Search Results

Search found 5885 results on 236 pages for 'finally'.

Page 197/236 | < Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >

  • Hide jQuery Accordion while loading

    - by zac
    I am testing a site build with a slow connection and I noticed the jQuery Accordion stays expanded for a long time, until the rest of the site is loaded, and then finally collapses. Not very pretty. I was wondering how I could keep it collapsed through the loading process and only expand when clicked. I am working with the standalone 1.6 version of the accordion plugin. The basic structure : <div class="sidebar"> <ul id="navigation" class="ui-accordion-container"> <li><a class="head" href="#">1</a> <ul class="sub"> <li><a href="#">1a</a></li> <li><a href="#">2a</a></li> </ul> </li> </ul> </div> and the script jQuery().ready(function(){ jQuery('#navigation').accordion({ active: 'false', header: '.head', navigation: true, animated: 'easeslide', collapsible: true }); }); I tried to hide the elements in the CSS to keep them from appearing while loading but all that achieved is in having them always hidden. Maybe the problem is in the CSS I have a background image in each of the sub menus: #navigation{ margin:0px; margin-left: 10px; padding:0px; text-indent:0px; font-size: 1.1em; width:200px; text-transform: uppercase; padding-bottom: 30px; } #navigation ul{ border-width:0px; margin:0px; padding:0px; text-indent:0px; } #navigation li{ list-style:none outside none; } #navigation li ul{ height:185px; overflow:auto; } #navigation li ul.sub{ background:url('../images/sub.jpg') no-repeat; dispaly: block; } #navigation li li a{ color:#000000; display:block; text-indent:20px; text-decoration: none; padding: 6px 0; } #navigation li li a:hover{ background-color:#FFFF99; color:#FF0000; } Thanks in advance for any advice on how to have this thing run a little smoother and having the accordion always collapsed. -edit - I forgot to mention that I am also hoping for a solution that will allow the nav to still be accessible for those without javscript.

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Opinions on collision detection objects with a moving scene

    - by Evan Teran
    So my question is simple, and I guess it boils down to how anal you want to be about collision detection. To keep things simple, lets assume we're talking about 2D sprites defined by a bounding box. In addition, let's assume that my sprite object has a function to detect collisions like this: S.collidesWith(other); Finally the scene is moving and "walls" in the scene can move, an object may not touch a wall. So a simple implementation might look like this (psuedo code): moveWalls(); moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } The problem with this is that if the sprite and wall move towards each other, depending on the circumstances (such as diagonal moment). They may pass though each other (unlikely but could happen). So I may do this instead. moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } This takes care of the passing through each other issue, but another rare issue comes up. If they are adjacent to each other (literally the next pixel) and both the wall and the sprite are moving left, then I will get an invalid collision since the wall moves, checks for collision (hit) then the sprite is moved. Which seems unfair. In addition, to that, the redundant collision detection feels very inefficient. I could give the player movement priority alleviating the first issue but it is still checking twice. moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } Am I simply over thinking this issue, should this just be chalked up to "it'll happen rare enough that no one will care"? Certainly looking at old sprite based games, I often find situations where the collision detection has subtle flaws, but I figure by now we can do better :-P. What are people's thoughts?

    Read the article

  • Schema to support dynamic properties

    - by Johan Fredrik Varen
    Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • Android - cant read TXT files from SDcard on real mashine?

    - by JustMe
    Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

    Read the article

  • 404 with spring 3

    - by markjason72
    hi I am going through my first lessons with spring 3.I created a dynamic web app in eclipse with the following structure. spring3mvc \src\my.spring.HelloWorldController.java \WebContent | |-----WEB-INF\jsp\hello.jsp |-----index.jsp |-----web.xml |-----WEB-INF\spring-servlet.xml |-----WEB-INF\lib\...*.jar files I created the spring-servlet.xml as below <context:component-scan base-package="my.spring" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView" /> <property name="prefix" value="/WEB-INF/jsp/" /> <property name="suffix" value=".jsp" /> </bean> and coded the controller package my.spring; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class HelloWorldController { @RequestMapping("/hello") public ModelAndView helloWorld() { String message = "Hello World, Spring 3.0!"; return new ModelAndView("hello", "message", message); } } index.jsp has a link to hello view <html> <body> <a href="hello.html">Say Hello</a> </body> </html> finally in hello.jsp I have put <html> <body> ${message} </body> </html> My web.xml has <display-name>Spring3MVC</display-name> <welcome-file-list> <welcome-file>index.jsp</welcome-file> </welcome-file-list> <servlet> <servlet-name>spring</servlet-name> <servlet-class> org.springframework.web.servlet.DispatcherServlet </servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>spring</servlet-name> <url-pattern>*.html</url-pattern> </servlet-mapping> When I run the app on Tomcat6 server( thru eclipse),I can see the index page at http://localhost:8080/Spring3MVC/ .It displays the link to hello page.When I click on it(http://localhost:8080/Spring3MVC/hello.html),I get a 404 error. message /Spring3MVC/hello.html description The requested resource (/Spring3MVC/hello.html) is not available. Any idea how I can solve this? thanks mark.

    Read the article

  • Why are these two sql statements deadlocking? (Deadlock graph + details included).

    - by Pure.Krome
    Hi folks, I've got the following deadlock graph that describes two sql statements that are deadlocking each other. I'm just not sure how to analyse this and then fix up my sql code to prevent this from happening. Main deadlock graph Click here for a bigger image. Left side, details Click here for a bigger image. Right side, details Click here for a bigger image. What is the code doing? I'm reading in a number of files (eg. lets say 3, for this example). Each file contains different data BUT the same type of data. I then insert data into LogEntries table and then (if required) I insert or delete something from the ConnectedClients table. Here's my sql code. using (TransactionScope transactionScope = new TransactionScope()) { _logEntryRepository.InsertOrUpdate(logEntry); // Now, if this log entry was a NewConnection or an LostConnection, then we need to make sure we update the ConnectedClients. if (logEntry.EventType == EventType.NewConnection) { _connectedClientRepository.Insert(new ConnectedClient { LogEntryId = logEntry.LogEntryId }); } // A (PB) BanKick does _NOT_ register a lost connection .. so we need to make sure we handle those scenario's as a LostConnection. if (logEntry.EventType == EventType.LostConnection || logEntry.EventType == EventType.BanKick) { _connectedClientRepository.Delete(logEntry.ClientName, logEntry.ClientIpAndPort); } _unitOfWork.Commit(); transactionScope.Complete(); } Now each file has it's own UnitOfWork instance (which means it has it's own database connection, transaction and repository context). So i'm assuming this means there's 3 different connections to the db all happening at the same time. Finally, this is using Entity Framework as the repository, but please don't let that stop you from having a think about this problem. Using a profiling tool, the Isolation Level is Serializable. I've also tried ReadCommited and ReadUncommited, but they both error :- ReadCommited: same as above. Deadlock. ReadUncommited: different error. EF exception that says it expected some result back, but got nothing. I'm guessing this is the LogEntryId Identity (scope_identity) value that is expected but not retrieve because of the dirty read. Please help! PS. It's Sql Server 2008, btw.

    Read the article

  • Problem separating C++ code in header, inline functions and code.

    - by YuppieNetworking
    Hello all, I have the simplest code that I want to separate in three files: Header file: class and struct declarations. No implementations at all. Inline functions file: implementation of inline methods in header. Code file: normal C++ code for more complicated implementations. When I was about to implement an operator[] method, I couldn't manage to compile it. Here is a minimal example that shows the same problem: Header (myclass.h): #ifndef _MYCLASS_H_ #define _MYCLASS_H_ class MyClass { public: MyClass(const int n); virtual ~MyClass(); double& operator[](const int i); double operator[](const int i) const; void someBigMethod(); private: double* arr; }; #endif /* _MYCLASS_H_ */ Inline functions (myclass-inl.h): #include "myclass.h" inline double& MyClass::operator[](const int i) { return arr[i]; } inline double MyClass::operator[](const int i) const { return arr[i]; } Code (myclass.cpp): #include "myclass.h" #include "myclass-inl.h" #include <iostream> inline MyClass::MyClass(const int n) { arr = new double[n]; } inline MyClass::~MyClass() { delete[] arr; } void MyClass::someBigMethod() { std::cout << "Hello big method that is not inlined" << std::endl; } And finally, a main to test it all: #include "myclass.h" #include <iostream> using namespace std; int main(int argc, char *argv[]) { MyClass m(123); double x = m[1]; m[1] = 1234; cout << "m[1]=" << m[1] << endl; x = x + 1; return 0; } void nothing() { cout << "hello world" << endl; } When I compile it, it says: main.cpp:(.text+0x1b): undefined reference to 'MyClass::MyClass(int)' main.cpp:(.text+0x2f): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x49): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x65): undefined reference to 'MyClass::operator[](int)' However, when I move the main method to the MyClass.cpp file, it works. Could you guys help me spot the problem? Thank you.

    Read the article

  • Objective-C++ Memory Problem

    - by Stephen Furlani
    Hello, I'm having memory woes. I've got a C++ Library (Equalizer from Eyescale) and they use the Traversal Visitor Pattern to allow you to add new functionality to their classes. I've finally figured out how it works, and I've got a Visitor that just returns the properties from one of the objects. (since I don't know how they're allocated). so. My little code does this: VisitorResult AGLContextVisitor::visit( Channel* channel ) { // Search through Nodes, Pipes until we get to the right window. // Add some code to make sure we find the right one? // Not executing the following code as C++ in gdb? eq::Window* w = channel->getWindow(); OSWindow* osw = w->getOSWindow(); AGLWindow* aw = (AGLWindow *)osw; AGLContext agl_ctx = aw->getAGLContext(); this->setContext(agl_ctx); return TRAVERSE_PRUNE; } So here's the problem. eq::Window* w = channel->getWindow(); (gdb) print w 0x0 BUT If I do this: (gdb) set objc-non-blocking-mode off (gdb) print w=channel->getWindow() 0x300effb9 // an honest memory location, and sets w as verified in the Debugger window of XCode. It does the same thing for osw. I don't get it. Why would something work in (gdb) but not in the code? The file is completely a cpp file, but it seems to be running in objc++, since I need to turn blocking off. Help!? I feel like I'm missing some memory-management basic thing here, either with C++ or Obj-C. [edit] channel-getWindow() is supposed to do this: /** @return the parent window. @version 1.0 */ Window* getWindow() { return _window; } The code also executes fine if I run it from a C++-only application. [edit] No... I tried creating a simple stand-alone program since I was tired of running it as a plugin. Messy to debug. And no, it doesn't run in the C++ program either. So I'm really at a loss as to what I'm doing wrong. Thanks, -- Stephen Furlani

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • can't insert arecord in a oracle database using C#

    - by Gya
    try { int val4 = Convert.ToInt32(tbGrupa.Text); string MyConString = "Data Source=**;User ID=******;Password=*****"; OracleConnection conexiune = new OracleConnection(MyConString); OracleCommand comanda = new OracleCommand(); comanda.Connection = conexiune; conexiune.Open(); comanda.Transaction = conexiune.BeginTransaction(); int id_stud = Convert.ToInt16(tbCodStud.Text); string nume = tbNume.Text; string prenume = tbPrenume.Text; string initiala_tatalui = tbInitiala.Text; string email = tbEmail.Text; string facultate = tbFac.Text; int grupa = Convert.ToInt16(tbGrupa.Text); string serie = tbSeria.Text; string forma_de_inv = tbFormaInvatamant.Text; DateTime data_acceptare_coordonare = dateTimePicker1.Value; DateTime data_sustinere_licenta = dateTimePicker2.Value; string sustinere = tbSustinereLicenta.Text; string parola_acces = tbParola.Text; try { comanda.Parameters.AddWithValue("id_stud", id_stud); comanda.Parameters.AddWithValue("nume", nume); comanda.Parameters.AddWithValue("prenume", prenume); comanda.Parameters.AddWithValue("initiala_tatalui", initiala_tatalui); comanda.Parameters.AddWithValue("facultate", facultate); comanda.Parameters.AddWithValue("email", email); comanda.Parameters.AddWithValue("seria", serie); comanda.Parameters.AddWithValue("grupa", grupa); comanda.Parameters.AddWithValue("forma_de_inv", forma_de_inv); comanda.Parameters.AddWithValue("data_acceptare_coordonare", data_acceptare_coordonare); comanda.Parameters.AddWithValue("data_sustinere_licenta", data_sustinere_licenta); comanda.Parameters.AddWithValue("sustinere_licenta", sustinere); comanda.Parameters.AddWithValue("parola_acces", parola_acces); comanda.Transaction.Commit(); MessageBox.Show("Studentul " + tbNume.Text + " " + tbPrenume.Text + " a fost adaugat în baza de date!"); } catch (Exception er) { comanda.Transaction.Rollback(); MessageBox.Show("ER1.1:" + er.Message); MessageBox.Show("ER1.2:" + er.StackTrace); } finally { conexiune.Close(); } } catch (Exception ex) { MessageBox.Show("ER2.1:"+ex.Message); MessageBox.Show("ER2.2:"+ex.StackTrace); } }

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • Problem with continue in While Loop within Try/Catch in C# (2.0)

    - by csharpnoob
    Hi, when i try to use in my ASPX Webpage in the Code Behind this try{ while() { ... db.Open(); readDataMoney = new OleDbCommand("SELECT * FROM Customer WHERE card = '" + customer.card + "';", db).ExecuteReader(); while (readDataMoney.Read()) { try { if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Credit"))) { customer.credit = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Credit")]); } if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Bonus"))) { customer.bonus = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Bonus")]); } } catch (Exception ex) { Connector.writeLog("Money: " + ex.StackTrace + "" + ex.Message + "" + ex.Source); customer.credit = 0.0; customer.credit = 0.0; continue; } finally { } } readDataMoney.Close(); vsiDB.Close(); ... } }catch { continue; } The whole page hangs if there is a problem when the read from db isn't working. I tried to check for !isNull, but same problem. I have a lots of differend MDB Files to process, which are readonly (can't repair/compact) and some or others not. Same Design/Layout of Tables. With good old ASP Classic 3.0 all of them are processing with the "On Resume Next". I know I know. But that's how it is. Can't change the source. So the basic question: So is there any way to tell .NET to continue the loop whatever happens within the try loop if there is any exception? After a lots of wating time i get this exceptions: at System.Data.Common.UnsafeNativeMethods.IDBInitializeInitialize.Invoke(IntPtr pThis) at System.Data.OleDb.DataSourceWrapper.InitializeAndCreateSession(OleDbConnectionString constr, SessionWrapper& sessionWrapper) at System.Data.OleDb.OleDbConnectionInternal..ctor(OleDbConnectionString constr, OleDbConnection connection) at System.Data.OleDb.OleDbConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.CreateNonPooledConnection(DbConnection owningConnection, DbConnectionPoolGroup poolGroup) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.OleDb.OleDbConnection.Open() at GetCustomer(String card)Thread was being aborted.System.Data and System.Runtime.InteropServices.Marshal.ReadInt16(IntPtr ptr, Int32 ofs) System.Data.ProviderBase.DbBuffer.ReadInt16(Int32 offset) System.Data.OleDb.ColumnBinding.Value_I2() System.Data.OleDb.ColumnBinding.Value() System.Data.OleDb.OleDbDataReader.GetValue(Int32 ordinal) System.Data.OleDb.OleDbDataReader.get_Item(Int32 index) Thread was terminated.mscorlib Thanks for any help.

    Read the article

  • Killing Mysql processes staying in sleep command.

    - by Shino88
    Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • how SendMailMAPI is adjusted to support multiple file attachments

    - by Tom
    I have this code that sends just one attachment by time, how can I adjust this code to send 1-2 attachments? function SendMailMAPI(const Subject, Body, FileName, SenderName, SenderEMail, RecepientName, RecepientEMail: String) : Integer; var message: TMapiMessage; lpSender, lpRecepient: TMapiRecipDesc; FileAttach: TMapiFileDesc; SM: TFNMapiSendMail; MAPIModule: HModule; begin FillChar(message, SizeOf(message), 0); with message do begin if (Subject<>'') then begin lpszSubject := PChar(Subject) end; if (Body<>'') then begin lpszNoteText := PChar(Body) end; if (SenderEMail<>'') then begin lpSender.ulRecipClass := MAPI_ORIG; if (SenderName='') then begin lpSender.lpszName := PChar(SenderEMail) end else begin lpSender.lpszName := PChar(SenderName) end; lpSender.lpszAddress := PChar('SMTP:'+SenderEMail); lpSender.ulReserved := 0; lpSender.ulEIDSize := 0; lpSender.lpEntryID := nil; lpOriginator := @lpSender; end; if (RecepientEMail<>'') then begin lpRecepient.ulRecipClass := MAPI_TO; if (RecepientName='') then begin lpRecepient.lpszName := PChar(RecepientEMail) end else begin lpRecepient.lpszName := PChar(RecepientName) end; lpRecepient.lpszAddress := PChar('SMTP:'+RecepientEMail); lpRecepient.ulReserved := 0; lpRecepient.ulEIDSize := 0; lpRecepient.lpEntryID := nil; nRecipCount := 1; lpRecips := @lpRecepient; end else begin lpRecips := nil end; if (FileName='') then begin nFileCount := 0; lpFiles := nil; end else begin FillChar(FileAttach, SizeOf(FileAttach), 0); FileAttach.nPosition := Cardinal($FFFFFFFF); FileAttach.lpszPathName := PChar(FileName); nFileCount := 1; lpFiles := @FileAttach; end; end; MAPIModule := LoadLibrary(PChar(MAPIDLL)); if MAPIModule=0 then begin Result := -1 end else begin try @SM := GetProcAddress(MAPIModule, 'MAPISendMail'); if @SM<>nil then begin Result := SM(0, Application.Handle, message, MAPI_DIALOG or MAPI_LOGON_UI, 0); end else begin Result := 1 end; finally FreeLibrary(MAPIModule); end; end; if Result<>0 then begin MessageDlg('Error sending mail ('+IntToStr(Result)+').', mtError, [mbOk], 0) end; end;

    Read the article

  • Feedback on Optimizing C# NET Code Block

    - by Brett Powell
    I just spent quite a few hours reading up on TCP servers and my desired protocol I was trying to implement, and finally got everything working great. I noticed the code looks like absolute bollocks (is the the correct usage? Im not a brit) and would like some feedback on optimizing it, mostly for reuse and readability. The packet formats are always int, int, int, string, string. try { BinaryReader reader = new BinaryReader(clientStream); int packetsize = reader.ReadInt32(); int requestid = reader.ReadInt32(); int serverdata = reader.ReadInt32(); Console.WriteLine("Packet Size: {0} RequestID: {1} ServerData: {2}", packetsize, requestid, serverdata); List<byte> str = new List<byte>(); byte nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // Password Sent to be Authenticated string string1 = Encoding.UTF8.GetString(str.ToArray()); str.Clear(); nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // NULL string string string2 = Encoding.UTF8.GetString(str.ToArray()); Console.WriteLine("String1: {0} String2: {1}", string1, string2); // Reply to Authentication Request MemoryStream stream = new MemoryStream(); BinaryWriter writer = new BinaryWriter(stream); writer.Write((int)(1)); // Packet Size writer.Write((int)(requestid)); // Mirror RequestID if Authenticated, -1 if Failed byte[] buffer = stream.ToArray(); clientStream.Write(buffer, 0, buffer.Length); clientStream.Flush(); } I am going to be dealing with other packet types as well that are formatted the same (int/int/int/str/str), but different values. I could probably create a packet class, but this is a bit outside my scope of knowledge for how to apply it to this scenario. If it makes any difference, this is the Protocol I am implementing. http://developer.valvesoftware.com/wiki/Source_RCON_Protocol

    Read the article

  • How to download file into string with progress callback?

    - by Kaminari
    I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

< Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >