:in `spawn_rails_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server_collection.rb:132:in `lookup_or_add' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/spawn_manager.rb:214:in `spawn_rails_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server_collection.rb:82:in `synchronize' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server_collection.rb:79:in `synchronize' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/spawn_manager.rb:213:in `spawn_rails_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/spawn_manager.rb:132:in `spawn_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/spawn_manager.rb:275:in `handle_spawn_application' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:357:in `__send__' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:357:in `server_main_loop' /var/lib/gems/1.8/gems/passenger-3.0.2/lib/phusion_passenger/abstract_server.rb:206:in `start_synchronously' /var/lib/gems/1.8/gems/passenger-3.0.2/helper-scripts/passenger-spawn-server:99

    Read the article

  • Can this Query can be corrected or different table structure needed? (question is clear, detailed, d

    - by sandeepan
    This is a bit lengthy but I have provided sufficient details and kept things very clear. Please see if you can help. (I will surely accept answer if it solves my problem) I am sure a person experienced with this can surely help or suggest me to decide the tables structure. About the system:- There are tutors who create classes A tags based search approach is being followed Tag relations are created/edited when new tutors registers/edits profile data and when tutors create classes (this makes tutors and classes searcheable).For simplicity, let us consider only tutor name and class name are the fields which are matched against search keywords. In this example, I am considering - tutor "Sandeepan Nath" has created a class called "first class" tutor "Bob Cratchit" has created a class called "new class" Desired search results- AND logic to be appied on the search keywords and match against class and tutor data(class name + tutor name), in other words, All those classes be shown such that all the search terms are present in the class name or its tutor name. Example to be clear - Searching "first class" returns class with id_wc = 1. Working Searching "Sandeepan class" should also return class with id_wc = 1. Not working in System 2. Problem with profile editing and searching To tell in one sentence, I am facing a conflict between the ease of profile edition (edition of tag relations when tutor profiles are edited) and the ease of search logic. In the beginning, we had one table structure and search was easy but tag edition logic was very clumsy and unmaintainable(Check System 1 in the section below) . So we created separate tag relations tables to make profile edition simpler but search has become difficult. Please dump the tables so that you can run the search query I have given below and see the results. System 1 (previous system - search easy - profile edition difficult):- Only one table called All_Tag_Relations table had the all the tag relations. The tags table below is common to both systems 1 and 2. CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 1, 1, 1), (4, 2, 1, 1), (5, 3, 1, 1), (6, 4, 1, 1), (7, 6, 2, NULL), (8, 7, 2, NULL), (9, 6, 2, 2), (10, 7, 2, 2), (11, 5, 2, 2), (12, 4, 2, 2); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=8 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'); Please note that for every class, the tag rels of its tutor have to be duplicated. Example, for class with id_wc=1, the tag rel records with id_tag_rel = 3 and 4 are actually extras if you compare with the tag rel records with id_tag_rel = 1 and 2. System 2 (present system - profile edition easy, search difficult) Two separate tables Tutors_Tag_Relations and Webclasses_Tag_Relations have the corresponding tag relations data (Please dump into a separate database)- CREATE TABLE IF NOT EXISTS `tutors_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `tutors_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`) VALUES (1, 1, 1), (2, 2, 1), (3, 6, 2), (4, 7, 2); CREATE TABLE IF NOT EXISTS `webclasses_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `webclasses_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`), KEY `id_tag` (`id_tag`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; INSERT INTO `webclasses_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 3, 1, 1), (2, 4, 1, 1), (3, 5, 2, 2), (4, 4, 2, 2); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=8 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'); CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; insert into All_Tag_Relations select NULL,id_tag,id_tutor,NULL from Tutors_Tag_Relations; insert into All_Tag_Relations select NULL,id_tag,id_tutor,id_wc from Webclasses_Tag_Relations; Here you can see how easily tutor first name can be edited only in one place. But search has become really difficult, so on being advised to use a Temporary table, I am creating one at every search request, then dumping all the necessary data and then searching from it, I am creating this All_Tag_Relations table at search run time. Here I am just dumping all the data from the two tables Tutors_Tag_Relations and Webclasses_Tag_Relations. But, I am still not able to get classes if I search with tutor name This is the query which searches "first class". Running them on both the systems shows correct results (returns the class with id_wc = 1). SELECT wtagrels.id_wc,SUM(DISTINCT( wtagrels.id_tag =3)) AS key_1_total_matches, SUM(DISTINCT( wtagrels.id_tag =4)) AS key_2_total_matches FROM all_tag_relations AS wtagrels WHERE ( wtagrels.id_tag =3 OR wtagrels.id_tag =4 ) GROUP BY wtagrels.id_wc HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 LIMIT 0, 20 But, searching for "Sandeepan class" works only with the 1st system Here is the query which searches "Sandeepan class" SELECT wtagrels.id_wc,SUM(DISTINCT( wtagrels.id_tag =1)) AS key_1_total_matches, SUM(DISTINCT( wtagrels.id_tag =4)) AS key_2_total_matches FROM all_tag_relations AS wtagrels WHERE ( wtagrels.id_tag =1 OR wtagrels.id_tag =4 ) GROUP BY wtagrels.id_wc HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 LIMIT 0, 20 Can anybody alter this query and somehow do a proper join or something to get correct results. That solves my problem in a nice way. As you can figure out, the reason why it does not work in system 2 is that in system 1, for every class, one additional tag relation linking class and tutor name is present. e.g. for class first class, (records with id_tag_rel 3 and 4) which returns the class on searching with tutor name. So, you see the trade-off between the search and profile edition difficulty with the two systems. How do I overcome both. I have to reach a conclusion soon. So far my reasoning is it is definitely not good from a code maintainability point of view to follow the single tag rel table structure of system one, because in a real system while editing a field like "tutor qualifications", there can be as many records in tag rels table as there are words in qualification of a tutor (one word in a field = one tag relation). Now suppose a tutor has 100 classes. When he edits his qualification, all the tag rel rows corresponding to him are deleted and then as many copies are to be created (as per the new qualification data) as there are classes. This becomes particularly difficult if later more searcheable fields are added. The code cannot be robust. Is the best solution to follow system 2 (edition has to be in one table - no extra work for each and every class) and somehow re-create the all_tag_relations table like system 1 (from the tables tutor_tag_relations and webclasses_tag_relations), creating the extra tutor tag rels for each and every class by a tutor (which is currently missing in system 2's temporary all_tag_relations table). That would be a time consuming logic script. I doubt that table can be recreated without resorting to PHP sript (mysql alone cannot do that). But the problem is that running all this at search time will make search definitely slow. So, how do such systems work? How are such situations handled? I thought about we can run a cron which initiates that PHP script, say every 1 minute and replaces the existing all_tag_relations table as per new tag rels from tutor_tag_relations and webclasses_tag_relations (replaces means creates a new table, deletes the original and renames the new one as all_tag_relations, otherwise search won't work during that period- or is there any better way to that?). Anyway, the result would be that any changes by tutors will reflect in search in the next 1 minute and not immediately. An alternateve would be to initate that PHP script every time a tutor edits his profile. But here again, since many users may edit their profiles concurrently, will the creation of so many tables be a burden and can mysql make the server slow? Any help would be appreciated and working solution will be accepted as answer. Thanks, Sandeepan

    Read the article

  • How Can I Populate Default Form Data with a ManyToMany Field?

    - by b14ck
    Ok, I've been crawling google and Django documentation for over 2 hours now (as well as the IRC channel on freenode), and haven't been able to figure this one out. Basically, I have a model called Room, which is displayed below: class Room(models.Model): """ A `Partyline` room. Rooms on the `Partyline`s are like mini-chatrooms. Each room has a variable amount of `Caller`s, and usually a moderator of some sort. Each `Partyline` has many rooms, and it is common for `Caller`s to join multiple rooms over the duration of their call. """ LIVE = 0 PRIVATE = 1 ONE_ON_ONE = 2 UNCENSORED = 3 BULLETIN_BOARD = 4 CHILL = 5 PHONE_BOOTH = 6 TYPE_CHOICES = ( ('LR', 'Live Room'), ('PR', 'Private Room'), ('UR', 'Uncensored Room'), ) type = models.CharField('Room Type', max_length=2, choices=TYPE_CHOICES) number = models.IntegerField('Room Number') partyline = models.ForeignKey(Partyline) owner = models.ForeignKey(User, blank=True, null=True) bans = models.ManyToManyField(Caller, blank=True, null=True) def __unicode__(self): return "%s - %s %d" % (self.partyline.name, self.type, self.number) I've also got a forms.py which has the following ModelForm to represent my Room model: from django.forms import ModelForm from partyline_portal.rooms.models import Room class RoomForm(ModelForm): class Meta: model = Room I'm creating a view which allows administrators to edit a given Room object. Here's my view (so far): def edit_room(request, id=None): """ Edit various attributes of a specific `Room`. Room owners do not have access to this page. They cannot edit the attributes of the `Room`(s) that they control. """ room = get_object_or_404(Room, id=id) if not room.is_owner(request.user): return HttpResponseForbidden('Forbidden.') if is_user_type(request.user, ['admin']): form_type = RoomForm elif is_user_type(request.user, ['lm']): form_type = LineManagerEditRoomForm elif is_user_type(request.user, ['lo']): form_type = LineOwnerEditRoomForm if request.method == 'POST': form = form_type(request.POST, instance=room) if form.is_valid(): if 'owner' in form.cleaned_data: room.owner = form.cleaned_data['owner'] room.save() else: defaults = {'type': room.type, 'number': room.number, 'partyline': room.partyline.id} if room.owner: defaults['owner'] = room.owner.id if room.bans: defaults['bans'] = room.bans.all() ### this does not work properly! form = form_type(defaults, instance=room) variables = RequestContext(request, {'form': form, 'room': room}) return render_to_response('portal/rooms/edit.html', variables) Now, this view works fine when I view the page. It shows all of the form attributes, and all of the default values are filled in (when users do a GET)... EXCEPT for the default values for the ManyToMany field 'bans'. Basically, if an admins clicks on a Room object to edit, the page they go to will show all of the Rooms default values except for the 'bans'. No matter what I do, I can't find a way to get Django to display the currently 'banned users' for the Room object. Here is the line of code that needs to be changed (from the view): defaults = {'type': room.type, 'number': room.number, 'partyline': room.partyline.id} if room.owner: defaults['owner'] = room.owner.id if room.bans: defaults['bans'] = room.bans.all() ### this does not work properly! There must be some other syntax I have to use to specify the default value for the 'bans' field. I've really been pulling my hair out on this one, and would definitely appreciate some help. Thanks!

    Read the article

  • ASP.NET- forcing child/container events to fire before parent onload?

    - by Hans Gruber
    I'm working on a questionnaire type application in which questions are stored in a database. Therefore, I create my controls dynamically on every Page.OnLoad. This works like a charm and ViewState is persisted between postbacks because I ensure that my dynamic controls always have the same generated Control.ID. In addition to the user control that dynamically populates the questions, my questionnaire page also contains a 'Status' section (also encapsulated by a user control) which represents the status of the questionnaire (choices are 'Complete', 'Started' or 'In Progress'). If the user changes the status of questionnaire (i.e. from 'In Progress' to 'Complete'), I need to postback to the server because the contents of the dynamic portion of the questionnaire depend on the selected status. Some questions are always present regardless of status, and yet others may not be present at all for the selected status. The point is, when the status changes, I have to postback to the page and render the right set of questions. Additionally, I need to preserve any user entered values for those questions which are 'always available'. However, due to the page life cycle in ASP.NET, the 'Status' user control's OnLoad, which contains the correct status needed to load the right questions from the DB, doesn't get executed until after the 'dynamic questions' user control has already been populated (with the wrong/stale values). To get around this, I raise an event from my 'Status' user control to the main page to indicate that the Status has changed. The main page then raises an event on the 'dynamic questions' user control. Since by the time this event bubbles up, the 'dynamic questions' user control has already loaded the 'wrong' questions from the DB, it first calls Controls.Clear. It then happily uses the new status to query the database for the 'correct' questions and does a Control.Add() on each. FYI, Control.IDs are consistent across postbacks. This solution works...sorta. The correct set of questions for the selected status do get rendered; however ViewState is getting lost for those 'always available' questions. I'm guessing this is because the 'dynamic questions' user control calls Controls.Clear when responding to the status changed event. This must somehow kill the association between ViewState and my dynamic controls, even though the Control.ID are consistent. This seems like such a common requirement, I'm virtually certain there is a better, cleaner and less error prone approach to accomplish this. In case its not plain obvious, I haven't been able to grok the ASP.NET page life-cycle despite working with it for the last year. Any help is much appreciated!

    Read the article

  • Difficulty adding widgets to django form.

    - by codingJoe
    I have a django app that tracks activities that can benefit a classroom. Using the django examples, I was able to build a form to enter this data. But when I try to add widgets to that form, things get tricky. What I want is a calendar widget that lets the user enter the 'activity_date' field using a widget. If I use Admin interface. The AdminDateWidget works fine. however. This particular user isn't allowed access to the admin interface so I need a different way to present this widget. Also I couldn't figure out how to make the bring the admin widget over into non-admin pages. So I tried a custom widget. This is the first custom widget I've built, so I'm not quite sure what is supposed to be going on here. Any Expert Advice? How do I get my date widget to work? # The Model class Activity(models.Model): activity_date = models.DateField() activity_type = models.CharField(max_length=50, choices=ACTIVITY_TYPES) activity_description = models.CharField(max_length=200) activity_duration= models.DecimalField(decimal_places=2, max_digits=4) est_attendance = models.IntegerField("Estimated attendance") # The Form class ActivityForm(forms.ModelForm): # The following line causes lockup if enabled. # With the DateTimeWidget removed, the form functions correctly except that there is no widget. #activity_date = forms.DateField(label=_('Date'), widget=DateTimeWidget) ##!!! Point of Error !!! class Meta: model = Activity fields = ('activity_date', 'activity_type', 'activity_description', 'activity_duration', 'est_attendance') def __init__(self, *args, **kwargs): super(ActivityForm, self).__init__(*args, **kwargs) instance = getattr(self, 'instance', None) edit_aid = kwargs.get('edit_aid', False) # On a different approach, the following also didn't work. #self.fields['activity_date'].widget = widgets.AdminDateWidget() # The Widget # Example referenced: http://djangosnippets.org/snippets/391/ calbtn = u""" <button id="calendar-trigger">...</button> <img src="%s/site_media/images/icon_calendar.gif" alt="calendar" id="%s_btn" style="cursor: pointer; border: 1px solid #8888aa;" title="Select date and time" onmouseover="this.style.background='#444444';" onmouseout="this.style.background=''" /> <script type="text/javascript"> Calendar.setup({ trigger : "calendar-trigger", inputField : "%s" }); </script>""" class DateTimeWidget(forms.widgets.TextInput): dformat = '%Y-%m-%d %H:%M' def render(self, name, value, attrs=None): print "DTWgt render name=%s, value=%s" % name, value if value is None: value = '' final_attrs = self.build_attrs(attrs, type=self.input_type, name=name) if value != '': try: final_attrs['value'] = \ force_unicode(value.strftime(self.dformat)) except: final_attrs['value'] = \ force_unicode(value) if not final_attrs.has_key('id'): final_attrs['id'] = u'%s_id' % (name) id = final_attrs['id'] jsdformat = self.dformat #.replace('%', '%%') cal = calbtn % (settings.MEDIA_URL, id, id, jsdformat, id) a = u'<input%s />%s' % (forms.util.flatatt(final_attrs), cal) print "render return %s " % a return mark_safe(a) def value_from_datadict(self, data, files, name): print "DTWgt value_from_datadict" dtf = forms.fields.DEFAULT_DATETIME_INPUT_FORMATS empty_values = forms.fields.EMPTY_VALUES value = data.get(name, None) if value in empty_values: return None if isinstance(value, datetime.datetime): return value if isinstance(value, datetime.date): return datetime.datetime(value.year, value.month, value.day) for format in dtf: try: return datetime.datetime(*time.strptime(value, format)[:6]) except ValueError: continue return None

    Read the article

  • How to avoid repetition when working with primitive types?

    - by I82Much
    I have the need to perform algorithms on various primitive types; the algorithm is essentially the same with the exception of which type the variables are. So for instance, /** * Determine if <code>value</code> is the bitwise OR of elements of <code>validValues</code> array. * For instance, our valid choices are 0001, 0010, and 1000. * We are given a value of 1001. This is valid because it can be made from * ORing together 0001 and 1000. * On the other hand, if we are given a value of 1111, this is invalid because * you cannot turn on the second bit from left by ORing together those 3 * valid values. */ public static boolean isValid(long value, long[] validValues) { for (long validOption : validValues) { value &= ~validOption; } return value != 0; } public static boolean isValid(int value, int[] validValues) { for (int validOption : validValues) { value &= ~validOption; } return value != 0; } How can I avoid this repetition? I know there's no way to genericize primitive arrays, so my hands seem tied. I have instances of primitive arrays and not boxed arrays of say Number objects, so I do not want to go that route either. I know there are a lot of questions about primitives with respect to arrays, autoboxing, etc., but I haven't seen it formulated in quite this way, and I haven't seen a decisive answer on how to interact with these arrays. I suppose I could do something like: public static<E extends Number> boolean isValid(E value, List<E> numbers) { long theValue = value.longValue(); for (Number validOption : numbers) { theValue &= ~validOption.longValue(); } return theValue != 0; } and then public static boolean isValid(long value, long[] validValues) { return isValid(value, Arrays.asList(ArrayUtils.toObject(validValues))); } public static boolean isValid(int value, int[] validValues) { return isValid(value, Arrays.asList(ArrayUtils.toObject(validValues))); } Is that really much better though? Any thoughts in this matter would be appreciated.

    Read the article

  • Which programming language to choose? (for a specific problem/domain, details inside)

    - by Bijan
    I am building a trading portfolio management system that is responsible for production, optimization, and simulation of non-high frequency trading portfolios (dealing with 1min or 3min bars of data, not tick data). I plan on employing Amazon web services to take on the entire load of the application. I have four choices that I am considering as language. a) Java b) C++ c) C# d) Python Here is the scope of the extremes of the project scope. This isn't how it will be, maybe ever, but it's within the scope of the requirements: Weekly simulation of 10,000,000 trading systems. (Each trading system is expected to have its own data mining methods, including feature selection algorithms which are extremely computationally-expensive. Imagine 500-5000 features using wrappers. These are not run often by any means, but it's still a consideration) Real-time production of portfolio w/ 100,000 trading strategies Taking in 1 min or 3 min data from every stock/futures market around the globe (approx 100,000) Portfolio optimization of portfolios with up to 100,000 strategies. (rather intensive algorithm) Speed is a concern, but I believe that Java can handle the load. I just want to make sure that Java CAN handle the above requirements comfortably. I don't want to do the project in C++, but I will if it's required. The reason C# is on there is because I thought it was a good alternative to Java, even though I don't like Windows at all and would prefer Java if all things are the same. Python - I've read somethings on PyPy and pyscho that claim python can be optimized with JIT compiling to run at near C-like speeds.... That's pretty much the only reason it is on this list, besides that fact that Python is a great language and would probably be the most enjoyable language to code in, which is not a factor at all for this project, but a perk. To sum up: - real time production - weekly simulations of a large number of systems - weekly/monthly optimizations of portfolios - large numbers of connections to collect data from There is no dealing with millisecond or even second based trades. The only consideration is if Java can possibly deal with this kind of load when spread out of a necessary amount of EC2 servers. Thank you guys so much for your wisdom.

    Read the article

  • Dynamic Multiple Choice (Like a Wizard) - How would you design it? (e.g. Schema, AI model, etc.)

    - by henry74
    This question can probably be broken up into multiple questions, but here goes... In essence, I'd like to allow users to type in what they would like to do and provide a wizard-like interface to ask for information which is missing to complete a requested query. For example, let's say a user types: "What is the weather like in Springfield?" We recognize the user is interested in weather, but it could be Springfield, Il or Springfield in another state. A follow-up question would be: What Springfield did you want weather for? 1 - Springfield, Il 2 - Springfield, Wi You can probably think of a million examples where a request is missing key data or its ambiguous. Make the assumption the gist of what the user wants can be understood, but there are missing pieces of data required to complete the request. Perhaps you can take it as far back as asking what the user wants to do and "leading" them to a query. This is not AI in the sense of taking any input and truly understanding it. I'm not referring to having some way to hold a conversation with a user. It's about inferring what a user wants, checking to see if there is an applicable service to be provided, identifying the inputs needed and overlaying that on top of what's missing from the request, then asking the user for the remaining information. That's it! :-) How would you want to store the information about services? How would you go about determining what was missing from the input data? My thoughts: Use regex expressions to identify clear pieces of information. These will be matched to the parameters of a service. Figure out which parameters do not have matching data and look up the associated question for those parameters. Ask those questions and capture answers. Re-run the service passing in the newly captured data. These would be more free-form questions. For multiple choice, identify the ambiguity and search for potential matches ranked in order of likelihood (add in user history/preferences to help decide). Provide the top 3 as choices. Thoughts appreciated. Cheers, Henry

    Read the article

  • C# Property Access vs Interface Implementation

    - by ehdv
    I'm writing a class to represent a Pivot Collection, the root object recognized by Pivot. A Collection has several attributes, a list of facet categories (each represented by a FacetCategory object) and a list of items (each represented by a PivotItem object). Therefore, an extremely simplified Collection reads: public class Collection { private List<FacetCategory> categories; private List<PivotItem> items; // other attributes } What I'm unsure of is how to properly grant access to those two lists. Because declaration order of both facet categories and items is visible to the user, I can't use sets, but the class also shouldn't allow duplicate categories or items. Furthermore, I'd like to make the Collection object as easy to use as possible. So my choices are: Have Collection implement IList<PivotItem> and have accessor methods for FacetCategory: In this case, one would add an item to Collection foo by writing foo.Add(bar). This works, but since a Collection is equally both kinds of list making it only pass as a list for one type (category or item) seems like a subpar solution. Create nested wrapper classes for List (CategoryList and ItemList). This has the advantage of making a consistent interface but the downside is that these properties would no longer be able to serve as lists (because I need to override the non-virtual Add method I have to implement IList rather than subclass List. Implicit casting wouldn't work because that would return the Add method to its normal behavior. Also, for reasons I can't figure out, IList is missing an AddRange method... public class Collection { private class CategoryList: IList<FacetCategory> { // ... } private readonly CategoryList categories = new CategoryList(); private readonly ItemList items = new ItemList(); public CategoryList FacetCategories { get { return categories; } set { categories.Clear(); categories.AddRange(value); } } public ItemList Items { get { return items; } set { items.Clear(); items.AddRange(value); } } } Finally, the third option is to combine options one and two, so that Collection implements IList<PivotItem> and has a property FacetCategories. Question: Which of these three is most appropriate, and why?

    Read the article

  • Django: Grouping by Dates and Servers

    - by TheLizardKing
    So I am trying to emulate google app's status page: http://www.google.com/appsstatus#hl=en but for backups for our own servers. Instead of service names on the left it'll be server names but the dates and hopefully the pagination will be there too. My models look incredibly similar to this: from django.db import models STATUS_CHOICES = ( ('UN', 'Unknown'), ('NI', 'No Issue'), ('IS', 'Issue'), ('NR', 'Not Running'), ) class Server(models.Model): name = models.CharField(max_length=32) def __unicode__(self): return self.name class Backup(models.Model): server = models.ForeignKey(Server) created = models.DateField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) status = models.CharField(max_length=2, choices=STATUS_CHOICES, default='UN') issue = models.TextField(blank=True) def __unicode__(self): return u'%s: %s' % (self.server, self.get_status_display()) My issue is that I am having a hell of a time displaying the information I need. Everyday a little after midnight a cron job will run and add a row for each server for that day, defaulting on status unknown (UN). My backups.html: {% extends "base.html" %} {% block content %} <table> <tr> <th>Name</th> {% for server in servers %} <th>{{ created }}</th> </tr> <tr> <td>{{ server.name }}</td> {% for backup in server.backup_set.all %} <td>{{ backup.get_status_display }}</td> {% endfor %} </tr> {% endfor %} </table> {% endblock content %} This actually works but I do not know how to get the dates to show. Obviously {{ created }} doesn't do anything but the servers don't have create dates. Backups do and because it's a cron job there should only be X number of rows with any particular date (depending on how many servers we are following for that day). Summary I want to create a table, X being server names, Y being dates starting at today while all the cells being the status of a backup. The above model and template should hopefully give you an idea what my thought process but I am willing to alter anything. Basically I am create a fancy excel spreadsheet.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • Jquery interactive table - multiple instance problem

    - by petejm
    Hello forgive me if i use the wrong terminology and the messiness of this code it is the first time I have used jquery. I am making an interactive table-product selector. Compatible systems run along the top and colour choices down the left. The table works by seeing if there is a cell is empty in a html table. If the cell is empty then that is a compatible system and a circle image is in that cell and it is selectable. When selected the product code is generated (by looking at the colour value and system name) and the relevant resource download pack can be downloaded. This works 'fine' when on its own on a page however when I have multiple instances of it on one page they interfere with each other. Only the first one works and clicking in the 2nd 3rd etc table updates the first one. I need these to function independant of each other. I believe the problem is centering around the (this) command working across all of the tables but I can't quite figure this out with what I know of jquery. <script type="text/javascript">// <![CDATA[ jQuery(document).ready(function($j){ $j(document).ready(function() { jQuery.noConflict() (function(){ $j(".options").each(function() { // current td element var tx = $j(this); // do it once only var val = tx.text(); tx.css('background', val ==1 ? '' : 'url(circ.png)'); }); $j("#para").text('').append("Please make a selection");; $j(".options").click(function(e) { $j(".options").each(function() { // current td element var tx = $j(this); // do it once only var val = tx.text(); tx.css('background', val ==1 ? '' : 'url(circ.png)'); }); var ProductCode = 241; var currentCellText = $j(this).text(); var LeftCellText = $j(this).prev().text(); var RightCellText = $j(this).next().text(); var RowIndex =$j(this).parent().parent().children().index($j(this).parent()); var ColIndex = $j(this).parent().children().index($j(this)); var RowsAbove = RowIndex; var ColName = $j(".head").children(':eq(' + ColIndex + ')').text(); var rowid = $j(this).parent().attr('id'); if(currentCellText===''){$j(this).css('background', 'url(circfill.png)'); $j("#para").text('').append( ColName +"-"+ ProductCode +"-"+ rowid +"<br />") $j("#resourcepack").text('').append("Download Selected Resource Pack") $j("#resourcepack").click(function(){ window.location = '241.zip'}); ;} else{$j("#para").text('').append("Incompatible Selection"); $j("#resourcepack").text('').append() }}); }); }); }); </script>

    Read the article

  • MATLAB arbitrary code execution

    - by aristotle2600
    I am writing an automatic grader program under linux. There are several graders written in MATLAB, so I want to tie them all together and let students run a program to do an assignment, and have them choose the assignment. I am using a C++ main program, which then has mcc-compiled MATLAB libraries linked to it. Specifically, my program reads a config file for the names of the various matlab programs, and other information. It then uses that information to present choices to the student. So, If an assignment changes, is added or removed, then all you have to do is change the config file. The idea is that next, the program invokes the correct matlab library that has been compiled with mcc. But, that means that the libraries have to be recompiled if a grader gets changed. Worse, the whole program must be recompiled if a grader is added or removed. So, I would like one, simple, unchanging matlab library function to call the grader m-files directly. I currently have such a library, that uses eval on a string passed to it from the main program. The problem is that when I do this, apparently, mcc absorbs the grader m-code into itself; changing the grader m code after compilation has no effect. I would like for this not to happen. It was brought to my attention that Mathworks may not want me to be able to do this, since it could bypass matlab entirely. That is not my intention, and I would be happy with a solution that requires a full matlab install. My possible solutions are to use a mex file for the main program, or have the main program call a mcc library, which then calls a mex file, which then calls the proper grader. The reason I am hesitant about the first solution is that I'm not sure how many changes I would have to make to my code to make it work; my code is C++, not C, which I think makes things more complicated. The 2nd solution, though, may just be more complicated and ultimately have the same problem. So, any thoughts on this situation? How should I do this?

    Read the article

  • jQuery replacing an image inside a .net datalist

    - by user359409
    (submit said I was trying to post an image so I've changed image everywhere to ix I am trying to get jQuery to replace an ix inside a datalist. The original ix is the thumbnail ix of a product on a category page. The small ix I am clicking on are swatch ix for the different colors of a product. I can get it to work using a div tag around the ix tag inside the ItemTemplate. I don't need to use a div tag if I can get the imagesx to swap- I was just using it because that is sample code I found and it works for the first product in the category. <asp:HyperLink ID="ProductNav" runat="server" NavigateUrl='<%#Eval("NavigateUrl") %>'> <div id="ladiv" runat="server"> <asp:Ixx runat="server" ID="ProdThumb" /> </div> </asp:HyperLink> <asp:PlaceHolder ID="phSwatches" runat="server"></asp:PlaceHolder> The ProdThumb ix is added from the code behind and the swatches are added from the code behind swatches.Controls.Add(new LiteralControl("<table><tr>")); foreach(OptionChoice optionChoice in option.Choices) { string swatchThumbnail = string.Format("<ix ID=\"{0}\" src=\"{1}\" border=\"0\" class=\"{2}\" />","swatch" + optionChoice.OptionChoiceId.ToString(), ResolveUrl(optionChoice.ThumbnailUrl),"imgthumb"); swatches.Controls.Add(new LiteralControl("<td>")); swatches.Controls.Add(new LiteralControl(swatchThumbnail)); swatches.Controls.Add(new LiteralControl("</td>")); } swatches.Controls.Add(new LiteralControl("</tr></table>")); prodThumb.IxUrl = product.ThumbnailUrl; prodThumb.AlternateText = product.ThumbnailAltText; prodThumb.CssClass = "Thumbnail"; The jQuery is: $(function() { $("ix.imgthumb").click(function(e) { var t = $(this); var newImg = ''; $('#ladiv') .html($(newImg) ); }); }); </script> Both images are named similar, except the swatch contains "sws" and the larger one is the some only with "swl". I have spent several days searching but am not able to get it to work. If I try something like $("#<%=ladiv.ClientID %") the code can't find it. I appreciate any help.

    Read the article

  • SharpDX: best practice for multiple RenderForms?

    - by Rob Jellinghaus
    I have an XNA app, but I really need to add multiple render windows, which XNA doesn't do. I'm looking at SharpDX (both for multi-window support and for DX11 / Metro / many other reasons). I decided to hack up the SharpDX DX11 MultiCubeTexture sample to see if I could make it work. My changes are pretty trivial. The original sample had: [STAThread] private static void Main() { var form = new RenderForm("SharpDX - MiniCubeTexture Direct3D11 Sample"); ... I changed this to: struct RenderFormWithActions { internal readonly RenderForm Form; // should just be Action but it's not in System namespace?! internal readonly Action RenderAction; internal readonly Action DisposeAction; internal RenderFormWithActions(RenderForm form, Action renderAction, Action disposeAction) { Form = form; RenderAction = renderAction; DisposeAction = disposeAction; } } [STAThread] private static void Main() { // hackity hack new Thread(new ThreadStart(() = { RenderFormWithActions form1 = CreateRenderForm(); RenderLoop.Run(form1.Form, () = form1.RenderAction(0)); form1.DisposeAction(0); })).Start(); new Thread(new ThreadStart(() = { RenderFormWithActions form2 = CreateRenderForm(); RenderLoop.Run(form2.Form, () = form2.RenderAction(0)); form2.DisposeAction(0); })).Start(); } private static RenderFormWithActions CreateRenderForm() { var form = new RenderForm("SharpDX - MiniCubeTexture Direct3D11 Sample"); ... Basically, I split out all the Main() code into a separate method which creates a RenderForm and two delegates (a render delegate, and a dispose delegate), and bundles them all together into a struct. I call this method twice, each time from a separate, new thread. Then I just have one RenderLoop on each new thread. I was thinking this wouldn't work because of the [STAThread] declaration -- I thought I would need to create the RenderForm on the main (STA) thread, and run only a single RenderLoop on that thread. Fortunately, it seems I was wrong. This works quite well -- if you drag one of the forms around, it stops rendering while being dragged, but starts again when you drop it; and the other form keeps chugging away. My questions are pretty basic: Is this a reasonable approach, or is there some lurking threading issue that might make trouble? My code simply duplicates all the setup code -- it makes a duplicate SwapChain, Device, Texture2D, vertex buffer, everything. I don't have a problem with this level of duplication -- my app is not intensive enough to suffer resource issues -- but nonetheless, is there a better practice? Is there any good reference for which DirectX structures can safely be shared, and which can't? It appears that RenderLoop.Run calls the render delegate in a tight loop. Is there any standard way to limit the frame rate of RenderLoop.Run, if you don't want a 400FPS app eating 100% of your CPU? Should I just Thread.Sleep(30) in the render delegate? (I asked on the sharpdx.org forums as well, but Alexandre is on vacation for two weeks, and my sister wants me to do a performance with my app at her wedding in three and a half weeks, so I'm mighty incented here! http://robjsoftware.org for details of what I'm building....)

    Read the article

  • Android - creating a custom preferences activity screen

    - by Bill Osuch
    Android applications can maintain their own internal preferences (and allow them to be modified by users) with very little coding. In fact, you don't even need to write an code to explicitly save these preferences, it's all handled automatically! Create a new Android project, with an intial activity title Main. Create two more activities: ShowPrefs, which extends Activity Set Prefs, which extends PreferenceActivity Add these two to your AndroidManifest.xml file: <activity android:name=".SetPrefs"></activity> <activity android:name=".ShowPrefs"></activity> Now we'll work on fleshing out each activity. First, open up the main.xml layout file and add a couple of buttons to it: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"    android:orientation="vertical"    android:layout_width="fill_parent"    android:layout_height="fill_parent"> <Button android:text="Edit Preferences"    android:id="@+id/prefButton"    android:layout_width="wrap_content"    android:layout_height="wrap_content"    android:layout_gravity="center_horizontal"/> <Button android:text="Show Preferences"    android:id="@+id/showButton"    android:layout_width="wrap_content"    android:layout_height="wrap_content"    android:layout_gravity="center_horizontal"/> </LinearLayout> Next, create a couple button listeners in Main.java to handle the clicks and start the other activities: Button editPrefs = (Button) findViewById(R.id.prefButton);       editPrefs.setOnClickListener(new View.OnClickListener() {              public void onClick(View view) {                  Intent myIntent = new Intent(view.getContext(), SetPrefs.class);                  startActivityForResult(myIntent, 0);              }      });           Button showPrefs = (Button) findViewById(R.id.showButton);      showPrefs.setOnClickListener(new View.OnClickListener() {              public void onClick(View view) {                  Intent myIntent = new Intent(view.getContext(), ShowPrefs.class);                  startActivityForResult(myIntent, 0);              }      }); Now, we'll create the actual preferences layout. You'll need to create a file called preferences.xml inside res/xml, and you'll likely have to create the xml directory as well. Add the following xml: <?xml version="1.0" encoding="utf-8"?> <PreferenceScreen xmlns:android="http://schemas.android.com/apk/res/android"> </PreferenceScreen> First we'll add a category, which is just a way to group similar preferences... sort of a horizontal bar. Add this inside the PreferenceScreen tags: <PreferenceCategory android:title="First Category"> </PreferenceCategory> Now add a Checkbox and an Edittext box (inside the PreferenceCategory tags): <CheckBoxPreference    android:key="checkboxPref"    android:title="Checkbox Preference"    android:summary="This preference can be true or false"    android:defaultValue="false"/> <EditTextPreference    android:key="editTextPref"    android:title="EditText Preference"    android:summary="This allows you to enter a string"    android:defaultValue="Nothing"/> The key is how you will refer to the preference in code, the title is the large text that will be displayed, and the summary is the smaller text (this will make sense when you see it). Let's say we've got a second group of preferences that apply to a different part of the app. Add a new category just below the first one: <PreferenceCategory android:title="Second Category"> </PreferenceCategory> In there we'll a list with radio buttons, so add: <ListPreference    android:key="listPref"    android:title="List Preference"    android:summary="This preference lets you select an item in a array"    android:entries="@array/listArray"    android:entryValues="@array/listValues" /> When complete, your full xml file should look like this: <?xml version="1.0" encoding="utf-8"?> <PreferenceScreen xmlns:android="http://schemas.android.com/apk/res/android">  <PreferenceCategory android:title="First Category"> <CheckBoxPreference    android:key="checkboxPref"    android:title="Checkbox Preference"    android:summary="This preference can be true or false"    android:defaultValue="false"/> <EditTextPreference    android:key="editTextPref"    android:title="EditText Preference"    android:summary="This allows you to enter a string"    android:defaultValue="Nothing"/>  </PreferenceCategory>  <PreferenceCategory android:title="Second Category">   <ListPreference    android:key="listPref"    android:title="List Preference"    android:summary="This preference lets you select an item in a array"    android:entries="@array/listArray"    android:entryValues="@array/listValues" />  </PreferenceCategory> </PreferenceScreen> However, when you try to save it, you'll get an error because you're missing your array definition. To fix this, add a file called arrays.xml in res/values, and paste in the following: <?xml version="1.0" encoding="utf-8"?> <resources>  <string-array name="listArray">      <item>Value 1</item>      <item>Value 2</item>      <item>Value 3</item>  </string-array>  <string-array name="listValues">      <item>1</item>      <item>2</item>      <item>3</item>  </string-array> </resources> Finally (for the preferences screen at least...) add the code that will display the preferences layout to the SetPrefs.java file:  @Override     public void onCreate(Bundle savedInstanceState) {      super.onCreate(savedInstanceState);      addPreferencesFromResource(R.xml.preferences);      } OK, so now we've got an activity that will set preferences, and save them without the need to write custom save code. Let's throw together an activity to work with the saved preferences. Create a new layout called showpreferences.xml and give it three Textviews: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"     android:orientation="vertical"     android:layout_width="fill_parent"     android:layout_height="fill_parent"> <TextView   android:id="@+id/textview1"     android:layout_width="fill_parent"     android:layout_height="wrap_content"     android:text="textview1"/> <TextView   android:id="@+id/textview2"     android:layout_width="fill_parent"     android:layout_height="wrap_content"     android:text="textview2"/> <TextView   android:id="@+id/textview3"     android:layout_width="fill_parent"     android:layout_height="wrap_content"     android:text="textview3"/> </LinearLayout> Open up the ShowPrefs.java file and have it use that layout: setContentView(R.layout.showpreferences); Then add the following code to load the DefaultSharedPreferences and display them: SharedPreferences prefs = PreferenceManager.getDefaultSharedPreferences(this);    TextView text1 = (TextView)findViewById(R.id.textview1); TextView text2 = (TextView)findViewById(R.id.textview2); TextView text3 = (TextView)findViewById(R.id.textview3);    text1.setText(new Boolean(prefs.getBoolean("checkboxPref", false)).toString()); text2.setText(prefs.getString("editTextPref", "<unset>"));; text3.setText(prefs.getString("listPref", "<unset>")); Fire up the application in the emulator and click the Edit Preferences button. Set various things, click the back button, then the Edit Preferences button again. Notice that your choices have been saved.   Now click the Show Preferences button, and you should see the results of what you set:   There are two more preference types that I did not include here: RingtonePreference - shows a radioGroup that lists your ringtones PreferenceScreen - allows you to embed a second preference screen inside the first - it opens up a new set of preferences when clicked

    Read the article

  • Advanced Data Source Engine coming to Telerik Reporting Q1 2010

    This is the final blog post from the pre-release series. In it we are going to share with you some of the updates coming to our reporting solution in Q1 2010. A new Declarative Data Source Engine will be added to Telerik Reporting, that will allow full control over data management, and deliver significant gains in rendering performance and memory consumption. Some of the engines new features will be: Data source parameters - those parameters will be used to limit data retrieved from the data source to just the data needed for the report. Data source parameters are processed on the data source side, however only queried data is fetched to the reporting engine, rather than the full data source. This leads to lower memory consumption, because data operations are performed on queried data only, rather than on all data. As a result, only the queried data needs to be stored in the memory vs. the whole dataset, which was the case with the old approach Support for stored procedures - they will assist in achieving a consistent implementation of logic across applications, and are especially practical for performing repetitive tasks. A stored procedure stores the SQL statements and logic, which can then be executed in different reports and/or applications. Stored Procedures will not only save development time, but they will also improve performance, because each stored procedure is compiled on the data base server once, and then is reutilized. In Telerik Reporting, the stored procedure will also be parameterized, where elements of the SQL statement will be bound to parameters. These parameterized SQL queries will be handled through the data source parameters, and are evaluated at run time. Using parameterized SQL queries will improve the performance and decrease the memory footprint of your application, because they will be applied directly on the database server and only the necessary data will be downloaded on the middle tier or client machine; Calculated fields through expressions - with the help of the new reporting engine you will be able to use field values in formulas to come up with a calculated field. A calculated field is a user defined field that is computed "on the fly" and does not exist in the data source, but can perform calculations using the data of the data source object it belongs to. Calculated fields are very handy for adding frequently used formulas to your reports; Improved performance and optimized in-memory OLAP engine - the new data source will come with several improvements in how aggregates are calculated, and memory is managed. As a result, you may experience between 30% (for simpler reports) and 400% (for calculation-intensive reports) in rendering performance, and about 50% decrease in memory consumption. Full design time support through wizards - Declarative data sources are a great advance and will save developers countless hours of coding. In Q1 2010, and true to Telerik Reportings essence, using the new data source engine and its features requires little to no coding, because we have extended most of the wizards to support the new functionality. The newly extended wizards are available in VS2005/VS2008/VS2010 design-time. More features will be revealed on the product's what's new page when the new version is officially released in a few days. Also make sure you attend the free webinar on Thursday, March 11th that will be dedicated to the updates in Telerik Reporting Q1 2010. Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Getting Started with ASP.NET Membership, Profile and RoleManager

    - by Ben Griswold
    A new ASP.NET MVC project includes preconfigured Membership, Profile and RoleManager providers right out of the box.  Try it yourself – create a ASP.NET MVC application, crack open the web.config file and have a look.  First, you’ll find the ApplicationServices database connection: <connectionStrings>   <add name="ApplicationServices"        connectionString="data source=.\SQLEXPRESS;Integrated Security=SSPI;AttachDBFilename=|DataDirectory|aspnetdb.mdf;User Instance=true"        providerName="System.Data.SqlClient"/> </connectionStrings>   Notice the connection string is referencing the aspnetdb.mdf database hosted by SQL Express and it’s using integrated security so it’ll just work for you without having to call out a specific database login or anything. Scroll down the file a bit and you’ll find each of the three noted sections: <membership>   <providers>     <clear/>     <add name="AspNetSqlMembershipProvider"          type="System.Web.Security.SqlMembershipProvider, System.Web, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"          connectionStringName="ApplicationServices"          enablePasswordRetrieval="false"          enablePasswordReset="true"          requiresQuestionAndAnswer="false"          requiresUniqueEmail="false"          passwordFormat="Hashed"          maxInvalidPasswordAttempts="5"          minRequiredPasswordLength="6"          minRequiredNonalphanumericCharacters="0"          passwordAttemptWindow="10"          passwordStrengthRegularExpression=""          applicationName="/"             />   </providers> </membership>   <profile>   <providers>     <clear/>     <add name="AspNetSqlProfileProvider"          type="System.Web.Profile.SqlProfileProvider, System.Web, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"          connectionStringName="ApplicationServices"          applicationName="/"             />   </providers> </profile>   <roleManager enabled="false">   <providers>     <clear />     <add connectionStringName="ApplicationServices" applicationName="/" name="AspNetSqlRoleProvider" type="System.Web.Security.SqlRoleProvider, System.Web, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a" />     <add applicationName="/" name="AspNetWindowsTokenRoleProvider" type="System.Web.Security.WindowsTokenRoleProvider, System.Web, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a" />   </providers> </roleManager> Really. It’s all there. Still don’t believe me.  Run the application, walk through the registration process and finally login and logout.  Completely functional – and you didn’t have to do a thing! What else?  Well, you can manage your users via the Configuration Manager which is hiding in Visual Studio behind Projects > ASP.NET Configuration. The ASP.NET Web Site Administration Tool isn’t MVC-specific (neither is the Membership, Profile or RoleManager stuff) but it’s neat and I hardly ever see anyone using it.  Here you can set up and edit users, roles, and set access permissions for your site. You can manage application settings, establish your SMTP settings, configure debugging and tracing, define default error page and even take your application offline.  The UI is rather plain-Jane but it works great. And here’s the best of all.  Let’s say you, like most of us, don’t want to run your application on top of the aspnetdb.mdf database.  Let’s suppose you want to use your own database and you’d like to add the membership stuff to it.  Well, that’s easy enough. Take a look inside your [drive:]\%windir%\Microsoft.Net\Framework\v2.0.50727\ folder.  Here you’ll find a bunch of files.  If you were to run the InstallCommon.sql, InstallMembership.sql, InstallRoles.sql and InstallProfile.sql files against the database of your choices, you’d be installing the same membership, profile and role artifacts which are found in the aspnet.db to your own database.  Too much trouble?  Okay. Run [drive:]\%windir%\Microsoft.Net\Framework\v2.0.50727\aspnet_regsql.exe from the command line instead.  This will launch the ASP.NET SQL Server Setup Wizard which walks you through the installation of those same database objects into the new or existing database of your choice. You may not always have the luxury of using this tool on your destination server, but you should use it whenever you can.  Last tip: don’t forget to update the ApplicationServices connectionstring to point to your custom database after the setup is complete. At the risk of sounding like a smarty, everything I’ve mentioned in this post has been around for quite a while. The thing is that not everyone has had the opportunity to use it.  And it makes sense. I know I’ve worked on projects which used custom membership services.  Why bother with the out-of-the-box stuff, right?   And the .NET framework is so massive, who can know it all. Well, eventually you might have a chance to architect your own solution using any implementation you’d like or you will have the time to play around with another aspect of the framework.  When you do, think back to this post.

    Read the article

  • Thursday Community Keynote: "By the Community, For the Community"

    - by Janice J. Heiss
    Sharat Chander, JavaOne Community Chairperson, began Thursday's Community Keynote. As part of the morning’s theme of "By the Community, For the Community," Chander noted that 60% of the material at the 2012 JavaOne conference was presented by Java Community members. "So next year, when the call for papers starts, put-in your submissions," he urged.From there, Gary Frost, Principal Member of Technical Staff, AMD, expanded upon Sunday's Strategy Keynote exploration of Project Sumatra, an OpenJDK project targeted at bringing Java to heterogeneous computing platforms (which combine the CPU and the parallel processor of the GPU into a single piece of silicon). Sumatra entails enhancing the JVM to make maximum use of these advanced platforms. Within this development space, AMD created the Aparapi API, which converts Java bytecode into OpenCL for execution on such GPU devices. The Aparapi API was open sourced in September 2011.Whether it was zooming-in on a Mandelbrot set, "the game of life," or a swarm of 10,000 Dukes in a space-bound gravitational dance, Frost's demos, using an Aparapi/OpenCL implementation, produced stunningly faster display results. He indicated that the Java 9 timeframe is where they see Project Sumatra coming to ultimate fruition, employing the Lamdas of Java 8.Returning to the theme of the keynote, Donald Smith, Director, Java Product Management, Oracle, explored a mind map graphic demonstrating the importance of Community in terms of fostering innovation. "It's the sharing and mixing of culture, the diversity, and the rapid prototyping," he said. Within this topic, Smith, brought up a panel of representatives from Cloudera, Eclipse, Eucalyptus, Perrone Robotics, and Twitter--ideal manifestations of community and innovation in the world of Java.Marten Mickos, CEO, Eucalyptus Systems, explored his company's open source cloud software platform, written in Java, and used by gaming companies, technology companies, media companies, and more. Chris Aniszczyk, Operations Engineering,Twitter, noted the importance of the JVM in terms of their multiple-language development environment. Mike Olson, CEO, Cloudera, described his company's Apache Hadoop-based software, support, and training. Mike Milinkovich, Executive Director, Eclipse Foundation, noted that they have about 270 tools projects at Eclipse, with 267 of them written in Java. Milinkovich added that Eclipse will even be going into space in 2013, as part of the control software on various experiments aboard the International Space Station. Lastly, Paul Perrone, CEO, Perrone Robotics, detailed his company's robotics and automation software platform built 100% on Java, including Java SE and Java ME--"on rat, to cat, to elephant-sized systems." Milinkovic noted that communities are by nature so good at innovation because of their very openness--"The more open you make your innovation process, the more ideas are challenged, and the more developers are focused on justifying their choices all the way through the process."From there, Georges Saab, VP Development Java SE OpenJDK, continued the topic of innovation and helping the Java Community to "Make the Future Java." Martijn Verburg, representing the London Java Community (winner of a Duke's Choice Award 2012 for their activity in OpenJDK and JCP), soon joined Saab onstage. Verburg detailed the LJC's "Adopt a JSR" program--"to get day-to-day developers more involved in the innovation that's happening around them."  From its London launching pad, the innovative program has spread to Brazil, Morocco, Latvia, India, and more.Other active participants in the program joined Verburg onstage--Ben Evans, London Java Community; James Gough, Stackthread; Bruno Souza, SOUJava; Richard Warburton, jClarity; and Cecelia Borg, Oracle--OpenJDK Onboarding. Together, the group explored the goals and tasks inherent in the Adopt a JSR program--from organizing hack days (testing prototype implementations), to managing mailing lists and forums, to triaging issues, to evangelism—all with the goal of fostering greater community/developer involvement, but equally importantly, building better open standards. “Come join us, and make your ecosystem better!" urged Verburg.Paul Perrone returned to profile the latest in his company's robotics work around Java--including the AARDBOTS family of smaller robotic vehicles, running the Perrone MAX platform on top of the Java JVM. Perrone took his "Rumbles" four-wheeled robot out for a spin onstage--a roaming, ARM-based security-bot vehicle, complete with IR, ultrasonic, and "cliff" sensors (the latter, for the raised stage at JavaOne). As an ultimate window into the future of robotics, Perrone displayed a "head-set" controller--a sensor directed at the forehead to monitor brainwaves, for the someday-implementation of brain-to-robot control.Then, just when it seemed this might be the end of the day's futuristic offerings, a mystery voice from offstage pronounced "I've got some toys"--proving to be guest-visitor James Gosling, there to explore his cutting-edge work with Liquid Robotics. While most think of robots as something with wheels or arms or lasers, Gosling explained, the Liquid Robotics vehicle is an entirely new and innovative ocean-going 'bot. Looking like a floating surfboard, with an attached set of underwater wings, the autonomous devices roam the oceans using only the energy of ocean waves to propel them, and a single actuated rudder to steer. "We have to accomplish all guidance just by wiggling the rudder," Gosling said. The devices offer applications from self-installing weather buoy, to pollution monitoring station, to marine mammal monitoring device, to climate change data gathering, to even ocean life genomic sampling. The early versions of the vehicle used C code on very tiny industrial micro controllers, where they had to "count the bytes one at a time."  But the latest generation vehicles, which just hit the water a week or so ago, employ an ARM processor running Linux and the ARM version of JDK 7. Gosling explained that vehicle communication from remote locations is achieved via the Iridium satellite network. But because of the costs of this communication path, the data must be sent in very small bursts--using SBD short burst data. "It costs $1/kb, so that rules everything in the software design,” said Gosling. “If you were trying to stream a Netflix video over this, it would cost a million dollars a movie. …We don't have a 'big data' problem," he quipped. There are currently about 150 Liquid Robotics vehicles out traversing the oceans. Gosling demonstrated real time satellite tracking of several vehicles currently at sea, noting that Java is actually particularly good at AI applications--due to the language having garbage collection, which facilitates complex data structures. To close-out his time onstage, Gosling of course participated in the ceremonial Java tee-shirt toss out to the audience…In parting, Chander passed the JavaOne Community Chairperson baton to Stephen Chin, Java Technology Evangelist, Oracle. Onstage in full motorcycle gear, Chin noted that he'll soon be touring Europe by motorcycle, meeting Java Community Members and streaming live via UStream--the ultimate manifestation of community and technology!  He also reminded attendees of the upcoming JavaOne Latin America 2012, São Paulo, Brazil (December 4-6, 2012), and stated that the CFP (call for papers) at the conference has been extended for one more week. "Remember, December is summer in Brazil!" Chin said.

    Read the article

  • dasBlog

    - by Daniel Moth
    Some people like blogging on a site that is completely managed by someone else (e.g. http://wordpress.com/) and others, like me, prefer hosting their own blog at their own domain. In the latter case you need to decide what blog engine to install on your web space to power your blog. There are many free blog engines to choose from (e.g. the one from http://wordpress.org/). If, like me, you want to use a blog engine that is based on the .NET platform you have many choices including BlogEngine.NET, Subtext and the one I picked: dasBlog. In this post I'll describe the steps I took to get going with the open source dasBlog (home page, source page). A. Installing First I installed dasBlog on my local Windows 7 machine where I have IIS7 installed. To install dasBlog, I started by clicking the "Install" button on its web gallery page. After that I went through configuration, theming and adding content as described below. Once I was happy that everything was working correctly on the local machine, I set this up on a hosting service. I went for a Windows IIS7 shared hosting 3 month Economy plan from GoDaddy. The dasBlog site lists a bunch of other hosts. You can read the installation instructions for dasBlog, and with GoDaddy I just had to click one button since it is available as part of their quick-install apps. With GoDaddy I had a previewdns option that allowed me to play around and preview my site before going live. B. Configuring After it was installed (on local machine and/or hosting provider), I followed the obvious steps to create an admin user and logged in. This displays an admin navigation bar with the following options: 1. Navigator Links: I decided I was not going to use this feature. I manage links on the side of my blog manually elsewhere as part of the theme. So, I deleted every entry on this page and ignored it thereafter. 2. Blogroll: Ditto - same comment as for Navigator Links. 3. Content Filters: I did not delete (or add) these, but I did ensure both checkboxes are not checked. I.e. I am not using this feature now, but I may return to it in the future. 4. Activity: This is a read-only view of various statistics. So nothing to configure here, but useful to come back to for complementary statistics to whatever other statistical package you use (e.g. free stats as part of the hosting and I also use feedburner for syndication stats). 5. Cross-posting: I did not need that, so I turned it off via the Configuration Settings discussed next. 6. Configuration Settings: This is where the bulk of the configuration for the blog takes place and they are stored in a single XML file: Site.Config file. There are truly self-explanatory options to pick for Basic Settings, Services Settings and Services to Ping, Syndication Settings (this is where you link to your feedburner name if you have one) and Mail to Weblog Settings (I keep this turned off). There are also "Xml Storage System Settings" (I keep this turned off), "OpenId Settings" (I allow OpenID commenters), "Spammer Settings" (Enable captcha, never show email addresses) and "Comment settings" (Enable comments, don't allow on older posts, don't allow html). There are also Appearance Settings (I checked the "Use Post Title for Permalink", replaced spaces with hyphen and unchecked the "Use Unique Title"). Finally, there are also Notification Settings, but they are a bit of hit and miss in my case, in that I don’t always get the emails (still investigating this). C. Adding Content You can add content via the "Add Entry" link on the admin navigation bar or by configuring the "Mail to Weblog" settings and sending email or, do what I've started doing, use Live Writer (also the team has a blog). Another way to add content is programmatically if, for example, you are migrating content from another blog (and I'll cover that in separate post sharing the code). What you should know is that all blog content (posts and comments) live in XML files in a folder called "content" under your dasBlog installation. D. Theming There is a very good guide about themes for dasBlog, there is also a similar guide with screenshots (scroll down to "So how do I create a theme") and the dasBlog macro reference. When you install dasBlog, there are many themes available; each theme is in its own folder (representing the folder name) under the themes folder. You may have noticed that you can switch between these via the "Appearance Settings" described above (look for the combobox after the Default Theme label). I created my own theme by copy-pasting an existing theme folder, renaming it and then switching to it as the default. I then opened the folder in Visual Studio and hacked around the HTML in the 3 files (itemTemplate, homeTemplate and dayTemplate). These files have a blogtemplate file extension, which I temporarily renamed to HTML as I was editing them. There is no more advice I can offer here as this is a matter of taste and the aforementioned links is all I used. Personally, I had salvaged the CSS (and structure) from my previous blog and wanted to make this one match it as closely as possible - I think I have succeeded. E. If you run into any issue with dasBlog... ...use your favorite search engine to find answers. Many bloggers have been using this engine for a while and have documented issues and workarounds over time. One such example is ScottHa's dasBlog category; another example is therightstuff where I "borrowed" the idea/macro for the outlook-style on-page navigation. If you don't find what you want through searching, try posting a question to the forums. Comments about this post welcome at the original blog.

    Read the article

  • Change or Reset Windows Password from a Ubuntu Live CD

    - by Trevor Bekolay
    If you can’t log in even after trying your twelve passwords, or you’ve inherited a computer complete with password-protected profiles, worry not – you don’t have to do a fresh install of Windows. We’ll show you how to change or reset your Windows password from a Ubuntu Live CD. This method works for all of the NT-based version of Windows – anything from Windows 2000 and later, basically. And yes, that includes Windows 7. You’ll need a Ubuntu 9.10 Live CD, or a bootable Ubuntu 9.10 Flash Drive. If you don’t have one, or have forgotten how to boot from the flash drive, check out our article on creating a bootable Ubuntu 9.10 flash drive. The program that lets us manipulate Windows passwords is called chntpw. The steps to install it are different in 32-bit and 64-bit versions of Ubuntu. Installation: 32-bit Open up Synaptic Package Manager by clicking on System at the top of the screen, expanding the Administration section, and clicking on Synaptic Package Manager. chntpw is found in the universe repository. Repositories are a way for Ubuntu to group software together so that users are able to choose if they want to use only completely open source software maintained by Ubuntu developers, or branch out and use software with different licenses and maintainers. To enable software from the universe repository, click on Settings > Repositories in the Synaptic window. Add a checkmark beside the box labeled “Community-maintained Open Source software (universe)” and then click close. When you change the repositories you are selecting software from, you have to reload the list of available software. In the main Synaptic window, click on the Reload button. The software lists will be downloaded. Once downloaded, Synaptic must rebuild its search index. The label over the text field by the Search button will read “Rebuilding search index.” When it reads “Quick search,” type chntpw in the text field. The package will show up in the list. Click on the checkbox near the chntpw name. Click on Mark for Installation. chntpw won’t actually be installed until you apply the changes you’ve made, so click on the Apply button in the Synaptic window now. You will be prompted to accept the changes. Click Apply. The changes should be applied quickly. When they’re done, click Close. chntpw is now installed! You can close Synaptic Package Manager. Skip to the section titled Using chntpw to reset your password. Installation: 64-bit The version of chntpw available in Ubuntu’s universe repository will not work properly on a 64-bit machine. Fortunately, a patched version exists in Debian’s Unstable branch, so let’s download it from there and install it manually. Open Firefox. Whether it’s your preferred browser or not, it’s very readily accessible in the Ubuntu Live CD environment, so it will be the easiest to use. There’s a shortcut to Firefox in the top panel. Navigate to http://packages.debian.org/sid/amd64/chntpw/download and download the latest version of chntpw for 64-bit machines. Note: In most cases it would be best to add the Debian Unstable branch to a package manager, but since the Live CD environment will revert to its original state once you reboot, it’ll be faster to just download the .deb file. Save the .deb file to the default location. You can close Firefox if desired. Open a terminal window by clicking on Applications at the top-left of the screen, expanding the Accessories folder, and clicking on Terminal. In the terminal window, enter the following text, hitting enter after each line: cd Downloadssudo dpkg –i chntpw* chntpw will now be installed. Using chntpw to reset your password Before running chntpw, you will have to mount the hard drive that contains your Windows installation. In most cases, Ubuntu 9.10 makes this simple. Click on Places at the top-left of the screen. If your Windows drive is easily identifiable – usually by its size – then left click on it. If it is not obvious, then click on Computer and check out each hard drive until you find the correct one. The correct hard drive will have the WINDOWS folder in it. When you find it, make a note of the drive’s label that appears in the menu bar of the file browser. If you don’t already have one open, start a terminal window by going to Applications > Accessories > Terminal. In the terminal window, enter the commands cd /medials pressing enter after each line. You should see one or more strings of text appear; one of those strings should correspond with the string that appeared in the title bar of the file browser earlier. Change to that directory by entering the command cd <hard drive label> Since the hard drive label will be very annoying to type in, you can use a shortcut by typing in the first few letters or numbers of the drive label (capitalization matters) and pressing the Tab key. It will automatically complete the rest of the string (if those first few letters or numbers are unique). We want to switch to a certain Windows directory. Enter the command: cd WINDOWS/system32/config/ Again, you can use tab-completion to speed up entering this command. To change or reset the administrator password, enter: sudo chntpw SAM SAM is the file that contains your Windows registry. You will see some text appear, including a list of all of the users on your system. At the bottom of the terminal window, you should see a prompt that begins with “User Edit Menu:” and offers four choices. We recommend that you clear the password to blank (you can always set a new password in Windows once you log in). To do this, enter “1” and then “y” to confirm. If you would like to change the password instead, enter “2”, then your desired password, and finally “y” to confirm. If you would like to reset or change the password of a user other than the administrator, enter: sudo chntpw –u <username> SAM From here, you can follow the same steps as before: enter “1” to reset the password to blank, or “2” to change it to a value you provide. And that’s it! Conclusion chntpw is a very useful utility provided for free by the open source community. It may make you think twice about how secure the Windows login system is, but knowing how to use chntpw can save your tail if your memory fails you two or eight times! Similar Articles Productive Geek Tips Reset Your Ubuntu Password Easily from the Live CDChange Your Forgotten Windows Password with the Linux System Rescue CDHow to Create and Use a Password Reset Disk in Windows Vista & Windows 7Reset Your Forgotten Password the Easy Way Using the Ultimate Boot CD for WindowsHow to install Spotify in Ubuntu 9.10 using Wine TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Add a Custom Title in IE using Spybot or Spyware Blaster When You Need to Hail a Taxi in NYC Live Map of Marine Traffic NoSquint Remembers Site Specific Zoom Levels (Firefox) New Firefox release 3.6.3 fixes 1 Critical bug Dark Side of the Moon (8-bit)

    Read the article

  • Validating a linked item&rsquo;s data template in Sitecore

    - by Kyle Burns
    I’ve been doing quite a bit of work in Sitecore recently and last week I encountered a situation that it appears many others have hit.  I was working with a field that had been configured originally as a grouped droplink, but now needed to be updated to support additional levels of hierarchy in the folder structure.  If you’ve done any work in Sitecore that statement makes sense, but if not it may seem a bit cryptic.  Sitecore offers a number of different field types and a subset of these field types focus on providing links either to other items on the content tree or to content that is not stored in Sitecore.  In the case of the grouped droplink, the field is configured with a “root” folder and each direct descendant of this folder is considered to be a header for a grouping of other items and displayed in a dropdown.  A picture is worth a thousand words, so consider the following piece of a content tree: If I configure a grouped droplink field to use the “Current” folder as its datasource, the control that gets to my content author looks like this: This presents a nicely organized display and limits the user to selecting only the direct grandchildren of the folder root.  It also presents the limitation that struck as we were thinking through the content architecture and how it would hold up over time – the authors cannot further organize content under the root folder because of the structure required for the dropdown to work.  Over time, not allowing the hierarchy to go any deeper would prevent out authors from being able to organize their content in a way that it would be found when needed, so the grouped droplink data type was not going to fit the bill. I needed to look for an alternative data type that allowed for selection of a single item and limited my choices to descendants of a specific node on the content tree.  After looking at the options available for links in Sitecore and considering them against each other, one option stood out as nearly perfect – the droptree.  This field type stores its data identically to the droplink and allows for the selection of zero or one items under a specific node in the content tree.  By changing my data template to use droptree instead of grouped droplink, the author is now presented with the following when selecting a linked item: Sounds great, but a did say almost perfect – there’s still one flaw.  The code intended to display the linked item is expecting the selection to use a specific data template (or more precisely it makes certain assumptions about the fields that will be present), but the droptree does nothing to prevent the author from selecting a folder (since folders are items too) instead of one of the items contained within a folder.  I looked to see if anyone had already solved this problem.  I found many people discussing the problem, but the closest that I found to a solution was the statement “the best thing would probably be to create a custom validator” with no further discussion in regards to what this validator might look like.  I needed to create my own validator to ensure that the user had not selected a folder.  Since so many people had the same issue, I decided to make the validator as reusable as possible and share it here. The validator that I created inherits from StandardValidator.  In order to make the validator more intuitive to developers that are familiar with the TreeList controls in Sitecore, I chose to implement the following parameters: ExcludeTemplatesForSelection – serves as a “deny list”.  If the data template of the selected item is in this list it will not validate IncludeTemplatesForSelection – this can either be empty to indicate that any template not contained in the exclusion list is acceptable or it can contain the list of acceptable templates Now that I’ve explained the parameters and the purpose of the validator, I’ll let the code do the rest of the talking: 1: /// <summary> 2: /// Validates that a link field value meets template requirements 3: /// specified using the following parameters: 4: /// - ExcludeTemplatesForSelection: If present, the item being 5: /// based on an excluded template will cause validation to fail. 6: /// - IncludeTemplatesForSelection: If present, the item not being 7: /// based on an included template will cause validation to fail 8: /// 9: /// ExcludeTemplatesForSelection trumps IncludeTemplatesForSelection 10: /// if the same value appears in both lists. Lists are comma seperated 11: /// </summary> 12: [Serializable] 13: public class LinkItemTemplateValidator : StandardValidator 14: { 15: public LinkItemTemplateValidator() 16: { 17: } 18:   19: /// <summary> 20: /// Serialization constructor is required by the runtime 21: /// </summary> 22: /// <param name="info"></param> 23: /// <param name="context"></param> 24: public LinkItemTemplateValidator(SerializationInfo info, StreamingContext context) : base(info, context) { } 25:   26: /// <summary> 27: /// Returns whether the linked item meets the template 28: /// constraints specified in the parameters 29: /// </summary> 30: /// <returns> 31: /// The result of the evaluation. 32: /// </returns> 33: protected override ValidatorResult Evaluate() 34: { 35: if (string.IsNullOrWhiteSpace(ControlValidationValue)) 36: { 37: return ValidatorResult.Valid; // let "required" validation handle 38: } 39:   40: var excludeString = Parameters["ExcludeTemplatesForSelection"]; 41: var includeString = Parameters["IncludeTemplatesForSelection"]; 42: if (string.IsNullOrWhiteSpace(excludeString) && string.IsNullOrWhiteSpace(includeString)) 43: { 44: return ValidatorResult.Valid; // "allow anything" if no params 45: } 46:   47: Guid linkedItemGuid; 48: if (!Guid.TryParse(ControlValidationValue, out linkedItemGuid)) 49: { 50: return ValidatorResult.Valid; // probably put validator on wrong field 51: } 52:   53: var item = GetItem(); 54: var linkedItem = item.Database.GetItem(new ID(linkedItemGuid)); 55:   56: if (linkedItem == null) 57: { 58: return ValidatorResult.Valid; // this validator isn't for broken links 59: } 60:   61: var exclusionList = (excludeString ?? string.Empty).Split(','); 62: var inclusionList = (includeString ?? string.Empty).Split(','); 63:   64: if ((inclusionList.Length == 0 || inclusionList.Contains(linkedItem.TemplateName)) 65: && !exclusionList.Contains(linkedItem.TemplateName)) 66: { 67: return ValidatorResult.Valid; 68: } 69:   70: Text = GetText("The field \"{0}\" specifies an item which is based on template \"{1}\". This template is not valid for selection", GetFieldDisplayName(), linkedItem.TemplateName); 71:   72: return GetFailedResult(ValidatorResult.FatalError); 73: } 74:   75: protected override ValidatorResult GetMaxValidatorResult() 76: { 77: return ValidatorResult.FatalError; 78: } 79:   80: public override string Name 81: { 82: get { return @"LinkItemTemplateValidator"; } 83: } 84: }   In this blog entry, I have shared some code that I found useful in solving a problem that seemed fairly common.  Hopefully the next person that is looking for this answer finds it useful as well.

    Read the article

  • POP Forums v9 Beta 1 for ASP.NET MVC 3 posted to CodePlex!

    - by Jeff
    As promised, I posted a beta build of my forum app for ASP.NET MVC 3. Get the new goodies here: http://popforums.codeplex.com/releases/view/58228 This is the first beta for the ASP.NET MVC 3 version of POP Forums. It is nearly feature complete, and ready for testing and feedback. For previous release notes, look here, here and here.Check out the live preview: http://preview.popforums.com/ForumsSetup instructions are on the home page of this project. The new hotness in the beta, or what has been done since the last preview: All views converted to use Razor E-mail subscription/notification of new posts New post indicators/mark read buttons Permalinks to posts Jump to newest post (from new post indicators) Recent topics Favorite topics Moderator functions for topics (pin/close/delete, plus move and rename) Search, ported from v8. Not a ton of optimization here, or new unit testing, but the old version worked pretty well User posts (topics the user posted in) Forgot password Vanity items (signatures and avatars) Hide vanity items per user preference Some minor data caching where appropriate A little bit of UI refinement Lots-o-bug fixes Lots-o-unit tests What's next? The plan between now and the next beta is as follows: Continue working through features/tasks, and fix bugs as they're reported Integrate the forum into a real, production site Refine the UI Refactor as much as possible... the code organization is not entirely logical in some places After the second beta, a release candidate will follow, with a real "final" release after that. Subsequent releases should come relatively frequently and without a lot of risk. The trick in building this thing has been that it mostly tossed the previous WebForms version, which was all full of crusties. The time table for this is a little harder to pin down, as day jobs and families will have their effect. Other notes Refactoring will be a priority. As the features of MVC have evolved, so have my desires to use it in a fashion that makes things clear and easy to follow. I don't even know if anyone will ever start mucking around in the code, but on the off chance they do, I'd like what they find to not suck. Other nice-to-haves are builds to target Windows Azure and SQL CE. A nice setup UI would be super too. I think the ASP.NET MVC world has gone long enough without a decent forum.The biggest challenge that I've found is making the forum something that can be dropped in any app. While it does rope its views into an area, areas are mostly just routing details. I haven't thought of a clever way yet to limit dependency injection, for example, to just the forum bits. I mean, everyone should be using Ninject, but how realistic is that? ;)How much time and effort should you spend on POP Forums in its current state? Change is inevitable, but at this point I'm reasonably committed to not changing the database schema. I really think it will stay as-is. All bets are off for the various interfaces throughout the app, but the data should generally resist change. It's not even that different from v8, which was one of the original goals because I didn't want to rewrite SQL or introduce a new ORM or whatever. My point is that if you wanted to build a site around this today, even though it's not entirely functional, I think it's low risk in terms of data loss. I can't vouch for whether or not you know what you're doing.I've been having some chats with people lately about quoting posts, and honestly there has to be something better and straight forward. That continues to be a holy grail of mine, and some day, I hope to find it.Enjoy... it's starting to feel more real every day!

    Read the article

< Previous Page | 192 193 194 195 196 197 198 199 200 201 202 203  | Next Page >