Search Results

Search found 5885 results on 236 pages for 'finally'.

Page 197/236 | < Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >

• Connection hangs after time of inactivity

  - by Sinuhe

  In my application, Spring manages connection pool for database access. Hibernate uses these connections for its queries. At first glance, I have no problems with the pool: it works correctly with concurrent clients and a pool with only one connection. I can execute a lot of queries, so I think that I (or Spring) don't leave open connections. My problem appears after some time of inactivity (sometimes 30 minutes, sometimes more than 2 hours). Then, when Hibernate does some search, it lasts too much. Setting log4j level to TRACE, I get this logs: ... 18:27:01 DEBUG nsactionSynchronizationManager - Retrieved value [org.springframework.orm.hibernate3.SessionHolder@99abd7] for key [org.hibernate.impl.SessionFactoryImpl@7d2897] bound to thread [http-8080-Processor24] 18:27:01 DEBUG HibernateTransactionManager - Found thread-bound Session [org.hibernate.impl.SessionImpl@8878cd] for Hibernate transaction 18:27:01 DEBUG HibernateTransactionManager - Using transaction object [org.springframework.orm.hibernate3.HibernateTransactionManager$HibernateTransactionObject@1b2ffee] 18:27:01 DEBUG HibernateTransactionManager - Creating new transaction with name [com.acjoventut.service.GenericManager.findByExample]: PROPAGATION_REQUIRED,ISOLATION_DEFAULT 18:27:01 DEBUG HibernateTransactionManager - Preparing JDBC Connection of Hibernate Session [org.hibernate.impl.SessionImpl@8878cd] 18:27:01 TRACE SessionImpl - setting flush mode to: AUTO 18:27:01 DEBUG JDBCTransaction - begin 18:27:01 DEBUG ConnectionManager - opening JDBC connection Here it gets frozen for about 2 - 10 minutes. But then continues: 18:30:11 DEBUG JDBCTransaction - current autocommit status: true 18:30:11 DEBUG JDBCTransaction - disabling autocommit 18:30:11 TRACE JDBCContext - after transaction begin 18:30:11 DEBUG HibernateTransactionManager - Exposing Hibernate transaction as JDBC transaction [jdbc:oracle:thin:@212.31.39.50:30998:orcl, UserName=DEVELOP, Oracle JDBC driver] 18:30:11 DEBUG nsactionSynchronizationManager - Bound value [org.springframework.jdbc.datasource.ConnectionHolder@843a9d] for key [org.apache.commons.dbcp.BasicDataSource@7745fd] to thread [http-8080-Processor24] 18:30:11 DEBUG nsactionSynchronizationManager - Initializing transaction synchronization ... After that, it works with no problems, until another period of inactivity. IMHO, it seems like connection pool returns an invalid/closed connection, and when Hibernate realizes that, ask another connection to the pool. I don't know how can I solve this problem or things I can do for delimiting it. Any help achieving this will be appreciate. Thanks. EDIT: Well, it finally was due a firewall rule. Database detects the connection is lost, but pool (dbcp or c3p0) not. So, it tries to query the database with no success. What is still strange for me is that timeout period is very variable. Maybe the rule is specially strange or firewall doesn't work correctly. Anyway, I have no access to that machine and I can only wait for an explanation. :(

  Read the article

• Schema to support dynamic properties

  - by Johan Fredrik Varen

  Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

  Read the article

• java multipart POST library

  - by tom

  Is there a multipart POST library out there that achieve the same effect of doing a POST from a html form? for example - upload a file programmingly in Java versus upload the file using a html form. And on the server side, it just blindly expect the request from client side to be a multipart POST request and parse out the data as appropriate. Has anyone tried this? specifically, I am trying to see if I can simulate the following with Java The user creates a blob by submitting an HTML form that includes one or more file input fields. Your app sets blobstoreService.createUploadUrl() as the destination (action) of this form, passing the function a URL path of a handler in your app. When the user submits the form, the user's browser uploads the specified files directly to the Blobstore. The Blobstore rewrites the user's request and stores the uploaded file data, replacing the uploaded file data with one or more corresponding blob keys, then passes the rewritten request to the handler at the URL path you provided to blobstoreService.createUploadUrl(). This handler can do additional processing based on the blob key. Finally, the handler must return a headers-only, redirect response (301, 302, or 303), typically a browser redirect to another page indicating the status of the blob upload. Set blobstoreService.createUploadUrl as the form action, passing the application path to load when the POST of the form is completed. <body> <form action="<%= blobstoreService.createUploadUrl("/upload") %>" method="post" enctype="multipart/form-data"> <input type="file" name="myFile"> <input type="submit" value="Submit"> </form> </body> Note that this is how the upload form would look if it were created as a JSP. The form must include a file upload field, and the form's enctype must be set to multipart/form-data. When the user submits the form, the POST is handled by the Blobstore API, which creates the blob. The API also creates an info record for the blob and stores the record in the datastore, and passes the rewritten request to your app on the given path as a blob key.

  Read the article

• how to check if internal storage file has any data

  - by user3720291

  public class Save extends Activity { int levels = 2; int data_block = 1024; //char[] data = new char[] {'0', '0'}; String blankval = "0"; String targetval = "0"; String temp; String tempwrite; String string = "null"; TextView tex1; TextView tex2; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.save); Intent intent = getIntent(); Bundle b = intent.getExtras(); tex1 = (TextView) findViewById(R.id.textView1); tex2 = (TextView) findViewById(R.id.textView2); if(b!=null) { string =(String) b.get("string"); } loadprev(); save(); } public void save() { if (string.equals("Blank")) blankval = "1"; if (string.equals("Target")) targetval = "1"; temp = blankval + targetval; try { FileOutputStream fos = openFileOutput("data.gds", MODE_PRIVATE); fos.write(temp.getBytes()); fos.close(); } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} tex1.setText(blankval); tex2.setText(targetval); } public void loadprev() { String final_data = ""; try { FileInputStream fis = openFileInput("data.gds"); InputStreamReader isr = new InputStreamReader(fis); char[] data = new char[data_block]; int size; while((size = isr.read(data))>0) { String read_data = String.copyValueOf(data, 0, size); final_data += read_data; data = new char[data_block]; } } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} char[] tempread = final_data.toCharArray();; blankval = "" + tempread[0]; targetval = "" + tempread[1]; } } After much tinkering i have finally managed to get my save/load function to work, but it does have an error, pretty much i got it to work then i did a fresh reintall deleting data.gds, afterwards the save/load function crashes because the data.gds file has no previous values. can i use a if statment to check if data.gds has any values in it, if so how do i do it and if not, then what could i use instead?

  Read the article

• How do I write sql data into a textbox after a submit type event

  - by Matt

  Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

  Read the article

• How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

  - by DarkWalker

  So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

  Read the article

• Can't insert a record in a oracle database using C#

  - by Gya

  try { int val4 = Convert.ToInt32(tbGrupa.Text); string MyConString = "Data Source=**;User ID=******;Password=*****"; OracleConnection conexiune = new OracleConnection(MyConString); OracleCommand comanda = new OracleCommand(); comanda.Connection = conexiune; conexiune.Open(); comanda.Transaction = conexiune.BeginTransaction(); int id_stud = Convert.ToInt16(tbCodStud.Text); string nume = tbNume.Text; string prenume = tbPrenume.Text; string initiala_tatalui = tbInitiala.Text; string email = tbEmail.Text; string facultate = tbFac.Text; int grupa = Convert.ToInt16(tbGrupa.Text); string serie = tbSeria.Text; string forma_de_inv = tbFormaInvatamant.Text; DateTime data_acceptare_coordonare = dateTimePicker1.Value; DateTime data_sustinere_licenta = dateTimePicker2.Value; string sustinere = tbSustinereLicenta.Text; string parola_acces = tbParola.Text; try { comanda.Parameters.AddWithValue("id_stud", id_stud); comanda.Parameters.AddWithValue("nume", nume); comanda.Parameters.AddWithValue("prenume", prenume); comanda.Parameters.AddWithValue("initiala_tatalui", initiala_tatalui); comanda.Parameters.AddWithValue("facultate", facultate); comanda.Parameters.AddWithValue("email", email); comanda.Parameters.AddWithValue("seria", serie); comanda.Parameters.AddWithValue("grupa", grupa); comanda.Parameters.AddWithValue("forma_de_inv", forma_de_inv); comanda.Parameters.AddWithValue("data_acceptare_coordonare", data_acceptare_coordonare); comanda.Parameters.AddWithValue("data_sustinere_licenta", data_sustinere_licenta); comanda.Parameters.AddWithValue("sustinere_licenta", sustinere); comanda.Parameters.AddWithValue("parola_acces", parola_acces); comanda.Transaction.Commit(); MessageBox.Show("Studentul " + tbNume.Text + " " + tbPrenume.Text + " a fost adaugat în baza de date!"); } catch (Exception er) { comanda.Transaction.Rollback(); MessageBox.Show("ER1.1:" + er.Message); MessageBox.Show("ER1.2:" + er.StackTrace); } finally { conexiune.Close(); } } catch (Exception ex) { MessageBox.Show("ER2.1:"+ex.Message); MessageBox.Show("ER2.2:"+ex.StackTrace); }

  Read the article

• Android - cant read TXT files from SDcard on real mashine?

  - by JustMe

  Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

  Read the article

• Saving data in custom class via AppDelegate

  - by redspike

  I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

  Read the article

• Killing Mysql processes staying in sleep command.

  - by Shino88

  Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

  Read the article

• How to download file into string with progress callback?

  - by Kaminari

  I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Is there a way to enforce/preserve order of XML elements in an XML Schema?

  - by MarcoS

  Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

  Read the article

• Problem separating C++ code in header, inline functions and code.

  - by YuppieNetworking

  Hello all, I have the simplest code that I want to separate in three files: Header file: class and struct declarations. No implementations at all. Inline functions file: implementation of inline methods in header. Code file: normal C++ code for more complicated implementations. When I was about to implement an operator[] method, I couldn't manage to compile it. Here is a minimal example that shows the same problem: Header (myclass.h): #ifndef _MYCLASS_H_ #define _MYCLASS_H_ class MyClass { public: MyClass(const int n); virtual ~MyClass(); double& operator[](const int i); double operator[](const int i) const; void someBigMethod(); private: double* arr; }; #endif /* _MYCLASS_H_ */ Inline functions (myclass-inl.h): #include "myclass.h" inline double& MyClass::operator[](const int i) { return arr[i]; } inline double MyClass::operator[](const int i) const { return arr[i]; } Code (myclass.cpp): #include "myclass.h" #include "myclass-inl.h" #include <iostream> inline MyClass::MyClass(const int n) { arr = new double[n]; } inline MyClass::~MyClass() { delete[] arr; } void MyClass::someBigMethod() { std::cout << "Hello big method that is not inlined" << std::endl; } And finally, a main to test it all: #include "myclass.h" #include <iostream> using namespace std; int main(int argc, char *argv[]) { MyClass m(123); double x = m[1]; m[1] = 1234; cout << "m[1]=" << m[1] << endl; x = x + 1; return 0; } void nothing() { cout << "hello world" << endl; } When I compile it, it says: main.cpp:(.text+0x1b): undefined reference to 'MyClass::MyClass(int)' main.cpp:(.text+0x2f): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x49): undefined reference to 'MyClass::operator[](int)' main.cpp:(.text+0x65): undefined reference to 'MyClass::operator[](int)' However, when I move the main method to the MyClass.cpp file, it works. Could you guys help me spot the problem? Thank you.

  Read the article

• how SendMailMAPI is adjusted to support multiple file attachments

  - by Tom

  I have this code that sends just one attachment by time, how can I adjust this code to send 1-2 attachments? function SendMailMAPI(const Subject, Body, FileName, SenderName, SenderEMail, RecepientName, RecepientEMail: String) : Integer; var message: TMapiMessage; lpSender, lpRecepient: TMapiRecipDesc; FileAttach: TMapiFileDesc; SM: TFNMapiSendMail; MAPIModule: HModule; begin FillChar(message, SizeOf(message), 0); with message do begin if (Subject<>'') then begin lpszSubject := PChar(Subject) end; if (Body<>'') then begin lpszNoteText := PChar(Body) end; if (SenderEMail<>'') then begin lpSender.ulRecipClass := MAPI_ORIG; if (SenderName='') then begin lpSender.lpszName := PChar(SenderEMail) end else begin lpSender.lpszName := PChar(SenderName) end; lpSender.lpszAddress := PChar('SMTP:'+SenderEMail); lpSender.ulReserved := 0; lpSender.ulEIDSize := 0; lpSender.lpEntryID := nil; lpOriginator := @lpSender; end; if (RecepientEMail<>'') then begin lpRecepient.ulRecipClass := MAPI_TO; if (RecepientName='') then begin lpRecepient.lpszName := PChar(RecepientEMail) end else begin lpRecepient.lpszName := PChar(RecepientName) end; lpRecepient.lpszAddress := PChar('SMTP:'+RecepientEMail); lpRecepient.ulReserved := 0; lpRecepient.ulEIDSize := 0; lpRecepient.lpEntryID := nil; nRecipCount := 1; lpRecips := @lpRecepient; end else begin lpRecips := nil end; if (FileName='') then begin nFileCount := 0; lpFiles := nil; end else begin FillChar(FileAttach, SizeOf(FileAttach), 0); FileAttach.nPosition := Cardinal($FFFFFFFF); FileAttach.lpszPathName := PChar(FileName); nFileCount := 1; lpFiles := @FileAttach; end; end; MAPIModule := LoadLibrary(PChar(MAPIDLL)); if MAPIModule=0 then begin Result := -1 end else begin try @SM := GetProcAddress(MAPIModule, 'MAPISendMail'); if @SM<>nil then begin Result := SM(0, Application.Handle, message, MAPI_DIALOG or MAPI_LOGON_UI, 0); end else begin Result := 1 end; finally FreeLibrary(MAPIModule); end; end; if Result<>0 then begin MessageDlg('Error sending mail ('+IntToStr(Result)+').', mtError, [mbOk], 0) end; end;

  Read the article

• TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

  - by domsom

  I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

  Read the article

• asp:Button is not calling server-side function

  - by Richard Neil Ilagan

  Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

  Read the article

• ASP.NET Application Level vs. Session Level and Global.asax...confused

  - by contactmatt

  The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

  Read the article

• DB Design Pattern - Many to many classification / categorised tagging.

  - by Robin Day

  I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

  Read the article

• .NET datetime issue with SQL stored procedure

  - by DanO

  I am getting the below error when executing my application on a Windows XP machine with .NET 2.0 installed. On my computer Windows 7 .NET 2.0 - 3.5 I am not having any issues. The target SQL server version is 2005. This error started occurring when I added the datetime to the stored procedure. I have been reading alot about using .NET datetime with SQL datetime and I still have not figured this out. If someone can point me in the right direction I would appreciate it. Here is the where I believe the error is coming from. private static void InsertRecon(string computerName, int EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) { SqlConnection DBC = new SqlConnection("server=server;UID=InventoryServer;Password=pass;database=Inventory;connection timeout=30"); SqlCommand CMD = new SqlCommand(); try { CMD.Connection = DBC; CMD.CommandType = CommandType.StoredProcedure; CMD.CommandText = "InsertReconData"; CMD.Parameters.Add("@CNAME", SqlDbType.NVarChar); CMD.Parameters.Add("@ENCRYPTEXIST", SqlDbType.Int); CMD.Parameters.Add("@RUNTIME", SqlDbType.Time); CMD.Parameters.Add("@ENCRYPTSIZE", SqlDbType.BigInt); CMD.Parameters.Add("@TIMEWRITTEN", SqlDbType.DateTime); CMD.Parameters["@CNAME"].Value = computerName; CMD.Parameters["@ENCRYPTEXIST"].Value = EncryptState; CMD.Parameters["@RUNTIME"].Value = FindTime; CMD.Parameters["@ENCRYPTSIZE"].Value = EncryptSize; CMD.Parameters["@TIMEWRITTEN"].Value = timeWritten; DBC.Open(); CMD.ExecuteNonQuery(); } catch (System.Data.SqlClient.SqlException e) { PostMessage(e.Message); } finally { DBC.Close(); CMD.Dispose(); DBC.Dispose(); } } Unhandled Exception: System.ArgumentOutOfRangeException: The SqlDbType enumeration value, 32, is invalid. Parameter name: SqlDbType at System.Data.SqlClient.MetaType.GetMetaTypeFromSqlDbType(SqlDbType target) at System.Data.SqlClient.SqlParameter.set_SqlDbType(SqlDbType value) at System.Data.SqlClient.SqlParameter..ctor(String parameterName, SqlDbType dbType) at System.Data.SqlClient.SqlParameterCollection.Add(String parameterName, SqlDbType sqlDbType) at ReconHelper.getFilesInfo.InsertRecon(String computerName, Int32 EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) at ReconHelper.getFilesInfo.Main(String[] args)

  Read the article

• how to use window.onload?

  - by Patrick

  I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

  Read the article

• How to make html image clickable inside a TextView

  - by Gonan

  I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

  Read the article

• How to create an entity with a composite primary key containing a generated value.

  - by David

  Using Hibernate + annotations, I'm trying to do the following: Two entities, Entity1 and Entity2. Entity1 contains a simple generated value primary key. Entity2 primary key is composed by a simple generated value + the id of entity one (with a many to one relationship) Unfortunately, I can't make it work. Here is an excerpt of the code: @Entity public class Entity1 { @Id @GeneratedValue private Long id; private String name; ... } @Entity public class Entity2 { @EmbeddedId private Entity2PK pk = new Entity2PK(); private String miscData; ... } @Embeddable public class Entity2PK implements Serializable { @GeneratedValue private Long id; @ManyToOne private Entity1 entity; } void test() { Entity1 e1 = new Entity1(); e1.setName("nameE1"); Entity2 e2 = new Entity2(); e2.setEntity1(e1); e2.setMiscData("test"); Transaction transaction = session.getTransaction(); try { transaction.begin(); session.save(e1); session.save(e2); transaction.commit(); } catch (Exception e) { transaction.rollback(); } finally { session.close(); } } When I run the test method I get the following errors: Hibernate: insert into Entity1 (id, name) values (null, ?) Hibernate: call identity() Hibernate: insert into Entity2 (miscData, entity_id, id) values (?, ?, ?) 07-Jun-2010 10:51:11 org.hibernate.util.JDBCExceptionReporter logExceptions WARNING: SQL Error: 0, SQLState: null 07-Jun-2010 10:51:11 org.hibernate.util.JDBCExceptionReporter logExceptions SEVERE: failed batch 07-Jun-2010 10:51:11 org.hibernate.event.def.AbstractFlushingEventListener performExecutions SEVERE: Could not synchronize database state with session org.hibernate.exception.GenericJDBCException: Could not execute JDBC batch update at org.hibernate.exception.SQLStateConverter.handledNonSpecificException(SQLStateConverter.java:103) at org.hibernate.exception.SQLStateConverter.convert(SQLStateConverter.java:91) at org.hibernate.exception.JDBCExceptionHelper.convert(JDBCExceptionHelper.java:43) at org.hibernate.jdbc.AbstractBatcher.executeBatch(AbstractBatcher.java:254) at org.hibernate.engine.ActionQueue.executeActions(ActionQueue.java:266) at org.hibernate.engine.ActionQueue.executeActions(ActionQueue.java:167) at org.hibernate.event.def.AbstractFlushingEventListener.performExecutions(AbstractFlushingEventListener.java:298) at org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:27) at org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1001) at org.hibernate.impl.SessionImpl.managedFlush(SessionImpl.java:339) at org.hibernate.transaction.JDBCTransaction.commit(JDBCTransaction.java:106) at test.App.main(App.java:32) Caused by: java.sql.BatchUpdateException: failed batch at org.hsqldb.jdbc.jdbcStatement.executeBatch(Unknown Source) at org.hsqldb.jdbc.jdbcPreparedStatement.executeBatch(Unknown Source) at org.hibernate.jdbc.BatchingBatcher.doExecuteBatch(BatchingBatcher.java:48) at org.hibernate.jdbc.AbstractBatcher.executeBatch(AbstractBatcher.java:247) ... 8 more Note that I use HSQLDB. Any ideas about what is wrong ?

  Read the article

• can't insert arecord in a oracle database using C#

  - by Gya

  try { int val4 = Convert.ToInt32(tbGrupa.Text); string MyConString = "Data Source=**;User ID=******;Password=*****"; OracleConnection conexiune = new OracleConnection(MyConString); OracleCommand comanda = new OracleCommand(); comanda.Connection = conexiune; conexiune.Open(); comanda.Transaction = conexiune.BeginTransaction(); int id_stud = Convert.ToInt16(tbCodStud.Text); string nume = tbNume.Text; string prenume = tbPrenume.Text; string initiala_tatalui = tbInitiala.Text; string email = tbEmail.Text; string facultate = tbFac.Text; int grupa = Convert.ToInt16(tbGrupa.Text); string serie = tbSeria.Text; string forma_de_inv = tbFormaInvatamant.Text; DateTime data_acceptare_coordonare = dateTimePicker1.Value; DateTime data_sustinere_licenta = dateTimePicker2.Value; string sustinere = tbSustinereLicenta.Text; string parola_acces = tbParola.Text; try { comanda.Parameters.AddWithValue("id_stud", id_stud); comanda.Parameters.AddWithValue("nume", nume); comanda.Parameters.AddWithValue("prenume", prenume); comanda.Parameters.AddWithValue("initiala_tatalui", initiala_tatalui); comanda.Parameters.AddWithValue("facultate", facultate); comanda.Parameters.AddWithValue("email", email); comanda.Parameters.AddWithValue("seria", serie); comanda.Parameters.AddWithValue("grupa", grupa); comanda.Parameters.AddWithValue("forma_de_inv", forma_de_inv); comanda.Parameters.AddWithValue("data_acceptare_coordonare", data_acceptare_coordonare); comanda.Parameters.AddWithValue("data_sustinere_licenta", data_sustinere_licenta); comanda.Parameters.AddWithValue("sustinere_licenta", sustinere); comanda.Parameters.AddWithValue("parola_acces", parola_acces); comanda.Transaction.Commit(); MessageBox.Show("Studentul " + tbNume.Text + " " + tbPrenume.Text + " a fost adaugat în baza de date!"); } catch (Exception er) { comanda.Transaction.Rollback(); MessageBox.Show("ER1.1:" + er.Message); MessageBox.Show("ER1.2:" + er.StackTrace); } finally { conexiune.Close(); } } catch (Exception ex) { MessageBox.Show("ER2.1:"+ex.Message); MessageBox.Show("ER2.2:"+ex.StackTrace); } }

  Read the article

• Casting objects in C# (ASP.Net MVC)

  - by Mortanis

  I'm coming from a background in ColdFusion, and finally moving onto something modern, so please bear with me. I'm running into a problem casting objects. I have two database tables that I'm using as Models - Residential and Commercial. Both of them share the majority of their fields, though each has a few unique fields. I've created another class as a container that contains the sum of all property fields. Query the Residential and Commercial, stuff it into my container, cunningly called Property. This works fine. However, I'm having problems aliasing the fields from Residential/Commercial onto Property. It's quite easy to create a method for each property: fillPropertyByResidential(Residential source) and fillPropertyByCommercial(Commercial source), and alias the variables. That also works fine, but quite obviously will copy a bunch of code - all those fields that are shared between the two main Models. So, I'd like a generic fillPropertyBySource() that takes the object, and detects if it's Residential or Commercial, fills the particular fields of each respective type, then do all the fields in common. Except, I gather in C# that variables created inside an If are only in the scope of the if, so I'm not sure how to do this. public property fillPropertyBySource(object source) { property prop = new property(); if (source is Residential) { Residential o = (Residential)source; //Fill Residential only fields } else if (source is Commercial) { Commercial o = (Commercial)source; //Fill Commercial only fields } //Fill fields shared by both prop.price = (int)o.price; prop.bathrooms = (float)o.bathrooms; return prop; } "o" being a Commercial or Residential only exists within the scope of the if. How do I detect the original type of the source object and take action? Bear with me - the shift from ColdFusion into a modern language is pretty..... difficult. More so since I'm used to procedural code and MVC is a massive paradigm shift. Edit: I should include the error: The name 'o' does not exist in the current context For the aliases of price and bathrooms in the shared area.

  Read the article

< Previous Page | 193 194 195 196 197 198 199 200 201 202 203 204  | Next Page >