Search Results

Search found 5885 results on 236 pages for 'finally'.

Page 197/236 | < Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • how to check if internal storage file has any data

    - by user3720291
    public class Save extends Activity { int levels = 2; int data_block = 1024; //char[] data = new char[] {'0', '0'}; String blankval = "0"; String targetval = "0"; String temp; String tempwrite; String string = "null"; TextView tex1; TextView tex2; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.save); Intent intent = getIntent(); Bundle b = intent.getExtras(); tex1 = (TextView) findViewById(R.id.textView1); tex2 = (TextView) findViewById(R.id.textView2); if(b!=null) { string =(String) b.get("string"); } loadprev(); save(); } public void save() { if (string.equals("Blank")) blankval = "1"; if (string.equals("Target")) targetval = "1"; temp = blankval + targetval; try { FileOutputStream fos = openFileOutput("data.gds", MODE_PRIVATE); fos.write(temp.getBytes()); fos.close(); } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} tex1.setText(blankval); tex2.setText(targetval); } public void loadprev() { String final_data = ""; try { FileInputStream fis = openFileInput("data.gds"); InputStreamReader isr = new InputStreamReader(fis); char[] data = new char[data_block]; int size; while((size = isr.read(data))>0) { String read_data = String.copyValueOf(data, 0, size); final_data += read_data; data = new char[data_block]; } } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} char[] tempread = final_data.toCharArray();; blankval = "" + tempread[0]; targetval = "" + tempread[1]; } } After much tinkering i have finally managed to get my save/load function to work, but it does have an error, pretty much i got it to work then i did a fresh reintall deleting data.gds, afterwards the save/load function crashes because the data.gds file has no previous values. can i use a if statment to check if data.gds has any values in it, if so how do i do it and if not, then what could i use instead?

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • vim plugin to show current Perl subroutine

    - by Andrew
    I'm trying to make a vim plugin that will split the window on load and simulate a info bar at the top of my terminal. I've got it sorta working but I think I've either reached limits of my knowledge of vim syntax or there's a logic problem in my code. The desired effect would be to do a reverse search for any declaration of a Perl subroutine form my current location in the active buffer and display the line in the top buffer. I'm also trying to make it skip that buffer when I switch buffers with <C-R>. My attempt at that so far can be seen in the mess of nested if statements. Anyway, here's the code. I would greatly appreciate feedback from anyone. (pastebin pastebin.com/8cuMPn1Q) let s:current_function_bufname = 'Current\ Function\/Subroutine' function! s:get_current_function_name(no_echo) let lnum = line(".") let col = col(".") if a:no_echo let s:current_function_name = getline(search("^[^s]sub .$", 'bW')) else echohl ModeMsg echo getline(search("^[^s]sub .$", 'bW')) "echo getline(search("^[^ \t#/]\{2}.[^:]\s$", 'bW')) echohl None endif endfunction let s:previous_winbufnr = 1 let s:current_function_name = '' let s:current_function_buffer_created = 0 let s:current_function_bufnr = 2 function! s:show_current_function() let total_buffers = winnr('$') let current_winbufnr = winnr() if s:previous_winbufnr != current_winbufnr if bufname(current_winbufnr) == s:current_function_bufname if s:previous_winbufnr < current_winbufnr let i = current_winbufnr + 1 if i total_buffers let i = 1 endif if i == s:current_function_bufnr let i = i + 1 endif if i total buffers let i = 1 endif exec i.'wincmd w' else let i = current_winbufnr - 1 if i < 1 let i = total_buffers endif if i == s:current_function_bufnr let i = i - 1 endif if i < 1 let i = total_buffers endif try exec i.'wincmd w' finally exec total_buffers.'wincmd w' endtry endif endif let s:previous_winbufnr = current_winbufnr return 1 endif if s:current_function_buffer_created == 0 exec 'top 1 split '.s:current_function_bufname call s:set_as_scratch_buffer() let s:current_function_buffer_created = 1 let s:current_function_bufnr = winnr() endif call s:activate_buffer_by_name(s:current_function_bufname) setlocal modifiable call s:get_current_function_name(1) call setline(1, s:current_function_name) setlocal nomodifiable call s:activate_buffer_by_name(bufname(current_winbufnr)) endfunction function! s:set_as_scratch_buffer() setlocal noswapfile setlocal nomodifiable setlocal bufhidden=delete setlocal buftype=nofile setlocal nobuflisted setlocal nonumber setlocal nowrap setlocal cursorline endfunction function! s:activate_buffer_by_name(name) for i in range(1, winnr('$')) let name = bufname(winbufnr(i)) let full_name = fnamemodify(bufname(winbufnr(i)), ':p') if name == a:name || full_name == a:name exec i.'wincmd w' return 1 endif endfor return 0 endfunction set laststatus=2 autocmd! CursorMoved,CursorMovedI,BufWinEnter * call s:show_current_function() (pastebin pastebin.com/8cuMPn1Q) similar to VIM: display custom reference bar on top of window and http://vim.wikia.com/wiki/Show_current_function_name_in_C_programs

    Read the article

  • base64-Encoding breaks smime-encrypted emaildata

    - by Streuner
    I'm using Mime::Lite to create and send E-Mails. Now I need to add support for S/Mime-encryption and finally could encrypt my E-Mail (the only Perllib I could install seems broken, so I'm using a systemcall and openssl smime), but when I try to create a mime-object with it, the E-Mail will be broken as soon as I set the Content-Transfer-Encoding to base64. To make it even more curious, it happens only if I set it via $myMessage->attr. If I'm using the constructor -new everything is fine, besides a little warning which I suppress by using MIME::Lite->quiet(1); Is it a bug or my fault? Here are the two ways how I create the mime-object. Setting the Content-Transfer-Encoding via construtor and suppress the warning: MIME::Lite->quiet(1); my $msgEncr = MIME::Lite->new(From =>'[email protected]', To => '[email protected]', Subject => 'SMIME Test', Data => $myEncryptedMessage, 'Content-Transfer-Encoding' => 'base64'); $msgEncr->attr('Content-Disposition' => 'attachment'); $msgEncr->attr('Content-Disposition.filename' => 'smime.p7m'); $msgEncr->attr('Content-Type' => 'application/x-pkcs7-mime'); $msgEncr->attr('Content-Type.smime-type' => 'enveloped-data'); $msgEncr->attr('Content-Type.name' => 'smime.p7m'); $msgEncr->send; MIME::Lite->quiet(0); Setting the Content-Transfer-Encoding via $myMessage->attr which breaks the encrypted Data, but won't cause a warning: my $msgEncr = MIME::Lite->new(From => '[email protected]', To => '[email protected]', Subject => 'SMIME Test', Data => $myEncryptedMessage); $msgEncr->attr('Content-Disposition' => 'attachment'); $msgEncr->attr('Content-Disposition.filename' => 'smime.p7m'); $msgEncr->attr('Content-Type' => 'application/x-pkcs7-mime'); $msgEncr->attr('Content-Type.smime-type' => 'enveloped-data'); $msgEncr->attr('Content-Type.name' => 'smime.p7m'); $msgEncr->attr('Content-Transfer-Encoding' => 'base64'); $msgEncr->send; I just don't get why my message is broken when I'm using the attribute-setter. Thanks in advance for your help! Besides that i'm unable to attach any file to this E-Mail without breaking the encrypted message again.

    Read the article

  • Android - cant read TXT files from SDcard on real mashine?

    - by JustMe
    Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

    Read the article

  • Objective-C++ Memory Problem

    - by Stephen Furlani
    Hello, I'm having memory woes. I've got a C++ Library (Equalizer from Eyescale) and they use the Traversal Visitor Pattern to allow you to add new functionality to their classes. I've finally figured out how it works, and I've got a Visitor that just returns the properties from one of the objects. (since I don't know how they're allocated). so. My little code does this: VisitorResult AGLContextVisitor::visit( Channel* channel ) { // Search through Nodes, Pipes until we get to the right window. // Add some code to make sure we find the right one? // Not executing the following code as C++ in gdb? eq::Window* w = channel->getWindow(); OSWindow* osw = w->getOSWindow(); AGLWindow* aw = (AGLWindow *)osw; AGLContext agl_ctx = aw->getAGLContext(); this->setContext(agl_ctx); return TRAVERSE_PRUNE; } So here's the problem. eq::Window* w = channel->getWindow(); (gdb) print w 0x0 BUT If I do this: (gdb) set objc-non-blocking-mode off (gdb) print w=channel->getWindow() 0x300effb9 // an honest memory location, and sets w as verified in the Debugger window of XCode. It does the same thing for osw. I don't get it. Why would something work in (gdb) but not in the code? The file is completely a cpp file, but it seems to be running in objc++, since I need to turn blocking off. Help!? I feel like I'm missing some memory-management basic thing here, either with C++ or Obj-C. [edit] channel-getWindow() is supposed to do this: /** @return the parent window. @version 1.0 */ Window* getWindow() { return _window; } The code also executes fine if I run it from a C++-only application. [edit] No... I tried creating a simple stand-alone program since I was tired of running it as a plugin. Messy to debug. And no, it doesn't run in the C++ program either. So I'm really at a loss as to what I'm doing wrong. Thanks, -- Stephen Furlani

    Read the article

  • Problem with continue in While Loop within Try/Catch in C# (2.0)

    - by csharpnoob
    Hi, when i try to use in my ASPX Webpage in the Code Behind this try{ while() { ... db.Open(); readDataMoney = new OleDbCommand("SELECT * FROM Customer WHERE card = '" + customer.card + "';", db).ExecuteReader(); while (readDataMoney.Read()) { try { if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Credit"))) { customer.credit = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Credit")]); } if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Bonus"))) { customer.bonus = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Bonus")]); } } catch (Exception ex) { Connector.writeLog("Money: " + ex.StackTrace + "" + ex.Message + "" + ex.Source); customer.credit = 0.0; customer.credit = 0.0; continue; } finally { } } readDataMoney.Close(); vsiDB.Close(); ... } }catch { continue; } The whole page hangs if there is a problem when the read from db isn't working. I tried to check for !isNull, but same problem. I have a lots of differend MDB Files to process, which are readonly (can't repair/compact) and some or others not. Same Design/Layout of Tables. With good old ASP Classic 3.0 all of them are processing with the "On Resume Next". I know I know. But that's how it is. Can't change the source. So the basic question: So is there any way to tell .NET to continue the loop whatever happens within the try loop if there is any exception? After a lots of wating time i get this exceptions: at System.Data.Common.UnsafeNativeMethods.IDBInitializeInitialize.Invoke(IntPtr pThis) at System.Data.OleDb.DataSourceWrapper.InitializeAndCreateSession(OleDbConnectionString constr, SessionWrapper& sessionWrapper) at System.Data.OleDb.OleDbConnectionInternal..ctor(OleDbConnectionString constr, OleDbConnection connection) at System.Data.OleDb.OleDbConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.CreateNonPooledConnection(DbConnection owningConnection, DbConnectionPoolGroup poolGroup) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.OleDb.OleDbConnection.Open() at GetCustomer(String card)Thread was being aborted.System.Data and System.Runtime.InteropServices.Marshal.ReadInt16(IntPtr ptr, Int32 ofs) System.Data.ProviderBase.DbBuffer.ReadInt16(Int32 offset) System.Data.OleDb.ColumnBinding.Value_I2() System.Data.OleDb.ColumnBinding.Value() System.Data.OleDb.OleDbDataReader.GetValue(Int32 ordinal) System.Data.OleDb.OleDbDataReader.get_Item(Int32 index) Thread was terminated.mscorlib Thanks for any help.

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • 404 with spring 3

    - by markjason72
    hi I am going through my first lessons with spring 3.I created a dynamic web app in eclipse with the following structure. spring3mvc \src\my.spring.HelloWorldController.java \WebContent | |-----WEB-INF\jsp\hello.jsp |-----index.jsp |-----web.xml |-----WEB-INF\spring-servlet.xml |-----WEB-INF\lib\...*.jar files I created the spring-servlet.xml as below <context:component-scan base-package="my.spring" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView" /> <property name="prefix" value="/WEB-INF/jsp/" /> <property name="suffix" value=".jsp" /> </bean> and coded the controller package my.spring; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class HelloWorldController { @RequestMapping("/hello") public ModelAndView helloWorld() { String message = "Hello World, Spring 3.0!"; return new ModelAndView("hello", "message", message); } } index.jsp has a link to hello view <html> <body> <a href="hello.html">Say Hello</a> </body> </html> finally in hello.jsp I have put <html> <body> ${message} </body> </html> My web.xml has <display-name>Spring3MVC</display-name> <welcome-file-list> <welcome-file>index.jsp</welcome-file> </welcome-file-list> <servlet> <servlet-name>spring</servlet-name> <servlet-class> org.springframework.web.servlet.DispatcherServlet </servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>spring</servlet-name> <url-pattern>*.html</url-pattern> </servlet-mapping> When I run the app on Tomcat6 server( thru eclipse),I can see the index page at http://localhost:8080/Spring3MVC/ .It displays the link to hello page.When I click on it(http://localhost:8080/Spring3MVC/hello.html),I get a 404 error. message /Spring3MVC/hello.html description The requested resource (/Spring3MVC/hello.html) is not available. Any idea how I can solve this? thanks mark.

    Read the article

  • Schema to support dynamic properties

    - by Johan Fredrik Varen
    Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Problem separating C++ code in header, inline functions and code.

    - by YuppieNetworking
    Hello all, I have the simplest code that I want to separate in three files: Header file: class and struct declarations. No implementations at all. Inline functions file: implementation of inline methods in header. Code file: normal C++ code for more complicated implementations. When I was about to implement an operator[] method, I couldn't manage to compile it. Here is a minimal example that shows the same problem: Header (myclass.h): #ifndef _MYCLASS_H_ #define _MYCLASS_H_ class MyClass { public: MyClass(const int n); virtual ~MyClass(); double& operator[](const int i); double operator[](const int i) const; void someBigMethod(); private: double* arr; }; #endif /* _MYCLASS_H_ */ Inline functions (myclass-inl.h): #include "myclass.h" inline double& MyClass::operator[](const int i) { return arr[i]; } inline double MyClass::operator[](const int i) const { return arr[i]; } Code (myclass.cpp): #include "myclass.h" #include "myclass-inl.h" #include <iostream> inline MyClass::MyClass(const int n) { arr = new double[n]; } inline MyClass::~MyClass() { delete[] arr; } void MyClass::someBigMethod() { std::cout << "Hello big method that is not inlined" << std::endl; } And finally, a main to test it all: #include "myclass.h" #include <iostream> using namespace std; int main(int argc, char *argv[]) { MyClass m(123); double x = m[1]; m[1] = 1234; cout << "m[1]=" << m[1] << endl; x = x + 1; return 0; } void nothing() { cout << "hello world" << endl; } When I compile it, it says: main.cpp:(.text+0x1b): undefined reference to 'MyClass::MyClass(int)' main.cpp:(.text+0x2f): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x49): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x65): undefined reference to 'MyClass::operator[](int)' However, when I move the main method to the MyClass.cpp file, it works. Could you guys help me spot the problem? Thank you.

    Read the article

  • Killing Mysql processes staying in sleep command.

    - by Shino88
    Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • can't insert arecord in a oracle database using C#

    - by Gya
    try { int val4 = Convert.ToInt32(tbGrupa.Text); string MyConString = "Data Source=**;User ID=******;Password=*****"; OracleConnection conexiune = new OracleConnection(MyConString); OracleCommand comanda = new OracleCommand(); comanda.Connection = conexiune; conexiune.Open(); comanda.Transaction = conexiune.BeginTransaction(); int id_stud = Convert.ToInt16(tbCodStud.Text); string nume = tbNume.Text; string prenume = tbPrenume.Text; string initiala_tatalui = tbInitiala.Text; string email = tbEmail.Text; string facultate = tbFac.Text; int grupa = Convert.ToInt16(tbGrupa.Text); string serie = tbSeria.Text; string forma_de_inv = tbFormaInvatamant.Text; DateTime data_acceptare_coordonare = dateTimePicker1.Value; DateTime data_sustinere_licenta = dateTimePicker2.Value; string sustinere = tbSustinereLicenta.Text; string parola_acces = tbParola.Text; try { comanda.Parameters.AddWithValue("id_stud", id_stud); comanda.Parameters.AddWithValue("nume", nume); comanda.Parameters.AddWithValue("prenume", prenume); comanda.Parameters.AddWithValue("initiala_tatalui", initiala_tatalui); comanda.Parameters.AddWithValue("facultate", facultate); comanda.Parameters.AddWithValue("email", email); comanda.Parameters.AddWithValue("seria", serie); comanda.Parameters.AddWithValue("grupa", grupa); comanda.Parameters.AddWithValue("forma_de_inv", forma_de_inv); comanda.Parameters.AddWithValue("data_acceptare_coordonare", data_acceptare_coordonare); comanda.Parameters.AddWithValue("data_sustinere_licenta", data_sustinere_licenta); comanda.Parameters.AddWithValue("sustinere_licenta", sustinere); comanda.Parameters.AddWithValue("parola_acces", parola_acces); comanda.Transaction.Commit(); MessageBox.Show("Studentul " + tbNume.Text + " " + tbPrenume.Text + " a fost adaugat în baza de date!"); } catch (Exception er) { comanda.Transaction.Rollback(); MessageBox.Show("ER1.1:" + er.Message); MessageBox.Show("ER1.2:" + er.StackTrace); } finally { conexiune.Close(); } } catch (Exception ex) { MessageBox.Show("ER2.1:"+ex.Message); MessageBox.Show("ER2.2:"+ex.StackTrace); } }

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • how SendMailMAPI is adjusted to support multiple file attachments

    - by Tom
    I have this code that sends just one attachment by time, how can I adjust this code to send 1-2 attachments? function SendMailMAPI(const Subject, Body, FileName, SenderName, SenderEMail, RecepientName, RecepientEMail: String) : Integer; var message: TMapiMessage; lpSender, lpRecepient: TMapiRecipDesc; FileAttach: TMapiFileDesc; SM: TFNMapiSendMail; MAPIModule: HModule; begin FillChar(message, SizeOf(message), 0); with message do begin if (Subject<>'') then begin lpszSubject := PChar(Subject) end; if (Body<>'') then begin lpszNoteText := PChar(Body) end; if (SenderEMail<>'') then begin lpSender.ulRecipClass := MAPI_ORIG; if (SenderName='') then begin lpSender.lpszName := PChar(SenderEMail) end else begin lpSender.lpszName := PChar(SenderName) end; lpSender.lpszAddress := PChar('SMTP:'+SenderEMail); lpSender.ulReserved := 0; lpSender.ulEIDSize := 0; lpSender.lpEntryID := nil; lpOriginator := @lpSender; end; if (RecepientEMail<>'') then begin lpRecepient.ulRecipClass := MAPI_TO; if (RecepientName='') then begin lpRecepient.lpszName := PChar(RecepientEMail) end else begin lpRecepient.lpszName := PChar(RecepientName) end; lpRecepient.lpszAddress := PChar('SMTP:'+RecepientEMail); lpRecepient.ulReserved := 0; lpRecepient.ulEIDSize := 0; lpRecepient.lpEntryID := nil; nRecipCount := 1; lpRecips := @lpRecepient; end else begin lpRecips := nil end; if (FileName='') then begin nFileCount := 0; lpFiles := nil; end else begin FillChar(FileAttach, SizeOf(FileAttach), 0); FileAttach.nPosition := Cardinal($FFFFFFFF); FileAttach.lpszPathName := PChar(FileName); nFileCount := 1; lpFiles := @FileAttach; end; end; MAPIModule := LoadLibrary(PChar(MAPIDLL)); if MAPIModule=0 then begin Result := -1 end else begin try @SM := GetProcAddress(MAPIModule, 'MAPISendMail'); if @SM<>nil then begin Result := SM(0, Application.Handle, message, MAPI_DIALOG or MAPI_LOGON_UI, 0); end else begin Result := 1 end; finally FreeLibrary(MAPIModule); end; end; if Result<>0 then begin MessageDlg('Error sending mail ('+IntToStr(Result)+').', mtError, [mbOk], 0) end; end;

    Read the article

  • How to Integrate C++ compiler in Visual Studio 2008

    - by Kasun
    Hi Can someone help me with this issue? I currently working on my project for final year of my honors degree. And we are developing a application to evaluate programming assignments of student ( for 1st year student level) I just want to know how to integrate C++ compiler using C# code to compile C++ code. In our case we are loading a student C++ code into text area, then with a click on button we want to compile the code. And if there any compilation errors it will be displayed on text area nearby. (Interface is attached herewith.) And finally it able to execute the code if there aren't any compilation errors. And results will be displayed in console. We were able to do this with a C#(C# code will be loaded to text area intead of C++ code) code using inbuilt compiler. But still not able to do for C# code. Can anyone suggest a method to do this? It is possible to integrate external compiler to VS C# code? If possible how to achieve it? Very grateful if anyone will contributing to solve this matter? This is code for Build button which we proceed with C# code compiling CodeDomProvider codeProvider = CodeDomProvider.CreateProvider("csharp"); string Output = "Out.exe"; Button ButtonObject = (Button)sender; rtbresult.Text = ""; System.CodeDom.Compiler.CompilerParameters parameters = new CompilerParameters(); //Make sure we generate an EXE, not a DLL parameters.GenerateExecutable = true; parameters.OutputAssembly = Output; CompilerResults results = codeProvider.CompileAssemblyFromSource(parameters, rtbcode.Text); if (results.Errors.Count > 0) { rtbresult.ForeColor = Color.Red; foreach (CompilerError CompErr in results.Errors) { rtbresult.Text = rtbresult.Text + "Line number " + CompErr.Line + ", Error Number: " + CompErr.ErrorNumber + ", '" + CompErr.ErrorText + ";" + Environment.NewLine + Environment.NewLine; } } else { //Successful Compile rtbresult.ForeColor = Color.Blue; rtbresult.Text = "Success!"; //If we clicked run then launch our EXE if (ButtonObject.Text == "Run") Process.Start(Output); // Run button }

    Read the article

  • How to download file into string with progress callback?

    - by Kaminari
    I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

    Read the article

  • .NET datetime issue with SQL stored procedure

    - by DanO
    I am getting the below error when executing my application on a Windows XP machine with .NET 2.0 installed. On my computer Windows 7 .NET 2.0 - 3.5 I am not having any issues. The target SQL server version is 2005. This error started occurring when I added the datetime to the stored procedure. I have been reading alot about using .NET datetime with SQL datetime and I still have not figured this out. If someone can point me in the right direction I would appreciate it. Here is the where I believe the error is coming from. private static void InsertRecon(string computerName, int EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) { SqlConnection DBC = new SqlConnection("server=server;UID=InventoryServer;Password=pass;database=Inventory;connection timeout=30"); SqlCommand CMD = new SqlCommand(); try { CMD.Connection = DBC; CMD.CommandType = CommandType.StoredProcedure; CMD.CommandText = "InsertReconData"; CMD.Parameters.Add("@CNAME", SqlDbType.NVarChar); CMD.Parameters.Add("@ENCRYPTEXIST", SqlDbType.Int); CMD.Parameters.Add("@RUNTIME", SqlDbType.Time); CMD.Parameters.Add("@ENCRYPTSIZE", SqlDbType.BigInt); CMD.Parameters.Add("@TIMEWRITTEN", SqlDbType.DateTime); CMD.Parameters["@CNAME"].Value = computerName; CMD.Parameters["@ENCRYPTEXIST"].Value = EncryptState; CMD.Parameters["@RUNTIME"].Value = FindTime; CMD.Parameters["@ENCRYPTSIZE"].Value = EncryptSize; CMD.Parameters["@TIMEWRITTEN"].Value = timeWritten; DBC.Open(); CMD.ExecuteNonQuery(); } catch (System.Data.SqlClient.SqlException e) { PostMessage(e.Message); } finally { DBC.Close(); CMD.Dispose(); DBC.Dispose(); } } Unhandled Exception: System.ArgumentOutOfRangeException: The SqlDbType enumeration value, 32, is invalid. Parameter name: SqlDbType at System.Data.SqlClient.MetaType.GetMetaTypeFromSqlDbType(SqlDbType target) at System.Data.SqlClient.SqlParameter.set_SqlDbType(SqlDbType value) at System.Data.SqlClient.SqlParameter..ctor(String parameterName, SqlDbType dbType) at System.Data.SqlClient.SqlParameterCollection.Add(String parameterName, SqlDbType sqlDbType) at ReconHelper.getFilesInfo.InsertRecon(String computerName, Int32 EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) at ReconHelper.getFilesInfo.Main(String[] args)

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

< Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >